Primer group for detecting aquatic pathogenic vibrio shavieri M05 and kit containing primer group

Abstract

The invention discloses a primer group for detecting aquatic pathogen vibrio shavieri M05 and a kit containing the primer group, and belongs to the technical field of aquatic pathogen detection. The primer group comprises an RPA (recombinase polymerase amplification) primer pair for amplifying a specific fragment of aquatic pathogenic vibrio shavieri M05 and crRNA (complementary ribose nucleic acid). Based on the primer group, recombinase polymerase amplification (RPA) and a CRISPR / Cas12a system are used for detecting the vibrio shavieri M05, the detection efficiency is greatly improved, the detection cost is reduced, meanwhile, the primer group has efficient specificity and sensitivity, the lowest detection limit of the vibrio shavieri M05 is 100 CFU / mL, and the primer group has a great application prospect in detection of aquatic pathogen vibrio shavieri M05.

Description

Technical Field

[0001] The present invention belongs to the technical field of aquatic pathogen detection, and particularly relates to a primer set for detecting the aquatic pathogen Vibrio sabio M05 and a kit containing the primer set. Background Art

[0002] Vibrio chagasii M05 was recently identified as the pathogen causing disease in marine invertebrates such as oysters, resulting in significant economic losses to the aquaculture industry. On TCBS plates, V. chagasii M05 appears as round, opaque yellow colonies with smooth, moist surfaces and neat edges, approximately 1-2 mm in diameter. Electron microscopy reveals that the isolated strain is short rod-shaped. Oyster seed infected with this pathogen lose vitality, become whitish, and show no feeding, with an overall mortality rate exceeding 80%. Therefore, V. chagasii M05 is highly harmful. Genome sequencing analysis revealed that the M05 strain carries virulence genes, including the secondary colonization factor AcfB, hemolysin, and the type II secretion pathway gene EpsD. Furthermore, the strain itself and its plasmids harbor numerous drug-resistance genes. Antimicrobial susceptibility testing revealed that the strain is sensitive to ciprofloxacin, tigecycline, and penicillins, and exhibits strong resistance to penicillins, aminoglycosides, and cephalosporins. It is difficult to control the harm of this pathogen through ordinary antibiotic treatment. Therefore, early detection and effective control of this infectious pathogen are crucial to ensure the stable development of the aquaculture industry.

[0003] The traditional method is to isolate, purify, enrich and culture the pathogens, and identify the species of the pathogens by combining morphology, physiological and biochemical characteristics and molecular biology. This method is time-consuming and labor-intensive, and requires a high level of professional and technical knowledge from the identifier, making it unsuitable for use in farms and grassroots breeders.

[0004] In terms of molecular biology testing, polymerase chain reaction (PCR) and quantitative real-time PCR (qPCR) technologies are the gold standard methods for pathogen nucleic acid detection. However, these methods are relatively time-consuming and have high requirements for detection conditions and equipment, which limits their rapid on-site pathogen detection outside the laboratory.

[0005] Therefore, there is an urgent need to provide a method suitable for on-site rapid detection of the aquatic pathogen Vibrio salpingii M05, so as to timely discover, control and prevent the further spread of the pathogen as soon as possible, which is of great significance to reducing aquaculture risks and protecting the economic interests of the aquaculture industry. Summary of the Invention

[0006] In view of the problems existing in the prior art, the object of the present invention is to provide a primer set for detecting the aquatic pathogen Vibrio saboriformis M05 and a kit containing the primer set.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] A primer set for detecting the aquatic pathogen Vibrio saboriae M05, the primer set comprising an RPA primer pair and crRNA for amplifying a specific fragment of the aquatic pathogen Vibrio saboriae M05;

[0009] The nucleic acid sequences of the RPA primer pair for amplifying the aquatic pathogen Vibrio salpingii M05-specific fragment are shown in SEQ ID NO: 1 and SEQ ID NO: 2;

[0010] The nucleic acid sequence of the crRNA is shown in SEQ ID NO: 3.

[0011] Application of the primer set for detecting aquatic pathogen Vibrio saburoi M05 in preparing a reagent for detecting aquatic pathogen Vibrio saburoi M05.

[0012] A kit for detecting aquatic pathogen Vibrio saburoi M05 based on the RPA-CRISPR / Cas12a system, the kit comprising an RPA primer pair and crRNA for amplifying a specific fragment of the aquatic pathogen Vibrio saburoi M05;

[0013] The nucleic acid sequences of the RPA primer pair for amplifying the aquatic pathogen Vibrio salpingii M05-specific fragment are shown in SEQ ID NO: 1 and SEQ ID NO: 2;

[0014] The nucleic acid sequence of the crRNA is shown in SEQ ID NO: 3.

[0015] Based on the above scheme, the kit for detecting aquatic pathogen Vibrio salpingii M05 based on the RPA-CRISPR / Cas12a system also includes Cas12a protein and a fluorescent probe.

[0016] On the basis of the above scheme, the fluorescent probe is a FAM-5'-TTTATTT (biotin) TATT-3'-BHQ reporter compatible probe.

[0017] Based on the above scheme, the method for using the kit for detecting aquatic pathogen Vibrio salpingii M05 based on the RPA-CRISPR / Cas12a system is as follows:

[0018] Using the DNA of the sample to be tested as a template, RPA amplification was performed using the primer pair shown in SEQ ID NO: 1 and SEQ ID NO: 2; the product obtained by RPA amplification was detected by CRISPR / Cas12a using crRNA.

[0019] Based on the above scheme, the RPA amplification condition is incubation at 39°C for 20 minutes.

[0020] Based on the above scheme, the CRISPR / Cas12a reaction conditions were incubation at 37°C for 20 minutes.

[0021] Based on the above scheme, the CRISPR / Cas12a reaction system is: 10 μL of 100 nM Cas12a protein, 0.5 μL of 2 μM fluorescent probe, 0.2 μL of 30 μM crRNA, 4 μL of 5× detection buffer, 5.3 μL of RPA amplification product, and the total reaction system is 20 μL.

[0022] Based on the above scheme, the components of the 5× detection buffer are: 20 mM HEPES, 10 mM MgCl 2 , 150 mM KCl and 0.5 mM TCEP.

[0023] Advantages of the technical solution of the present invention

[0024] The primer set and crRNA of the present invention are designed based on a specific sequence in the Vibrio sabio M05 gene.

[0025] Based on the above primer set, the present invention uses recombinase polymerase amplification (RPA) and CRISPR / Cas12a system to detect Vibrio saburo M05, which greatly improves detection efficiency and reduces detection costs. At the same time, it has high specificity and sensitivity. The minimum detection limit for Vibrio saburo M05 is 100 CFU / mL, which has great application prospects in the detection of aquatic pathogen Vibrio saburo M05. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is an SDS-PAGE gel image of Cas12a protein (wherein, lanes 1-6 represent the protein expression of 6 single colonies of the same species in the same bacterial plate, and the area framed in red is the expression band of Cas12a protein);

[0027] Figure 2 This is a sensitivity analysis chart of RPA-CRISPR / Cas12a in detecting aquatic pathogen Vibrio salpingii M05 (where "ns" indicates that the relative fluorescence intensity value of this group is not significantly different from that of the control negative group, and "*" indicates that the relative fluorescence intensity value of this group is significantly different from that of the control negative group);

[0028] Figure 3 This is a gel image showing the sensitivity analysis of PCR detection of aquatic pathogen Vibrio salpingii M05 (the red framed area is the target DNA band of the PCR product);

[0029] Figure 4 Specific fluorescence photos and quantitative fluorescence data of RPA-CRISPR / Cas12a detecting the aquatic pathogen Vibrio salpingii M05 (the left picture is a fluorescence photo, and the right picture is a quantitative fluorescence data graph);

[0030] Figure 5 These are the results of PCR and RPA-CRISPR / Cas12a testing of real samples (A is the PCR test result, and B is the RPA-CRISPR / Cas12a test result). DETAILED DESCRIPTION

[0031] The terms used in the present invention, unless otherwise specified, generally have the meanings commonly understood by those of ordinary skill in the art. Below, in conjunction with specific examples, the present invention will be further described in detail with reference to data. The following examples are merely for illustration of the present invention and are not intended to limit the scope of the present invention in any way.

[0032] The experimental methods in the following examples, unless otherwise specified, are all conventional methods and are performed according to the techniques or conditions described in the literature in this field or according to the product instructions. The experimental materials, reagents, and drugs used in the following examples, unless otherwise specified, can all be purchased through general channels.

[0033] The samples in the present invention can be samples containing the aquatic pathogen Vibrio salpingii M05, such as cells and their culture media used in infection experiments, or specimens and cultured cells from living organisms, or samples from living organisms suspected of being infected with the aquatic pathogen Vibrio salpingii M05. These samples can be pre-treated by separation, extraction, concentration, purification, etc.

[0034] The sample was pre-amplified using the RPA primers of the present invention, and then the RPA amplification product was detected by the CRISPR / Cas12a system, and the negative and positive were judged by the fluorescence brightness of the CRISPR reaction product.

[0035] The Vibrio saburoi used in the present invention is a dominant strain M05 isolated from diseased oyster larvae (Ge Hui, Li Huiyao, Wu Qisheng, et al. Isolation, identification and whole genome analysis of Vibrio saburoi, a pathogenic bacterium of Fujian oysters [J / OL]. Journal of Xiamen University (Natural Science Edition), 1-10 [2024-11-30]. http: / / kns.cnki.net / kcms / detail / 35.1070.N.20240912.1835.002.html.). The present invention detects the toxR gene of Vibrio saburoi M05.

[0036] The partial nucleic acid sequence (5'→3') of the toxR gene of Vibrio saboriani M05 amplified in the following examples is as follows: TAAAACTGTGCCTAAACGCGGCTACCAATTTATCGCAACCGTTGAGCGCTCAGCCCCA CTTTCGTCAAATGACCAACCTGCTGCAGTTGAAATTGCCGAAAATGACGTAGAACCAA GCCTAACGTTTGCAACAACACCTGTCGCAGAAGAAGTCGTTTCTGAGAC (SEQ ID NO: 7)

[0037] Example 1

[0038] A primer set for detecting the aquatic pathogen Vibrio saburoi M05, wherein the primer set comprises an RPA primer pair and crRNA for amplifying a specific fragment of the aquatic pathogen Vibrio saburoi M05.

[0039] The nucleic acid sequence of the RPA primer pair for amplifying the aquatic pathogen Vibrio salpingii M05 specific fragment is as follows:

[0040] toxR-RPA-F: 5'-TAAAACTGTGCCTAAACGGCGGCTACCAATT-3' (SEQ ID NO: 1);

[0041] toxR-RPA-R: 5'-GTCTCAGAAACGACTTCTTCTGCGACAGGT-3' (SEQ ID NO: 2).

[0042] The crRNA sequence is as follows:

[0043] crRNA: 5'-GTCAAATGACCAACCTGCTGCAG-3' (SEQ ID NO: 3).

[0044] Example 2

[0045] A kit for detecting the aquatic pathogen Vibrio saburo M05 based on the RPA-CRISPR / Cas12a system, the kit comprising an RPA primer pair and crRNA for amplifying a specific fragment of the aquatic pathogen Vibrio saburo M05, and also comprising a Cas12a protein and a fluorescent probe.

[0046] The nucleic acid sequence of the RPA primer pair for amplifying the aquatic pathogen Vibrio salpingii M05 specific fragment is as follows:

[0047] toxR-RPA-F: 5'-TAAAACTGTGCCTAAACGGCGGCTACCAATT-3' (SEQ ID NO: 1);

[0048] toxR-RPA-R: 5'-GTCTCAGAAACGACTTCTTCTGCGACAGGT-3' (SEQ ID NO: 2).

[0049] The crRNA sequence is as follows:

[0050] crRNA: 5'-GTCAAATGACCAACCTGCTGCAG-3' (SEQ ID NO: 3);

[0051] The crRNA can be prepared in the following manner:

[0052] The crRNA required for the CRISPR / Cas12a system is obtained through in vitro T7 transcription. Primers for crRNA transcription templates are obtained through PCR amplification. Subsequently, an in vitro DNA transcription reaction is performed using 1 μL of the target DNA template, 1 μL of transcriptase, and 8 μL of buffer, which is then made up to 20 μL with water. The reaction is incubated at 37°C for 4 hours. DNA degrading enzyme is then added to remove the DNA template in a clean hood, and an RNA purification agent is used to remove organic salts and proteins from the solution. The resulting crRNA is stored at -20°C for subsequent use.

[0053] The fluorescent probe is a FAM-5'-TTTATTT (biotin) TATT-3'-BHQ reporter-compatible probe (SEQ ID NO: 6), which was purchased from Beijing Baoying Tonghui Biotechnology Co., Ltd.

[0054] The Cas12a protein can be obtained from commercial channels or prepared as follows:

[0055] The plasmid pET28b-Cas12a was introduced into Escherichia coli BL21 (DE3) by heat shock to obtain bacteria that can express Cas12a protein. The bacteria were cultured in 750 mL LB medium at 37°C for 2 hours and 1 mM IPTG was added. The theoretical size of Cas12a protein is about 140 kDa. The bacteria were induced at 18°C ​​for about 24 hours to express the protein. The SDS-PAGE gel is shown below. Figure 1 As shown, it can be seen that the protein bands are consistent with the theoretical size.

[0056] Example 3

[0057] The method for detecting aquatic pathogen Vibrio salpingii M05 based on the RPA-CRISPR / Cas12a system is as follows:

[0058] (1) extracting DNA from the sample using conventional methods or DNA kits in the art;

[0059] (2) Using the extracted DNA as a template, perform RPA amplification;

[0060] The RPA isothermal amplification kit was purchased from Xiamen Corelet Biotechnology Co., Ltd. The kit components include: lyophilized powder (24T / pkg), 2.5× Rehydration Buffer and 20× Mg(OAc)2, each kit has 96T (50μL).

[0061] The RPA reaction system (50 μL) is:

[0062] 2 μL each of RPA forward and reverse primers (0.4 μM), 20 μL of 2.5×Rehydration Buffer, and 5.5 μL of the DNA template to be tested were added to a test tube containing lyophilized powder (1 portion), and then water was added to the entire reaction system to 47.5 μL. After mixing evenly, 2.5 μL of 20×Mg(OAc)2 was added to the PCR tube cap and centrifuged to mix.

[0063] RPA reaction procedure: 39°C for 20 min.

[0064] The RPA forward and reverse primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0065] (3) performing CRISPR / Cas12a detection using the product obtained by RPA amplification in step (2);

[0066] The reaction system is (20 μL): 10 μL (100 nM) of Cas12a protein, 0.5 μL (2 μM) of fluorescent probe, 0.2 μL (30 μM) of crRNA, 4 μL of 5× detection buffer (the components of the detection buffer are: 20 mM HEPES, 10 mM MgCl2, 150 mM KCl and 0.5 mM TCEP), 5.3 μL of RPA amplification product, and the total reaction system is 20 μL.

[0067] Reaction procedure: incubate at 37°C for 20 min.

[0068] The nucleic acid sequence of the crRNA is shown in SEQ ID NO: 3, and the fluorescent probe is a FAM-5'-TTTATTT (biotin) TATT-3'-BHQ reporter compatible probe (SEQ ID NO: 6).

[0069] (4) Result observation: The results were visually observed using the blue LED illumination of a gel imager, or the reaction solution was placed in a 96-well plate and the data were quantified using a multifunctional microplate reader.

[0070] Sensitivity of the RPA-CRISPR / Cas12a system for detecting the aquatic pathogen Vibrio salpingii M05

[0071] Aquatic pathogen Vibrio salpingii M05 was cultured in a shaker at 25°C. A bacterial suspension with a McFarland turbidity of about 0.5 was prepared. 1 mL of the bacterial suspension was sequentially pipetted into 9 mL of PBS buffer to prepare gradient dilutions. 100 μL of the bacterial suspension was then spread onto an agar plate and incubated at 25°C for 24 hours. The bacterial suspensions at different gradients were counted. Finally, the bacterial suspensions at different concentration gradients (10 6 , 10 5 , 10 4 , 10 3 , 10 2 , 10, 1 and 0 CFU / mL) as templates to evaluate the sensitivity of the RPA-CRISPR / Cas12a system. PCR was also used for detection. The specific method is as follows: 1 μL of bacterial solution with different concentration gradients, 1 μL of PCR forward primer, 1 μL of PCR reverse primer, 10 μL of sterile water, and then 10 μL of 2× Taq Master Mix were added and mixed in a PCR tube. The relevant parameters were set according to the PCR instrument for PCR amplification. The amplified samples were detected by agarose gel electrophoresis and compared with the fluorescence intensity measurement results of the microplate reader of the RPA-CRISPR / Cas12a method.

[0072] The sequences of the PCR forward primer and PCR reverse primer are as follows:

[0073] PCR-F: 5'-TAAAACTGTGCCTAAACGCGG-3' (SEQ ID NO: 4);

[0074] PCR-R: 5'-ACGACTTCTTCTGCGACAGG-3' (SEQ ID NO: 5).

[0075] The above template was tested using the method of Example 3, and the results were as follows: Figure 2 As shown. The detection limit of RPA-CRISPR / Cas12a fluorescence detection for the aquatic pathogen Vibrio salpingii M05 is approximately 100 CFU / mL. PCR was also used to detect and analyze the above templates, and the results are shown. Figure 3 As shown in the figure, the PCR method also has a detection limit of 100 CFU / mL for the aquatic pathogen Vibrio salpingii M05. Experimental results demonstrate that the RPA-CRISPR / Cas12a fluorescence method has comparable detection sensitivity to PCR, but is simpler and more convenient, making it more suitable for rapid, on-site pathogen detection outside the laboratory.

[0076] Specificity of the RPA-CRISPR / Cas12a system-based method for detecting aquatic pathogen Vibrio salpingii M05

[0077] The aquatic pathogen Vibrio chagasii M05 (Vibrio chagasii), Escherichia coli (E. coli), Vibrio parahaemolyticus (AHPND), and Staphylococcus aureus (S. aureus) were isothermally amplified under their respective RPA primers, and PBS without any substance was used as a negative control group (Control). The crRNA shown in SEQ ID NO: 3 was added to each of the five amplification products, and CRISPR / Cas12a fluorescence detection was subsequently performed to evaluate the specificity of the method for detecting the aquatic pathogen Vibrio chagasii M05 based on the RPA-CRISPR / Cas12a system.

[0078] The results are as follows Figure 4 As shown in the fluorescence images and fluorescence intensity measurements, it is clear that only the characteristic substrate sequence of the aquatic pathogen Vibrio salpinosa M05 can activate the detection activity of Cas12a, which is significantly different from the other groups. This shows that crRNA can only react specifically with the corresponding aquatic pathogen Vibrio salpinosa M05 sequence and can be used to detect aquatic pathogen Vibrio salpinosa M05.

[0079] Example 4

[0080] Detection of aquatic pathogen Vibrio salpingii M05 in real samples based on RPA-CRISPR / Cas12a system

[0081] Multiple real oyster tissue samples infected with Vibrio salpingii M05 were numbered and placed in centrifuge tubes. Sterile PBS solution was added and the tissues were ground in a grinder. To release bacterial nucleic acids, the suspension was heated at 95°C for 10 minutes. After centrifugation, the supernatant was collected as the processed real sample. A small amount of sample was taken as needed for RPA amplification and CRISPR / Cas12a detection using the method of Example 3. After the reaction was completed, visual observation was performed under the illumination of the blue LED of the gel imager. After observation, the solution was placed in a 96-well plate for data quantification using a multifunctional microplate reader.

[0082] PCR testing is generally considered the gold standard for current nucleic acid detection methods. Therefore, PCR was also used to detect the aquatic pathogen Vibrio salpingii M05 as a control for verification. The specific method is as follows: 1 μL of the supernatant after grinding the sample to be tested, 1 μL of PCR forward primer, 1 μL of PCR reverse primer, and 10 μL of sterile water were added, followed by 10 μL of 2× Taq Master Mix. The mixture was mixed in a PCR tube. PCR amplification was performed according to the relevant parameters set in the PCR instrument. The amplified sample was analyzed by agarose gel electrophoresis and compared with the fluorescence intensity measurement results of the RPA-CRISPR / Cas12a method using a microplate reader.

[0083] The sequences of the PCR forward primer and PCR reverse primer are as follows:

[0084] PCR-F: 5'-TAAAACTGTGCCTAAACGCGG-3' (SEQ ID NO: 4);

[0085] PCR-R: 5'-ACGACTTCTTCTGCGACAGG-3' (SEQ ID NO: 5).

[0086] The results are as follows Figure 5 As shown:

[0087] PCR test results are as follows Figure 5 As shown in (A), Vibrio salpingii M05 is present in samples 1, 4, 6, and 8. The results of RPA-CRISPR / Cas12a fluorescence detection are shown in Figure 5 As shown in (B), by measuring the fluorescence parameters and comparing them with the PCR detection results, it can be found that the positive and negative group results obtained by RPA-CRISPR / Cas12a fluorescence detection are the same as the PCR results, indicating the true reliability of the RPA-CRISPR / Cas12a detection system and its application in the detection of Vibrio serratioma M05 infection in real aquaculture processes.

[0088] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other manner. Any person skilled in the art may utilize the above-disclosed technical content to modify or modify the present invention into equivalent embodiments. However, any simple modifications, equivalent variations, and modifications to the above embodiments that do not depart from the technical content of the present invention and are based on the technical essence of the present invention remain within the scope of protection of the present invention.

Claims

1. A primer set for detecting aquatic pathogenic Vibrio saboriformis M05, characterized in that: The primer set comprises an RPA primer pair and crRNA for amplifying aquatic pathogenic Vibrio saboriformis M05-specific fragment; The nucleic acid sequences of the RPA primer pair for amplifying the specific fragment of the aquatic pathogen Vibrio saboriformis M05 are shown in SEQ ID NO: 1 and SEQ ID NO: 2; The nucleic acid sequence of the crRNA is shown in SEQ ID NO:

3.

2. Use of the primer set for detecting aquatic pathogen Vibrio saborioni M05 according to claim 1 in preparing a reagent for detecting aquatic pathogen Vibrio saborioni M05.

3. A kit for detecting aquatic pathogenic Vibrio sabio M05 based on the RPA-CRISPR / Cas12a system, characterized in that: The kit comprises an RPA primer pair and crRNA for amplifying a specific fragment of aquatic pathogen Vibrio saboriformis M05; The nucleic acid sequences of the RPA primer pair for amplifying the specific fragment of the aquatic pathogen Vibrio saboriformis M05 are shown in SEQ ID NO: 1 and SEQ ID NO: 2; The nucleic acid sequence of the crRNA is shown in SEQ ID NO:

3.

4. According to claim 3, a kit for detecting aquatic pathogenic Vibrio sabio M05 based on the RPA-CRISPR / Cas12a system, characterized in that: It also contains Cas12a protein and fluorescent probe.

5. According to claim 4, a kit for detecting aquatic pathogenic Vibrio sabio M05 based on the RPA-CRISPR / Cas12a system, characterized in that: The fluorescent probe is a FAM-5'-TTTATTT (biotin) TATT-3'-BHQ reporter compatible probe.

6. A kit for detecting aquatic pathogenic Vibrio saboriformis M05 based on the RPA-CRISPR / Cas12a system according to any one of claims 3 to 5, characterized in that: How to use: Using the DNA of the sample to be tested as a template, RPA amplification was performed using the primer pairs shown in SEQ ID NO: 1 and SEQ ID NO: 2; the product obtained by RPA amplification was detected by CRISPR / Cas12a using crRNA.

7. According to claim 6, a kit for detecting aquatic pathogenic Vibrio sabio M05 based on the RPA-CRISPR / Cas12a system, characterized in that: The RPA amplification condition is incubation at 39° C. for 20 min.

8. According to claim 6, a kit for detecting aquatic pathogenic Vibrio sabio M05 based on the RPA-CRISPR / Cas12a system, characterized in that: The CRISPR / Cas12a reaction conditions were incubated at 37°C for 20 min.

9. According to claim 6, a kit for detecting aquatic pathogenic Vibrio saboriformis M05 based on the RPA-CRISPR / Cas12a system, characterized in that: The CRISPR / Cas12a reaction system is: 10 μL of 100 nM Cas12a protein, 0.5 μL of 2 μM fluorescent probe, 0.2 μL of 30 μM crRNA, 4 μL of 5× detection buffer, 5.3 μL of RPA amplification product, and the total reaction system is 20 μL.

10. The kit for detecting aquatic pathogenic Vibrio saboriformis M05 based on the RPA-CRISPR / Cas12a system according to claim 9, characterized in that: The composition of the 5× detection buffer is: 20 mM HEPES, 10 mM MgCl2, 150 mM KCl and 0.5 mM TCEP.

Images