Lecanicillium aphanocladiii hou 1 and application thereof

Abstract

The invention relates to a Lecanicillium aphanocladiii hou 1 and an application thereof, the Lecanicillium aphanocladiii hou 1 is preserved in the Guangdong Microbiological Culture Collection Center, the preservation number of the Lecanicillium aphanocladiii hou 1 is GDMCC No: 64188, and the preservation date is December 24, 2023. The Lecanicillium aphanocladiii hou 1 disclosed by the invention has strong infectivity on green peach aphids, shows high pathogenicity and can be used for preventing and treating the green peach aphids. Long-term infection biology and indoor biological assay show that the strain has a very strong infection insecticidal effect on green peach aphids, and the strain is a biocontrol fungus, can be used as a living biopesticide, can be singly used or mixed with other insecticides, and has very strong application potential in biological prevention and control of green peach aphids.

Description

Technical Field

[0001] The invention belongs to the technical field of biological control, and particularly relates to a wax scale fungus strain Lecanicillium aphanocladii with high pathogenicity to green peach aphid and an application thereof. Background Art

[0002] Myzus persicae (Sulzer), also known as tobacco aphid and peach red aphid, belongs to the order Hemiptera, family Aphididae. It is a polyphagous pest with a wide host range. It can harm more than 400 plant species from 50 families, such as tobacco, fruit trees and vegetables. After feeding, peach aphids directly cause a decrease in plant yield and quality. They can also spread 115 plant viruses such as potato leaf roll virus and beet yellow web disease (accounting for 67.7% of the 170 plant viruses spread by aphids). The losses caused by these viral diseases are far greater than their direct harm.

[0003] Due to its short era cycle, parthenogenesis, large number of occurrence, and winged aphid migration, it is very easy to cause damage, so chemical control is still the main method in production. Due to repeated use of large doses, peach aphids in the field have developed resistance not only to some traditional insecticides, such as organophosphates, carbamates, pyrethroids, neonicotinoids, pymetrozine, etc., but also to some new insecticides that have entered the market in recent years, such as spirotetramat, flonicamid, flupyrazone, and diprofil. Peach aphid is one of the three aphids in the world with the longest history of drug resistance and the most profound impact. Resistance can only increase the dosage of drugs to control peach aphids in the field, which has led to a series of problems such as the mass death of peach aphids' natural enemies, loss of biodiversity, and environmental pollution. Faced with such a passive situation, it is urgent to study and apply non-chemical means to control peach aphids.

[0004] In the comprehensive prevention and control of peach aphids, biological control has become one of the most effective and promising means of prevention and control of peach aphids and other pests due to its advantages of being green, environmentally friendly, and long-lasting. Biological control is a biological method that uses beneficial organisms and their products to inhibit or control harmful organisms. Biological control includes parasitic natural enemies, predatory natural enemies, and microbial methods. Compared with natural enemy insects, the use of microorganisms to control peach aphids is less. Therefore, seeking effective microbial products and application technologies is one of the main research directions for the prevention and control of peach aphids in the future. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects and technical deficiencies of existing methods for controlling peach aphids, and to provide a Lecanicillium aphanocladii strain with high pathogenicity to peach aphids and its application; the fungus is an insect pathogenic fungus and can be used as a living biological pesticide with high pathogenicity to peach aphids for controlling peach aphids.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A strain of Lecanicillium aphanocladii,

[0008] The Lecanicillium aphanocladii Hu 1 strain is deposited in the Guangdong Provincial Microbiological Culture Collection Center, with the strain collection number: GDMCC No: 64188, the collection date: December 24, 2023, and the collection address is Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0009] The lecanicillium aphanocladii fungus strain belongs to the order Hypocreales, the family Cordyceps, and the genus Lecanicillium. The mycelium is white, and the reverse side of the colony is red, reddish white or creamy, and the soluble pigment color is red. Single, paired, whorled or irregularly clustered conidia structures are produced on the creeping hyphae, and the conidiophores are flask-shaped at the beginning, gradually become thinner, and end at a solitary conidia structure, and the conidia are oval to elliptical.

[0010] The Lecanicillium aphanocladii Hu1 strain has strong infectivity to peach aphids and exhibits high pathogenicity.

[0011] The application of the Lecanicillium aphanocladii strain in preventing and controlling peach aphids.

[0012] The method for preparing the spore suspension of the Lecanicillium aphanocladii Hu1 strain comprises the following steps: using a 5mm puncher to punch out three mycelium blocks of the Lecanicillium aphanocladii Hu1 strain, inoculating the blocks into a PDB liquid culture medium at an inoculation rate of 2-5%, fermenting at a temperature of 26-28°C, rotating at a speed of 150-180 rpm, and fermenting for 10-15 days; filtering the fermented liquid with sterile gauze to obtain a conidia suspension, namely the spore suspension.

[0013] Preferably, in order to separate the hyphae from the spores, the mixture is shaken on a vortex shaker for 45 to 90 minutes to separate the hyphae from the spores, and then filtered through 8 layers of sterile gauze to obtain a spore suspension.

[0014] A spore suspension of Lecanicillium aphanocladii Hu1 prepared by the preparation method.

[0015] The invention discloses an application of the spore suspension of the lecanicillium aphanocladii strain in preventing and controlling peach aphids.

[0016] Bioassay tests showed that the conidia of the above-mentioned Lecanicillium aphanocladii Hu1 strain showed strong toxicity to peach aphid.

[0017] Moreover, the above-mentioned conidia suspension of Lecanicillium aphanocladii was sprayed at the early stage of the occurrence of peach aphids (10 6 ~10 8 spores / ml) to control peach aphid.

[0018] The spore dilution of the Lecanicillium aphanocladii Hu1 strain is used in combination with a chemical insecticide to prevent and control peach aphids; the spore dilution of the Lecanicillium aphanocladii Hu1 strain is obtained by diluting the spore suspension of the Lecanicillium aphanocladii Hu1 strain with sterile water.

[0019] The conidia suspension of the Lecanicillium aphanocladii Hu 1 strain can be used alone, or mixed with chemical insecticides such as imidacloprid, thiamethoxam, acetamiprid, spirotetramat, flonicamid, thiacloprid, flupyradone, sulfoxaflor, and pymetrozine, and sprayed for control in the early stage of peach aphid infestation.

[0020] Application of spore suspension of Lecanicillium aphanocladii Hu 1 in preventing and controlling peach aphids, and application of spore suspension of Lecanicillium aphanocladii Hu 1 in preventing and controlling diseases caused by peach aphids, and application of spore suspension of Lecanicillium aphanocladii Hu 1 in preparing drugs for preventing and controlling diseases caused by peach aphids.

[0021] The spore dilution of the Lecanicillium aphanocladii Hu1 strain is mixed with 0.1%-0.2% surfactant for use in preventing and controlling peach aphids; the spore dilution of the Lecanicillium aphanocladii Hu1 strain is obtained by diluting the spore suspension of the Lecanicillium aphanocladii Hu1 strain with sterile water.

[0022] The surfactant is a mixture of one or more of calcium dodecylbenzene sulfonate, castor oil polyoxyethylene ether, Tween 20, dodecyl polyoxyethylene ether, nonylphenol polyoxyethylene ether phosphate, fatty acid polyoxyethylene ester, and Trion-100.

[0023] Compared with the prior art, the invention has the following advantages: a Lecanicillium aphanocladii Hu1 strain with high pathogenicity to green peach aphid is screened and obtained; long-term infection biology and indoor bioassays show that the strain has a strong infection and insecticidal effect on green peach aphid; moreover, the strain is a biocontrol fungus and can be used as a living biological pesticide, which can be used alone or mixed with other insecticides, and has very strong application potential in the biological control of green peach aphid. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Colony morphology of Lecanicillium aphanocladii Hu1.

[0025] Figure 2 Conidia of Lecanicillium aphanocladii Hu1.

[0026] Figure 3 Micrograph of the wax scale fungus strain Lecanicillium aphanocladii Hu1 infecting green peach aphid.

[0027] Figure 4 Bioassay of the wax scale fungus strain Lecanicillium aphanocladii Hu1 against peach aphid.

[0028] Figure 5 After spraying the spores of Lecanicillium aphanocladii Hu1, the green peach aphids on the leaves were infected and died. Among them, the pink and shriveled ones were dead aphids. DETAILED DESCRIPTION

[0029] The present invention is further described below with reference to specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0030] Unless otherwise specified, all reagents and materials used in the present invention are commercially available.

[0031] 1. Source of Materials

[0032] (1) Potato dextrose agar (PDA): Peel 200 g of potatoes, cut into small pieces, add 1 L of water, boil for 20 min, filter through gauze, add 20 g of glucose and 18-20 g of agar, stir to dissolve and mix, make up to the volume in a conical flask, and sterilize in an autoclave (121°C, 30 min) for 30 min.

[0033] (2) Aseptic operation conditions: All utensils and equipment must be sterilized in an autoclave at 121°C for 30 min. Inoculation and other operations must be performed in a clean bench.

[0034] (3) Culture conditions: Culture in a 25°C constant temperature incubator in the dark. After the colonies have grown, transfer to a PDA slant and culture for 4 days before storing in a refrigerator at 4°C.

[0035] Example 1. Isolation, purification and identification of Lecanicillium aphanocladii Hu1

[0036] First, disinfect the surface of the infected aphids with 75% alcohol for 30 seconds, and then disinfect with 5% sodium hypochlorite solution for 30 seconds. After disinfection, rinse the sample three times in sterile water, pick the hyphae on the surface of the sample with a sterile toothpick and inoculate it into the PDA plate, and culture it in the dark in a 25℃ constant temperature box. After the colony is formed, purify each strain by single spore separation. The purified strain is transferred to the PDA slant and then stored in a 4℃ refrigerator.

[0037] After culturing on PDA medium at 25°C for 10 days, the diameter of the colony is 30-50 mm, and after culturing for 14 days, the diameter is 65-75 mm. The mycelium is white, and the reverse side of the colony is red, reddish-white or cream-colored. The soluble pigment is red, such as Figure 1 shown.

[0038] Microscopic morphological characteristics of the strains Figure 2 As shown, single, paired, whorled or irregularly clustered conidial structures are produced on the creeping hyphae. The conidiophores are flask-shaped at first, gradually become thinner, and there is a solitary conidial structure at the end. The conidia are oval to elliptical and measure 2.7-4×1.5-2.2 μm.

[0039] Molecular identification results

[0040] The ITS sequence obtained by sequencing sample Hu 1 is 509bp. The nucleotide homology comparison between the ITS sequence of the bacterium and the registered sequences in Genebank using the Blast program shows that the homology between the ITS sequence of the bacterium and Lecanicillium aphanocladii is 100%, and the homology between the ITS sequence of the bacterium and Lecanicillium dimorphum is 99.63%. The LSU rRNA gene sequence obtained by sequencing is 540bp. The nucleotide homology comparison between the ITS sequence of the bacterium and the registered sequences in Genebank using the Blast program shows that the homology between the LSU rRNA gene sequence of the bacterium and Lecanicillium aphanocladii is 100%, and the homology between the ITS sequence of the bacterium and Lecanicillium dimorphum is 99.63%. The ITS and LSU rRNA gene sequencing sequences of strain Hu 1 have the highest homology with Lecanicillium aphanocladii (filamentous wax scale fungus), reaching 100%; its culture characteristics and microscopic morphological characteristics are most similar to Lecanicillium aphanocladii (filamentous wax scale fungus). Based on the above identification, the sample is Lecanicillium aphanocladii (filamentous wax scale fungus).

[0041] ITS sequencing sequence of sample Hu 1:

[0042] TACCATGATG TTGCTTCGGC GGACTCGCCC CGGCGTCCGG ACGGCCTAGC GCCGCCCGCG

[0043] GCCCGGATCC AGGCGGCCGC CGGAGACCAC CAAAACTATT TTGTATCAGC AGTTTTTTCT

[0044] GAATCCGCCG CAAGGCAAAA CAAATGAATC AAAACTTTCA ACAACGGATC TCTTGGTTCT

[0045] GGCATCGATG AAGAACGCAG CGAAATGCGA TAAGTAATGT GAATTGCAGA ATTCAGTGAA

[0046] TCATCGAATC TTTGAACGCA CATTGCGCCC GCCAGCATTC TGGCGGGCAT GCCTGTTCGA

[0047] GCGTCATTTC AACCCTCGAC TTCCCTTTGG GGAAATCGGC GTTGGGGACT GGCAGCATAC

[0048] CGCCGGCCCC GAAATGGAGT GGCGGCCCGT CCGCGGCGAC CTCTGCGTAG TAATCCAACC

[0049] TCGCACCGGA ACCCCGACGT GGCCACGCCG TAAAACACCC CACTTTCTGAACGTTGACCTCGGATCAGGTAGGAATACCC GCTGAACTT(SEQ ID NO:1)

[0050] Sequencing sequence of the LSU rRNA gene of Sample Hu1:

[0051] CCGGCGCAGG GTATTACGCA ATGGGCTATA ACACTCCCGA GGGAGCCACA TTCCCAAAGC

[0052] CTTTATCCCC CGCGCCAAAC TGATGCTGGC CTGTGCCCGG CAAAGTGCAC CAGCGAGAAC

[0053] GCTGGATGAT TCACCGGGCC CAAGTCTGGT CATAGGCGCT TCCCTTTCAA CAATTTCACG

[0054] TACTTTTTAA CCCTCTTTTC AAAGTGCTTT TCATCTTTCG ATCACTCTAC TTGTGCGCTA

[0055] TCGGTCTCTG GCCAATATTT AGCTTTAGAA GACATATACC TCCCATTTTG AGCAGCATTC

[0056] CCAAACTACT CGACTCGTCG AAGGAACTTT ACAGAGGCTT GGTATCCGAC CAGACGGGGC

[0057] TCTCACCCTC TATGGCGTCC CGTTCCAGGG AACTCGGAAG GCACCTCGCC AAAAGTATCC

[0058] TCTACAAATT ACAATTCGGA CCCGAGGGCC AGATTTCAAA TTTGAGCTGT TGCCGCTTCA

[0059] CTCGCCGTTA CTGGGGCAAT CCCTGTTGGT TTCTTTTCCT CCGCTTATTG ATATGCTTAA(SEQID NO:2)

[0060] Example 2: Determination of pathogenicity of Lecanicillium aphanocladii strain to Myzus persicae

[0061] Green peach aphid, from the greenhouse of the Institute of Plant Protection, Fujian Academy of Agricultural Sciences, using the successive propagation population of pakchoi.

[0062] Bioassay is one of the methods to determine the toxicity and lethality of entomogenous fungi to target pests, and can provide an important reference for the comprehensive evaluation of the biological control potential of the entomogenous fungi. In this study, the pathogenicity of the wax scale fungus strain Lecanicillium aphanocladii Hu1 to different ages of peach aphid was determined to clarify the differences and concentrations of its toxicity to different stages of peach aphid.

[0063] Preparation of spore suspension: Use a 5mm puncher to punch out three mycelium blocks from the Lecanicillium aphanocladii Hu 1 strain, inoculate them into PDB liquid culture medium, ferment at 25-28°C, rotate at 150-180rpm, and after 10-15 days of fermentation, filter the fermentation liquid with 8 layers of sterile gauze to obtain a spore suspension. Use the hemocytometer to count the spore concentration of the Lecanicillium aphanocladii Hu 1 strain under a research-grade microscope (BX61), and dilute it with sterile water to prepare a spore dilution of the Lecanicillium aphanocladii Hu 1 strain. Take 6 portions of the spore dilution and add 0.1% Triton-100 aqueous solution to prepare 1.0×10 3 , 1.0×10 4 , 1.0×10 5 , 1.0×10 6 , 1.0×10 7 , 1.0×10 8 Spores / mL of solution at six concentrations.

[0064] The toxicity of Lecanicillium aphanocladii Hu1 to peach aphid was determined by leaf dipping method. Cabbage leaves were immersed in different spore dilutions prepared with Triton-100 for 15 seconds, taken out and dried naturally, and then placed in a round box with a 0.3 cm layer of 2% agar at the bottom, sealed with a perforated sealing film, and the death of peach aphids was investigated after 5 days. Figure 3 , 4 shown.

[0065] Table 1 Regression equation and parameters of pathogenicity of Lecanococcus cereus to adult peach aphids

[0066] Insect stage Slope <![CDATA[LC 50 (spores / ml)]]> 95% confidence interval (spores / ml) <![CDATA[χ 2 ]]> 1st instar nymph 0.37(0.03) <![CDATA[1.26×10 5 ]]> <![CDATA[(5.88×10 4 -2.5×10 5 )]]> 1.87(df=5) 2nd instar nymph 0.4(0.03) <![CDATA[2.63×10 5 ]]> <![CDATA[(1.35×10 5 -4.94×10 5 )]]> 2.55(df=5) 3rd instar nymph 0.37(0.03) <![CDATA[3.84×10 5 ]]> <![CDATA[(1.9×10 5 -7.51×10 5 )]]> 1.02(df=5) 4th instar nymph 0.39(0.03) <![CDATA[7.81×10 5 ]]> <![CDATA[(3.86×10 5 -1.51×10 5 )]]> 2.47(df=5) Wingless female aphid 0.41(0.25) <![CDATA[3.86×10 6 ]]> <![CDATA[(2.04×10 6 -7.15×10 6 )]]> 0.975(df=5)

[0067] The results of bioassay showed that the Lecanicillium aphanocladii Hu1 strain was infectious to peach aphids of different ages, and was more pathogenic to young peach aphids.

[0068] Example 3 Control effect of Lecanicillium aphanocladii strain on peach aphid

[0069] In the peach orchard of Lantan Village, Daqiao Town, Gutian County, Ningde City, 0.1% Triton-100 was used to spray the spore dilution of Lecanus fasciatus once at the early stage of the outbreak (the spore dilution was diluted with 0.1% Triton-100 to a final concentration of 10 7 Spores / ml, 10 6 Spores / ml, 10 5 Spores / ml), imidacloprid and thiacloprid were used as controls. The insect population was investigated on the eve of application, and the number of surviving insects was investigated once every 3, 5, 10, 14, and 21 days after application, for a total of 6 times. The investigation method adopted a fixed-plant and fixed-tip investigation. Two peach trees were investigated in each plot. Two insect-infested tips were selected from each tree in five different directions: east, south, west, north, and center, and the number of live insects on each tip was investigated and recorded. Compared with the blank control area, the relative control effect was calculated. The test results show that the application of Lecanicillium aphanocladii spore dilution has a good control effect on peach aphids in the early stage of peach aphid infestation. 7 days and 10 days after application, the control effect on peach aphids is equal to or better than the control agent imidacloprid and thiamethoxam treatment, while 14 days and 21 days after application, the control effect of Lecanicillium aphanocladii spore dilution is significantly higher than that of imidacloprid and thiamethoxam treatment, indicating that the spore dilution of Lecanicillium aphanocladii has a longer lasting effect (Table 2)

[0070] Table 2 Results of the test on the efficacy of Lecanopsis fasciatus against peach aphids

[0071] deal with 3 days 7 days 10 days 14 days 21 days 70% Imidacloprid water dispersible granules 5000 times 78.88％a 83.94％a 87.14％b 79.77％b 60.53％c 25% Thiamethoxam water dispersible granules 3000 times 81.56％a 87.95％a 88.28% ab 80.80％b 67.81％b <![CDATA[Lecanicillium psalliotae 10 7 spores / ml]]> 71.08% ab 89.32％a 94.40％a 93.27％a 84.50％a <![CDATA[Lecanicillium psalliotae 10 6 spores / ml]]> 68.64%ab 87.88％a 92.82%ab 92.12％a 83.30％a <![CDATA[Isaria farinosa 10 5 spores / ml]]> 63.84％b 88.13％a 90.00% ab 91.81％a 81.28％a

[0072] Note: The same letters in the same column in the table indicate no significant difference at the 0.05 level (DMRT method)

[0073] Example 4 The efficacy of the mixture of Lecanococcus spp. 1 and different insecticides against Pakchoi peach aphid

[0074] In the early stage of peach aphid outbreak, thiamethoxam, flonicamid, spirotetramat and a mixed insecticide prepared by adding spore dilutions of Lecanicillium aphanocladii to the three insecticides were sprayed on the pakchoi fields in Dahu Village, Dahu Township, Minhou County, Fuzhou City, once each; the three insecticides were sprayed with a concentration of 10 5 After the spore dilutions of Lecanicillium aphanocladii with spores / ml were mixed, the spore concentration in the prepared mixed insecticide was 10 6 spores / ml, investigate the insect population base before applying the pesticide, and investigate the number of surviving insects once every 3, 5, 10, 14 and 21 days after applying the pesticide, for a total of 6 times. Survey method: In each plot, 5 Chinese cabbages were fixed and investigated, and the number of live insects on each shoot was recorded. Compared with the blank control area, the relative control effect was calculated (Table 3). The results showed that the addition of spore dilutions of the filamentous wax scale fungus strain Lecanicillium aphanocladii Hu 1 can significantly increase the rapidity and persistence of thiamethoxam, flonicamid and spirotetramat against peach aphids of Chinese cabbage. After spraying the spore dilutions of the filamentous wax scale fungus strain Lecanicillium aphanocladii Hu 1, the situation of peach aphids on the leaves was as follows Figure 5 As shown, the pink shrunken ones are dead aphids.

[0075] Table 3 The results of the test on the efficacy of Leucocephalus spp. in controlling Pakchoi peach aphid

[0076]

[0077] Note: The same letters in the same column in the table indicate no significant difference at the 0.05 level (DMRT method)

[0078] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A strain of Lecanicillium aphanocladii, characterized in that: The Lecanicillium aphanocladii Hu 1 strain is deposited in the Guangdong Provincial Microbiological Culture Collection Center, with the strain collection number: GDMCC No: 64188 and the collection date: December 24, 2023.

2. The Lecanicillium aphanocladii fungus strain according to claim 1, characterized in that: The strain belongs to the Hypocreales, Cordyceps family, and Lecanopsis genus.

3. The Lecanicillium aphanocladii strain according to claim 1, characterized in that: The Lecanicillium aphanocladii Hu1 strain has strong infectivity to green peach aphids and exhibits high pathogenicity.

4. Use of the Lecanicillium aphanocladii strain according to claim 1 in controlling green peach aphids.

5. The method for preparing a spore suspension of the lecanicillium aphanocladii fungus strain according to claim 1, characterized in that: The lecanicillium aphanocladii Hu1 strain is inoculated into a PDB liquid culture medium at an inoculation rate of 2-5%, the fermentation temperature is 26-28 DEG C, the rotation speed is 150-180 rpm, the fermentation culture time is 10-15 days, and the spore suspension is filtered.

6. A spore suspension of the Lecanicilliumaphanocladii strain obtained by the preparation method as claimed in claim 5.

7. Use of the spore suspension of the Lecanicillium aphanocladii strain as claimed in claim 6 in controlling green peach aphids.

8. The use according to claim 7, characterized in that: The spore dilution of the Lecanicillium aphanocladii Hu1 strain is used in combination with a chemical pesticide for preventing and controlling peach aphids; the spore dilution of the Lecanicillium aphanocladii Hu1 strain is obtained by diluting the spore suspension of the Lecanicillium aphanocladii Hu1 strain with sterile water.

9. The use according to claim 7, characterized in that: The spore dilution of the Lecanicillium aphanocladii Hu1 strain is mixed with 0.1%-0.2% surfactant for use in preventing and controlling peach aphids; the spore dilution of the Lecanicillium aphanocladii Hu1 strain is obtained by diluting the spore suspension of the Lecanicillium aphanocladii Hu1 strain with sterile water.

10. The use according to claim 9, characterized in that: The surfactant is a mixture of one or more of calcium dodecylbenzene sulfonate, castor oil polyoxyethylene ether, Tween 20, dodecyl polyoxyethylene ether, nonylphenol polyoxyethylene ether phosphate, fatty acid polyoxyethylene ester, and Trion-100.

Images