Method for synthesizing R-1, 3-butanediol through biological catalysis
By catalyzing 4-hydroxy-2-butanone by using carbonyl reductase of R-1,3-butanone, the problem of low conversion rate of biocatalytic preparation of R-1,3-butanediol was solved, and efficient and green R-1,3 was achieved. -Butanediol production, significantly improved conversion rate and purity, and is suitable for large-scale applications.
Patent Information
- Application Number
- CN202411511657.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-28
- Publication Date
- 2025-01-17
AI Technical Summary
In the prior art, the conversion rate of biocatalytic preparation of R-1,3-butanediol is relatively low, making it difficult to achieve efficient and large-scale production.
Carbonyl reductase derived from Resella 4-hydroxy-2-butanone was catalyzed by adding coenzyme NAD+ and isopropanol to phosphate buffer, and the temperature was controlled at 20~40℃ and the time was controlled at 12~48. The reaction during the hour increased the conversion rate of R-1,3-butanediol.
The high conversion rate of R-1,3-butanediol (up to 90%) and high purity (99%) are achieved, and the method is environmentally friendly, conforms to the concept of green chemistry, and is suitable for sustainable development.
Smart Images
Figure CN119320807A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of biocatalysis, and in particular to a method for synthesizing R-1,3-butanediol by biocatalysis. Background Art
[0002] As a widely used chiral intermediate, R-1,3-butanediol plays an important role in the synthesis of carbapenem antibiotics, azetidinone, spices, pheromones, pesticides and other substances. R-1,3-butanediol has always been prepared mainly by chemical methods. However, traditional chemical synthesis technology has many limitations, and the asymmetric bioreduction principle of carbonyl groups shows unique advantages. It has the advantages of strong stereoselectivity, high catalytic efficiency, mild reaction conditions and environmentally friendly production process. Therefore, in recent years, the method of using carbonyl reductase to asymmetric reduce 4-hydroxy-2-butanone to produce this type of chiral alcohol has attracted much attention.
[0003] At present, the main ways to obtain R-1,3-butanediol are chemical and biological methods. The early chemical synthesis method uses L-threonine as the starting material, and produces R-1,3-butanediol through four steps of nitrosation deamination, methylation, hydrogenation debromination and reduction. The purity of the product can reach 99%. However, the process has problems such as complex process, high toxicity of auxiliary materials and difficulty in recycling, which makes it difficult to achieve large-scale production. Eguchi et al. used a biological method to prepare R-1,3-butanediol by using immobilized SP382 lipase to repeatedly catalyze the double acylation reaction to split (R,S)-1,3-butanediol. Although its optical purity is above 98%, the conversion rate is relatively low, only 62%. Therefore, it is necessary to develop a method for synthesizing R-1,3-butanediol with high conversion rate. Summary of the invention
[0004] The invention provides a method for biocatalytically synthesizing R-1,3-butanediol, which solves the problem of low conversion rate of biocatalytically preparing R-1,3-butanediol in the related art.
[0005] The technical solution of the present invention is as follows: The present invention provides a method for biocatalytically synthesizing R-1,3-butanediol, comprising the following steps: Using 4-hydroxy-2-butanone as raw material, R-1,3-butanediol is obtained through carbonyl reductase catalysis. The carbonyl reductase is derived from Lysella Leifsonia sp. ), the amino acid sequence of the carbonyl reductase is shown as SEQ ID No.2, and the gene sequence encoding the carbonyl reductase is shown as SEQ ID No.1.
[0006] As a further technical solution, the carbonyl reductase is added in the form of whole cells, crude enzyme solution, lyophilized powder of crude enzyme solution, and pure enzyme solution.
[0007] As a further technical solution, the catalytic reaction further includes adding reaction buffer, coenzyme NAD + , isopropyl alcohol.
[0008] As a further technical solution, the reaction buffer is a phosphate buffer, and the addition amount of the phosphate buffer is 50-100 mmol / L.
[0009] As a further technical solution, the coenzyme NAD + The amount added is 1~5mmol / L.
[0010] As a further technical solution, the amount of isopropanol added is 10% v / v.
[0011] As a further technical solution, the added amount of the 4-hydroxy-2-butanone is 40-50 g / L.
[0012] As a further technical solution, the added amount of the carbonyl reductase is 70-100 g / L.
[0013] As a further technical solution, the temperature of the catalytic reaction is 20-40°C, preferably, the temperature of the catalytic reaction is 20-25°C; the time of the catalytic reaction is 12-48h, preferably, the time of the catalytic reaction is 12-24h.
[0014] As a further technical solution, the rotation speed of the catalytic reaction is 250~500rpm / min.
[0015] As a further technical solution, the carbonyl reductase is produced by Escherichia coli ) was cloned and expressed in BW25113.
[0016] The working principle and beneficial effects of the present invention are: In the present invention, R-1,3-butanediol is synthesized by a biocatalytic method, which has significant environmental friendliness. A bioenzyme catalyst is used throughout the process, which avoids the use of a large number of chemical reagents, reduces the discharge of waste and the pollution to the environment. Compared with the large amount of toxic and harmful substances produced by traditional chemical synthesis methods, this method is more in line with the concept of green chemistry and helps to achieve sustainable development. In the present invention, carbonyl reductase is used as a catalyst to catalyze the reaction of 4-hydroxy-2-butanone to obtain R-1,3-butanediol, and its conversion rate can reach 90% and the purity is 99%. The method for synthesizing R-1,3-butanediol has high selectivity, mild and efficient reaction conditions, and easy-to-obtain raw materials, which provides broad application prospects for the efficient and green production of R-1,3-butanediol. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] The present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.
[0018] Figure 1 This is the reaction principle diagram of carbonyl reductase catalyzing the synthesis of R-1,3-butanediol from 4-hydroxy-2-butanone; Figure 2 This is the peak diagram of gas chromatography detection of 4-hydroxy-2-butanone and R-1,3-butanediol standard products; Figure 3 This is the peak diagram of the reaction liquid gas chromatography detection. DETAILED DESCRIPTION
[0019] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0020] In the following embodiments, unless otherwise specified, all of them are conventional methods.
[0021] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.
[0022] Example 1 The method for preparing a carbonyl reductase engineering strain comprises the following steps: The gene encoding carbonyl reductase was artificially synthesized according to the gene shown in SEQ ID NO.1.
[0023] PCR amplification was performed using the carbonyl reductase gene obtained above as a template and ADH-F and ADH-R as primers.
[0024] ADH-F: cgggatccatggcgcagtacgatgtt; ADH-R: gaagcttttactgcgcggtgtaa.
[0025] The PCR reaction system is as follows: DNA template, about 50 ng; upstream and downstream primers (10 µM), 1 µL each; 5×PCR Buffer, 10 µL; dNTP Mix (2.5 mM each), 4 µL; PrimeSTAR HS DNA Polymerase, 0.5 µL, add water to a total volume of 50 µL.
[0026] PCR conditions were: 94°C for 5 min; 94°C for 30 s, 55°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 10 min.
[0027] The PCR amplification product was recovered by agarose gel kit, and after double digestion with BamHI and Hind III, it was connected to the pET-28a (+) vector and transformed into Escherichia coli BW25113. The positive transformants were screened on LB plates containing kanamycin (50 μg / mL) and sequenced for verification. The nucleotide sequence of the amplified product is shown in SEQ ID NO.1 in the sequence list, which can encode a protein composed of the amino acid sequence shown in SEQ ID NO.2 in the sequence list.
[0028] Example 2 The expression of carbonyl reductase and the preparation of whole cells, crude enzyme solution, crude enzyme lyophilized powder and pure enzyme solution include the following steps: The recombinant expression vector of carbonyl reductase was transferred into the competent cells of Escherichia coli BW25113, and cultured at 37°C for 16 hours. After the transformants grew out, a single transformant was inoculated into 5 mL LB medium containing kanamycin (50 μg / mL), and cultured at 37°C and 200 rpm for 16 hours. Then, it was inoculated into LB medium at a ratio of 1% (volume percentage), cultured at 37°C and 200 rpm until the OD600 value was about 0.6-0.8, IPTG was added at a final concentration of 0.1 mmol / L, induced culture was carried out at 25°C for 14 hours, and the bacteria were collected by centrifugation at 4°C and 10000 rpm for 5 minutes, which was the whole cell; The cells were resuspended and washed once with 50 mmol / L phosphate buffer at pH 7.0, and then ultrasonically disrupted. The cells were centrifuged at 10,000 rpm for 5 min to obtain the supernatant as the crude enzyme solution. The crude enzyme solution is freeze-dried to obtain the crude enzyme solution freeze-dried powder; The crude enzyme solution is purified by affinity chromatography nickel column to obtain pure enzyme solution.
[0029] Example 3 The method for determining the activity of carbonyl reductase comprises the following steps: Take an appropriate amount of fermentation liquid to determine the OD600 value, take 5 OD600 of the liquid and centrifuge it, take the precipitate and resuspend it in 1mL KPB buffer (50mM, pH7), ultrasonically disrupt it in ice water for 10min (power 200W), and centrifuge it at 12000rpm for 2min. Determination system: add 0.5mg / mL isopropanol and 2.5mM NAD + The absorbance at 340 nm was measured by UV spectrophotometer. + The change in absorbance value at 1 min represents the enzyme activity. Enzyme activity is defined as the amount of enzyme required to catalyze the production of 1 µmol NADH per minute, which is defined as 1 enzyme activity unit (U). The enzyme activity of carbonyl reductase was determined to be 64.3 U / mL.
[0030] Example 4 The method for preparing R-1,3-butanediol by using carbonyl reductase whole cell catalysis comprises the following steps: In a 1L fermentation tank, add 40g / L 4-hydroxy-2-butanone, 5mmol / L NAD + , 100g / L carbonyl reductase whole cells, 10% (v / v) isopropanol, and phosphate buffer (50mmol / L pH7) is added to 500mL, and the reaction is completed after stirring at 25℃ and 400rpm for 24h to obtain R-1,3-butanediol reaction solution. The reaction formula is as follows Figure 1 shown.
[0031] After the reaction is completed, potassium carbonate is added to the reaction solution until saturated, and then an equal volume of ethyl acetate is added for extraction, vortexed for 10 minutes, and centrifuged at 12000rpm for 2 minutes. The upper phase is filtered through a 0.22μm organic membrane and detected by gas chromatography. The gas phase detection conditions are: chiral column Supelco Gamma DEX 225 (30m*0.25mm*0.25μm), column temperature: 140℃, injection port temperature: 250℃, FID detector temperature: 280℃. The content of R-1,3-butanediol in the reaction solution is 36g / L, the conversion rate is 90%, and the purity is 99%. The gas chromatography detection peak diagram of 4-hydroxy-2-butanone and R-1,3-butanediol standard is shown in the figure Figure 2 As shown; the peak diagram of the reaction liquid gas chromatography detection is as shown Figure 3 shown.
[0032] Comparative Example 1 From Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia ) carbonyl reductase whole cell catalysis method for preparing R-1,3-butanediol, comprising the following steps: S1. Construct a carbonyl reductase engineering strain according to the method in Example 1, and prepare a whole cell of carbonyl reductase according to the method in Example 2; S2. The method for preparing R-1,3-butanediol using carbonyl reductase whole cells is the same as that in Example 4. The conversion rate of R-1,3-butanediol was measured to be 12% and the purity was 99%.
[0033] From Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia ) is shown as SEQ ID No.3, and the amino acid sequence is shown as SEQ ID No.4.
[0034] Comparative Example 2 Derived from Bacillus arguta Bacillus aryabhattai ) carbonyl reductase whole cell catalysis method for preparing R-1,3-butanediol, comprising the following steps: S1. Construct a carbonyl reductase engineering strain according to the method in Example 1, and prepare a whole cell of carbonyl reductase according to the method in Example 2; S2. The method for preparing R-1,3-butanediol using carbonyl reductase whole cells is the same as that in Example 4. The conversion rate of R-1,3-butanediol was measured to be 5% and the purity was 99%.
[0035] Derived from Bacillus arguta Bacillus aryabhattai )'s carbonyl reductase gene sequence is shown in SEQ ID No.5, and its amino acid sequence is shown in SEQ ID No.6.
[0036] Compared with Example 4, the comparative examples 1 and 2 used the Stenotrophomonas maltophilia ) and Bacillus argutatus ( Bacillus aryabhattai ) carbonyl reductase whole cells were used to prepare R-1,3-butanediol. The results showed that the conversion rates of R-1,3-butanediol in Comparative Examples 1 and 2 were lower than those in Example 4, indicating that the use of the carbonyl reductase whole cells from Rysostreae ( Leifsonia sp. ) carbonyl reductase to prepare R-1,3-butanediol, which can improve the conversion rate of R-1,3-butanediol.
[0037] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.
Claims
1. A method for biocatalytic synthesis of R-1,3-butanediol, characterized in that: The following steps are involved: Using 4-hydroxy-2-butanone as raw material, R-1,3-butanediol is obtained through carbonyl reductase catalysis. The carbonyl reductase is derived from Lysella Leifsonia sp. ), the amino acid sequence of the carbonyl reductase is shown as SEQ ID No.2, and the gene sequence encoding the carbonyl reductase is shown as SEQ ID No.
1.
2. The method for biocatalytic synthesis of R-1,3-butanediol according to claim 1, characterized in that: The carbonyl reductase is added in the form of whole cells, crude enzyme solution, lyophilized powder of crude enzyme solution, and pure enzyme solution.
3. The method for biocatalytic synthesis of R-1,3-butanediol according to claim 1, characterized in that: The catalytic reaction also adds reaction buffer, coenzyme NAD + , isopropyl alcohol.
4. The method for biocatalytic synthesis of R-1,3-butanediol according to claim 3, characterized in that: The reaction buffer is a phosphate buffer, and the addition amount of the phosphate buffer is 50-100 mmol / L.
5. The method for biocatalytic synthesis of R-1,3-butanediol according to claim 3, characterized in that: The coenzyme NAD + The amount added is 1~5mmol / L.
6. The method for biocatalytic synthesis of R-1,3-butanediol according to claim 3, characterized in that: The added amount of the isopropanol is 10% v / v.
7. The method for biocatalytic synthesis of R-1,3-butanediol according to claim 1, characterized in that: The added amount of the 4-hydroxy-2-butanone is 40-50 g / L.
8. The method for biocatalytic synthesis of R-1,3-butanediol according to claim 1, characterized in that: The added amount of the carbonyl reductase is 70-100 g / L.
9. The method for biocatalytic synthesis of R-1,3-butanediol according to claim 1, characterized in that: The temperature of the catalytic reaction is 20-40° C., and the time of the catalytic reaction is 12-48 hours.
10. The method for biocatalytic synthesis of R-1,3-butanediol according to claim 1, characterized in that: The carbonyl reductase is expressed in Escherichia coli ( Escherichia coli ) was cloned and expressed in BW25113.