SNP (Single Nucleotide Polymorphism) molecular marker related to lambing traits of sheep as well as detection primer group, kit and application of SNP molecular marker

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to lambing traits of sheep as well as a detection primer group, a kit and application of the SNP molecular marker, and belongs to the technical field of SNP molecular markers. The invention provides an application of an SNP (Single Nucleotide Polymorphism) molecular marker related to lambing traits of sheep in lambing detection or sheep breeding, the SNP molecular marker is located at the 18197516bp site of the genome sequence of the second chromosome ABCA1 of a sheep genome AR-UIRAbv2.0, and the base polymorphism is Tgt; and C. According to the method for detecting the single nucleotide polymorphism of the ABCA1 gene of the sheep and the application of the method, basic data is provided for molecular-assisted marker selective breeding of the sheep, and the improvement work of germplasm resources of the sheep in China is accelerated.

Description

Technical Field

[0001] The invention relates to the technical field of SNP molecular markers, and in particular to a SNP molecular marker associated with sheep multiplicity traits and a detection primer set, a kit and application thereof. Background Art

[0002] Reproductive performance is a key factor affecting the economic benefits of sheep farming, especially the number of lambs, which is controlled by the core indicator of micro-effect polygenes, has a low heritability (0.08-0.18), and the lambing traits of ewes are greatly affected by the environment and feeding conditions. The improvement of conventional breeding methods has been relatively slow. With the development of molecular marker technology, the use of molecular genetic markers closely related to lambing traits for precise selection can reduce the blindness in the breeding process, improve the efficiency of breeding, and speed up the breeding process.

[0003] To promote the development of the sheep industry, it is necessary to strengthen the selection and promotion of fine breeds, develop moderate-scale breeding, and promote the agricultural and animal husbandry cycle. Introducing foreign fine breeds, combining them with local breeds, and using advanced breeding technology to cultivate new sheep breeds is the core task, which can better promote the sheep industry to develop in a healthy, safe, and high-quality manner.

[0004] Dorper sheep grow fast, have good meat quality and strong resistance to adversity; Hu sheep have high fertility and are resistant to high temperature and humidity. Through the hybridization of Dorper sheep and Hu sheep, the Dorper-Hu hybrid sheep is obtained, which has the advantages of both and has improved growth rate and meat quality. The study of molecular markers of lambing number of Dorper-Hu hybrid sheep is of great significance to the development and utilization of sheep multi-birth resources and production practice, which helps to give full play to their reproductive potential, thus laying a solid foundation for the sustainable development of the sheep industry.

[0005] With the rapid development of molecular biology and genomics technology, high-throughput sequencing, genome selection, molecular markers and genetic modification technologies are becoming increasingly mature. Whole genome resequencing can detect genetic variations such as single nucleotide polymorphisms (SNPs) and insertions and deletions (Indels) through high-precision sequencing. Combined with bioinformatics analysis, it reveals key genes related to lambing traits, providing a new perspective for studying animal genetic characteristics. Sequenom MassARRAY technology is widely used for rapid verification and screening of known candidate gene loci due to its high throughput and high accuracy.

[0006] Combining whole genome resequencing with Sequenom MassARRAY technology can not only fully analyze the genetic basis of lambing traits in Duhu hybrid sheep, but also accelerate the breeding process and improve reproductive efficiency and economic benefits. This precision breeding method provides new opportunities for the development and utilization of sheep multi-birth resources, and is expected to promote the development of the sheep industry in the direction of high efficiency and high quality.

[0007] ATPbinding cassette transporter A1 (ABCA1) is a type of membrane integral protein encoded by the ABCA1 gene and is a member of the ABC superfamily. Currently, 7 ABC subfamilies with a total of 48 members have been discovered. The ABCA subfamily has a total of 12 members, among which ABCA1 is mainly responsible for the transport of cholesterol and phospholipids from the intracellular to the extracellular and participates in the production of high-density lipoprotein (HDL).

[0008] Studies have shown that homozygous female ABCA1-deficient mice show significant obstacles in reproduction, specifically reduced number of pregnancies and small litter size, indicating that there is a certain correlation between the ABCA1 gene and reproductive performance. This may be related to the important role of this gene in lipid metabolism. ABCA1 deficiency may lead to lipid metabolism imbalance, thereby affecting the function of reproductive organs and embryonic development, and ultimately leading to decreased reproductive capacity (Robert J. Aiello et al., 2003). Although ABCA1 gene polymorphisms have been studied in model animals such as mice, research in livestock has not yet been carried out, which provides a new direction for exploring the molecular basis of livestock reproductive performance. Summary of the invention

[0009] The purpose of the present invention is to provide a method for utilizing Sequenom The method and application of SNP technology to detect single nucleotide polymorphism of sheep ABCA1 gene provides basic data for molecular assisted marker selection breeding of sheep and accelerates the improvement of China's sheep germplasm resources.

[0010] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0011] The invention discloses an application of a SNP molecular marker related to the trait of sheep multiplication in sheep multiplication detection or sheep breeding. The SNP molecular marker is located at the 18197516 bp position of the ABCA1 genome sequence of chromosome 2 of the sheep genome ARS-UI_Ramb_v2.0, and the base polymorphism is T>C.

[0012] Preferably, the number of lambs born by ewes with the TT genotype at the site is significantly higher than that of ewes with the TC and CC genotypes.

[0013] The present invention also provides a primer set for detecting the SNP molecular marker in the application, the primer set comprises upstream and downstream primers and an extension primer, the upstream and downstream primer sequences are shown in SEQ ID NO.1-2, and the extension primer sequence is shown in SEQ ID NO.3.

[0014] The present invention also provides a kit for detecting the sheep multi-lamb trait using the primer set.

[0015] The present invention also provides the application of the primer set or the kit in sheep multiplicity detection or sheep breeding.

[0016] The present invention also provides a method for breeding sheep with strong reproductive ability using the primer set or the kit, comprising the following steps:

[0017] (1) Extracting the genetic DNA of the sheep to be tested;

[0018] (2) using the genomic DNA of the sheep to be tested as a template, and performing PCR amplification using the upstream and downstream primers in the primer set;

[0019] (3) digesting the PCR amplification product with SAP enzyme to obtain enzyme digestion product;

[0020] (4) using the enzyme digestion product as a template and using the extension primer to perform an extension reaction;

[0021] (5) Analyze the extension products and perform gene typing on the 18197516 bp locus of the sheep chromosome 2 ABCA1 genomic sequence;

[0022] (6) Breeding sheep whose genotype at the 18197516bp site is TT.

[0023] Preferably, the sheep are Duhu hybrid sheep.

[0024] Preferably, the reproductive capacity is the number of lambs born.

[0025] The present invention provides a SNP molecular marker, which is significantly associated with the lambing trait of sheep. The molecular marker can be used alone or in combination with existing markers to make high-precision predictions of the lambing trait of sheep, thereby providing stable and accurate results. This provides important support for improving the reproductive performance and breeding efficiency of sheep, accelerates the process of sheep germplasm improvement, and promotes the modernization of China's sheep industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the mass spectrometry detection result of the 18197516bp position of the chromosome 2 genome sequence of the Duhu hybrid sheep in Example 2. DETAILED DESCRIPTION

[0027] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0028] Example 1

[0029] 76 ewes with three consecutive birth records were selected, of which 43 showed continuous multiple births (≥2 births) and the other 33 showed continuous single births. In-depth whole-genome resequencing analysis was performed on the 76 samples, generating a total of 2679.69Gb of raw data. The average sequencing depth of each sample reached 11 times, and the average genome coverage was 98.2%. The comparison results with the reference genome showed a positioning rate of more than 99%, from which 36,655,095 high-quality SNP variations were successfully identified.

[0030] After data quality control, genome-wide association analysis (GWAS) was performed. The 30 SNP sites with the smallest P value were selected, and the selected SNPs sites were typed using MassARRAY detection technology, and a significance test was performed with the number of lambs. The ABCA1 gene was screened out as a gene that may affect the lambing trait.

[0031] In the process of studying SNPs in the sheep genome, it was found that the T>C mutation at the 18197516th base position of sheep chromosome 2 was significantly correlated with the sheep's multi-lamb trait.

[0032] Example 2

[0033] 2.1 Experimental Materials

[0034] Two hundred Duhu hybrid sheep with three consecutive litters were selected for venous blood sampling, DNA extraction and genotyping, and the association analysis between genotype and litter size was performed.

[0035] 2.2 Extraction of genomic DNA

[0036] Blood was collected from the jugular vein of sheep in 1.1 using a 2 ml EDTA negative pressure anticoagulation tube, and the blood was lysed and centrifuged using red blood cell lysis buffer to obtain a white precipitate, and genomic DNA was isolated using a standard phenol-chloroform extraction method. The concentration and purity of the extracted DNA were detected using a Nanodrop 2000 spectrophotometer and 1% agarose gel electrophoresis, and qualified DNA samples were stored at -80°C.

[0037] 2.3 Sequenom SNP technology for genotyping

[0038] The primer set was designed for the 18197516bp site of the sheep chromosome 2 genome sequence (based on the sheep genome sequence information version number ARS-UI_Ramb_v2.0). The sequence of the upstream primer used for PCR amplification is shown in SEQ ID NO.1, the sequence of the downstream primer is shown in SEQ ID NO.2, and the extension primer sequence is SEQ ID NO.3. The above primers were synthesized by Compson.

[0039] Upstream primer: ACGTTGGATGAAGCTGAGATGGAGCAGATG (SEQ ID NO.1)

[0040] Downstream primer: ACGTTGGATGCTGACAGCTGACTTGTCTTG (SEQ ID NO.2)

[0041] Extension primer: GAGTTTGCTGGGCGGCAA (SEQ ID NO. 3)

[0042] The testing process is as follows:

[0043] (1) Extracting the genetic DNA of the sheep to be tested;

[0044] (2) Using the genomic DNA of the sheep to be tested as a template, PCR amplification was performed using upstream and downstream primers;

[0045] (3) digesting the PCR amplification product with SAP enzyme to obtain enzyme digestion product;

[0046] (4) using the enzyme digestion product as a template and using an extension primer to perform an extension reaction;

[0047] (5) Analyze the extension product to determine the gene at the 18197516 bp position of the sheep chromosome 2 genome sequence.

[0048] 2.3.1 PCR amplification

[0049] Multiplex PCR technology was used, and the reaction system (384-well PCR plate + 38% reagent loss) was shown in Table 1. The PCR program was: 94°C pre-denaturation for 120 s, one repeat; 94°C denaturation for 20 s, 56°C annealing for 30 s, 72°C extension for 60 s, three processes for a total of 45 repeats; and finally 72°C extension for 3 min.

[0050] Table 1 PCR amplification reaction system

[0051]

[0052] 2.3.2SAP Processing

[0053] After the PCR amplification is completed, the PCR product shrimp alkaline phosphatase (SAP) treatment reaction solution (384-well PCR plate + 38% reagent loss) is prepared according to the ratio in Table 2. 2 μL of SAP treatment solution is placed in each well of the 384-well plate, and then the plate is placed in a PCR instrument to perform the following steps: this process is carried out at 37°C for 40 minutes; denaturation at 85°C for 5 minutes; each is carried out for one cycle.

[0054] Table 2SAP treatment reaction solution formula

[0055]

[0056]

[0057] 2.3.3 Extended processing

[0058] The composition information of the single base extension reaction solution is shown in Table 3. 2 μL of the single base extension reaction mixture was added to each well and mixed with the SAP-treated mixture, and the following steps were performed: 94°C for 30 s, one cycle; 94°C for 5 s, one cycle, 52°C for 5 s, 5 cycles, 80°C for 5 s, 5 cycles, and the three processes were repeated 40 times in total; 72°C for 3 min, one cycle.

[0059] Table 3 Single base extension reaction solution components

[0060]

[0061] 2.3.4 Product purification

[0062] The reaction product after the extension treatment was diluted and desalted, and the sample was spotted onto the target using a MassARRAYTM RS1000 spotter, and then mass spectrometry was performed until crystallization, and the data was collected and organized.

[0063] 2.3.5 Data collation

[0064] The mass spectrometry detection results of the 18197516bp position of the genome sequence of chromosome 2 of Duhu hybrid sheep are as follows Figure 1 As shown, the horizontal axis is the low molecular weight height (LowMass Height), and the vertical axis is the high molecular weight height (HighMassHeight). The results showed that there were 148 cases of TT genotype, 25 cases of TC genotype, and 27 cases of CC genotype.

[0065] The statistical results of different genotype analysis at the 18197516bp position of the sheep chromosome 2 genome sequence to be tested are shown in Tables 4 and 5.

[0066] Table 4 Genotype frequency and allele frequency at position 18197516bp in the genome sequence of sheep chromosome 2 in the Duhu hybrid sheep population

[0067]

[0068] From the statistical results in Table 4, it can be seen that the site conforms to the Hardy-Weinberg equilibrium.

[0069] Table 5 Association analysis between different genotypes at 18197516bp site of sheep chromosome 2 genome sequence and lambing size of Duhu hybrid sheep

[0070]

[0071] Note: Lowercase letters with different superscripts represent significant differences

[0072] From the statistical results in Table 5, it can be seen that the 18197516bp site of the sheep chromosome 2 genome sequence is closely associated with the number of lambs born in the first, second and third litters of Duhu hybrid sheep. The number of lambs born by TT type ewes at this site is significantly higher than that by CC type ewes.

[0073] In summary, the method provided by the present invention can realize automatic detection of SNP sites, screen out TT or TC individuals with the trait of multiple lambs, thereby improving the reproductive capacity of sheep, and is suitable for large-scale breeding of sheep with the trait of multiple lambs as the breeding goal.

[0074] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An application of a SNP molecular marker associated with the trait of sheep multiplicity in sheep multiplicity detection or sheep breeding, characterized in that: The SNP molecular marker is located at the 18197516bp position of the ABCA1 genome sequence of chromosome 2 in the sheep genome ARS-UI_Ramb_v2.0, and the base polymorphism is T>C.

2. The use according to claim 1, characterized in that: The number of lambs born by ewes with TT genotype at the said locus is significantly higher than that of ewes with TC and CC genotypes.

3. A primer set for detecting a SNP molecular marker in the use according to any one of claims 1 to 2, characterized in that: The primer set comprises upstream and downstream primers and an extension primer. The sequences of the upstream and downstream primers are shown in SEQ ID NO.1-2, and the sequence of the extension primer is shown in SEQ ID NO.

3.

4. A kit for detecting the multi-lamb trait in sheep comprising the primer set according to claim 3.

5. Use of the primer set according to claim 3 or the kit according to claim 4 in sheep multiplicity detection or sheep breeding.

6. A method for breeding sheep with strong reproductive ability using the primer set according to claim 3 or the kit according to claim 4, characterized in that: The steps include: (1) Extracting the genetic DNA of the sheep to be tested; (2) using the genomic DNA of the sheep to be tested as a template, and performing PCR amplification using the upstream and downstream primers in the primer set; (3) digesting the PCR amplification product with SAP enzyme to obtain enzyme digestion product; (4) using the enzyme digestion product as a template and using the extension primer to perform an extension reaction; (5) Analyze the extension products and perform gene typing on the 18197516 bp locus of the sheep chromosome 2 ABCA1 genomic sequence; (6) Breeding sheep whose genotype at the 18197516bp site is TT.

7. The method according to claim 6, characterized in that The sheep are Duhu hybrid sheep.

8. The method according to claim 7, characterized in that The reproductive capacity is the number of lambs born.

Images