Application of N-acetylglycine in preparation of medicine for preventing and treating radiation-induced lung injury

Abstract

The invention provides application of N-acetylglycine in preparation of a medicine for preventing and treating radiation-induced pulmonary injury, and belongs to the technical field of biological medicine. The invention provides application of N-acetylglycine in preparation of a medicine for preventing and / or treating radiation-induced lung injury. Cell experiments prove that N-acetylglycine can improve the occurrence conditions of cell ferroptosis and copper death caused by ionizing radiation. Mouse experiments prove that the N-acetylglycine has a potential effect of improving the radiation-induced lung injury.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and specifically relates to the application of N-acetylglycine in preparing a drug for preventing and treating radiation lung injury. Background Art

[0002] Radiation-induced lung injury (RILI) is a common complication of thoracic tumor radiotherapy. It is clinically divided into early radiation-induced pneumonia (Radiation-induced pneumonia) and late radiation-induced pulmonary fibrosis (Radiation-induced pulmonary fibrosis, RIPF). Clinical symptoms include retching, shortness of breath, chest pain, fever, and even respiratory failure and death. Since there is a lack of effective treatment for RILI, finding drug intervention targets with diagnostic potential has very important clinical application value for the prevention and treatment of radiation-induced lung injury. Body fluid specimens such as serum and feces can be used as important specimen sources for disease diagnosis and treatment efficacy evaluation due to their easy availability and rich content. Screening serum markers with diagnostic and therapeutic potential based on metabolomics has research significance for the prevention and treatment of radiation-induced lung injury. Summary of the invention

[0003] The present invention provides the use of N-acetylglycine in the preparation of a drug for preventing and treating radiation-induced lung injury, and confirms that the N-acetylglycine has a potential effect of improving radiation-induced lung injury.

[0004] The purpose of the present invention is to provide the use of N-acetylglycine in preparing a drug for preventing and / or treating radiation lung injury.

[0005] In a specific embodiment of the present invention, the working concentration of N-acetylglycine in the radiation lung injury drug is not less than 10 μM.

[0006] In a specific embodiment of the present invention, the administration of the radiation lung injury drug includes cell administration and body administration.

[0007] In a specific embodiment of the present invention, when the cells are administered, DMSO is used as a solvent and the working solution concentration is 10 to 40 μM.

[0008] In a specific embodiment of the present invention, when the body is administered, 0.2 mg of N-acetylglycine is administered to mice each time.

[0009] In a specific embodiment of the present invention, when the body is administered, a mixture of DMSO, PEG3000, Tween-80 and ddH2O is used as the solvent.

[0010] In a specific embodiment of the present invention, the solvent includes 5% DMSO, 40% PEG300, 5% Tween-80 and 50% ddH2O in terms of volume percentage.

[0011] Another object of the present invention is to provide a drug for preventing and / or treating radiation-induced lung injury, comprising N-acetylglycine and pharmaceutically acceptable excipients.

[0012] Beneficial effects: The present invention provides the use of N-acetylglycine in the preparation of drugs for preventing and / or treating radiation lung injury. In the embodiment, 10 μM N-acetylglycine is given to lung epithelial cells (A549) immediately before 10Gy γ-ray irradiation, and samples are collected for 48 hours after irradiation to observe the changes in cell inflammatory factors IL-1β and TGF-β, ROS production, and cell iron death and copper death. The results show that N-acetylglycine can improve the occurrence of iron death and copper death caused by ionizing radiation. In the present invention, mice irradiated with 20Gy γ-rays for a single whole chest irradiation for 14 days and 30 days developed radiation pneumonia in mice, and mice irradiated for 120 days developed radiation lung fibrosis, and the damage effect was improved after the administration of NAGly reagent. In the metabolomics analysis results, it was found that the content of N-acetylglycine in the feces of mice at 1 month and 4 months was significantly increased, confirming that N-acetylglycine has the potential to improve radiation lung injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 This is a graph showing the results of N-acetylglycine improving the increase of inflammatory factors in human lung epithelial cells A549 caused by ionizing radiation;

[0014] Figure 2 The results of N-acetylglycine improving the increase of ROS in human lung epithelial cells A549 caused by ionizing radiation;

[0015] Figure 3 The results of N-acetylglycine improving ferroptosis and copper death of human lung epithelial cells A549 induced by ionizing radiation;

[0016] Figure 4 This is a graph showing the changes in mouse body weight and mouse lung coefficient after irradiation;

[0017] Figure 5 This is the result of inflammatory infiltration of lung cells in mice after irradiation;

[0018] Figure 6 This is the result of respiratory function test on mice raised for 14, 30, and 120 days after irradiation. DETAILED DESCRIPTION

[0019] The purpose of the present invention is to provide application of N-acetylglycine in preparing medicine for preventing and treating radiation lung injury.

[0020] The N-acetylglycine referred to in the present invention has a CAS number of 543-24-8 and a molecular formula of C4H7NO3.

[0021] In a specific embodiment of the present invention, the administration of the radiation lung injury drug includes cell administration and body administration. When administering to cells, DMSO is used as the solvent, and the working solution concentration is 10-40 μM. When configuring the liquid for cell administration, the present invention first configures 60mM N-acetylglycine mother solution, such as taking 7.026mgN-acetylglycine solid and dissolving it in 1mLDMSO to obtain 60mM mother solution; then dilute the mother solution with DMSO, such as taking 10μL 60mM mother solution and dissolving it in 50μLDMSO to obtain 10mM liquid, when administering, 10mM liquid and culture medium are configured according to a volume ratio of 1:1000 to obtain 10μM N-acetylglycine working solution, and 10μM N-acetylglycine is given immediately before 10Gyγ-ray irradiation of lung epithelial cells (A549), and 48h of culture after irradiation is collected to observe the changes of cell inflammatory factors IL-1β and TGF-β, ROS generation and cell iron death and copper death. The results show that N-acetylglycine can improve the increase of inflammatory factors IL-1β and TGF-β of lung epithelial cells caused by ionizing radiation, increase of ROS and cell copper death and iron death.

[0022] In a specific embodiment of the present invention, when the organism is administered, 0.2 mg of the N-acetylglycine is administered to mice per day. The administration method of the organism can be intragastric administration as in the embodiment, and when the mice are intragastrically administered, a mixed solution of DMSO, PEG3000, Tween-80 and ddH2O is used as the solvent. In the embodiment of the present invention, the solvent includes 5% DMSO, 40% PEG300, 5% Tween-80 and 50% ddH2O in terms of volume percentage. When preparing the oral gavage agent, the preferred preparation is 0.02 mg / μL N-acetylglycine mother solution, that is, 0.02 mg N-acetylglycine is dissolved in 1 μL DMSO to obtain 0.02 mg / μL mother solution, and then N-acetylglycine reagent (NAGly) is prepared, which includes: 5% N-acetylglycine mother solution, 40% PEG300, 5% Tween-80 and 50% ddH2O by volume, and 200 μL is gavaged per mouse each time. The embodiment of the present invention found through metabolomics analysis that the content of N-acetylglycine in the feces of mice irradiated with 20Gy γ-rays for 1 month and 4 months was significantly increased, confirming that N-acetylglycine has the potential effect of improving radiation lung injury.

[0023] Another object of the present invention is to provide a drug for preventing and / or treating radiation-induced lung injury, comprising N-acetylglycine and pharmaceutically acceptable excipients.

[0024] The present invention does not specifically limit the type and amount of the auxiliary materials, and conventional auxiliary materials in the art can be used to add and prepare the medicine.

[0025] To further illustrate the present invention, the application of N-acetylglycine provided by the present invention in preparing a drug for preventing and treating radiation-induced lung injury is described in detail below in conjunction with examples, but they should not be construed as limiting the scope of protection of the present invention.

[0026] Example 1 Cell experiment

[0027] Acetylglycine mother solution (60 mM): Dissolve 7.026 mg of N-acetylglycine solid in 1 mL of DMSO;

[0028] N-acetylglycine working solution (10 mM): Dissolve 10 μL of 60 mM stock solution in 50 μL DMSO to obtain a 10 mM working solution;

[0029] Complete culture medium: DMEM: fetal bovine serum: double antibody = 0.94:0.05:0.01.

[0030] During the experiment, a 10 μM N-acetylglycine solution was prepared at a ratio of working solution: complete culture medium = 1:1000. 10 μM N-acetylglycine was given immediately before lung epithelial cells (A549) were irradiated with 10 Gy γ rays. After irradiation, samples were collected and cultured for 48 hours to observe the changes in cell inflammatory factors IL-1β and TGF-β, the production of ROS, and the occurrence of cell iron death and copper death.

[0031] Primer sequences for determining the expression of cellular inflammatory factors:

[0032] h actinF (SEQ ID No. 1):gacctgtacgccaacacag;

[0033] h actinR (SEQ ID No. 2): ctcaggaggagcaatgatc;

[0034] h IL1-βF1 (SEQ ID No. 3): GCCAGTGAAATGATGGCTTATT;

[0035] h IL1-βR1 (SEQ ID No. 4): AGGAGCACTTCATCTGTTTAGG;

[0036] hTGF-Β1F1 (SEQ ID No. 5): CTGTACATTGACT TCCGCAAG;

[0037] hTGF-B1R1 (SEQ ID No. 6): TGTCCAGGCTCCAAATGTAG.

[0038] The changes of inflammatory factors IL-1β and TGF-β Figure 1 As shown, N-acetylglycine improves the increase of inflammatory factors in lung epithelial cells induced by ionizing radiation.

[0039] The ROS production was detected using the Bio-Tech ROS Detection Kit. The results are as follows: Figure 2 As shown, N-acetylglycine improves the increase of reactive oxygen species in lung epithelial cells induced by ionizing radiation.

[0040] How does ferroptosis and copper death occur? Figure 3 As shown, N-acetylglycine improves the occurrence of ferroptosis in lung epithelial cells induced by ionizing radiation.

[0041] Example 2 Mouse Experiment

[0042] The experiment was divided into three groups:

[0043] NC+Vehicle group: 7-week-old male C57BL / 6J mice were purchased and bred in an SPF environment for one week. After that, they were gavaged with 0.2 mg of the solvent once a day.

[0044] IR+Vehicle group: 7-week-old male C57BL / 6J mice were purchased and adapted to SPF environment for one week, then irradiated with 20Gy gamma rays to the whole chest, and then gavaged with solvent once a day at a rate of 0.2mg per mouse.

[0045] IR+N-acetylglycine reagent (IR+NAGly) group: Normally purchased 7-week-old male C57BL / 6J mice were adaptively raised in an SPF environment for one week and then irradiated with 20Gy gamma rays to the whole chest once. The solvent was initially administered to each mouse at 0.2mg once a day.

[0046] Wherein, solvent (Vehicle): 5% DMSO + 40% PEG300 + 5% Tween-80 + 50% ddH2O;

[0047] N-acetylglycine reagent (NAGly, IR): 5% N-acetylglycine stock solution + 40% PEG300 + 5% Tween-80 + 50% ddH2O (200 μL per mouse);

[0048] N-acetylglycine stock solution: Dissolve 0.02 mg of N-acetylglycine in 1 μL of DMSO to obtain a 0.02 mg / μL stock solution.

[0049] Experimental process:

[0050] 1. Sample collection in 15 days

[0051] NC+Vehicle group: After one week of adaptive feeding, the solvent was gavage-fed 14 times a day;

[0052] IR+Vehicle group: After one week of adaptive feeding, the whole chest was irradiated with 20Gy gamma rays once, and the solvent was given immediately after irradiation, once a day, for a total of 14 times;

[0053] IR+NAGly group: After one week of adaptive feeding, the whole chest was irradiated with 20Gy gamma rays once, and NAGly was given immediately after irradiation, once a day, for a total of 14 times;

[0054] Samples were collected every 14 days during the experiment to observe the coat color, body weight, lung coefficient, and HE and Masson staining results of lung tissue.

[0055] 2. 30 days to collect samples

[0056] NC+Vehicle group: After one week of adaptive feeding, the solvent was gavage-fed 30 times a day;

[0057] IR+Vehicle group: After one week of adaptive feeding, the whole chest was irradiated with 20Gy gamma rays once, and the solvent was given immediately after irradiation, once a day, for a total of 30 times;

[0058] IR+NAGly group: After one week of adaptive feeding, the whole chest was irradiated with 20Gy gamma rays once, and NAGly was given immediately after irradiation, once a day, for a total of 30 times;

[0059] Samples were collected every 30 days during the experiment to observe the coat color, body weight, lung coefficient, and HE and Masson staining results of the lung tissues of the mice.

[0060] 3. 120 days to collect samples

[0061] NC+Vehicle group: After one week of adaptive feeding, the mice were gavaged with solvent 30 times a day for 30 days, and then fed normally for 90 days;

[0062] IR+Vehicle group: After one week of adaptive feeding, the whole chest was irradiated with 20Gy gamma rays once, and the solvent was immediately given once a day for 30 times for a total of 30 days, and then the normal feeding was carried out for 90 days;

[0063] IR+NAGly group: After one week of adaptive feeding, the whole chest was irradiated with 20Gy gamma rays once, and NAGly was immediately given once a day for 30 times for a total of 30 days, and then normal feeding was carried out for 90 days.

[0064] The results of mouse weight changes are as follows Figure 4 As shown, seven days after irradiation, the weight of mice dropped sharply, and the weight loss was alleviated by NAGly administration; the results of the mouse lung coefficient are shown in Figure 4 As shown, the lung coefficient of mice increased after irradiation, and the damage was alleviated after administration of NAGly.

[0065] The results of inflammatory infiltration of lung cells in mice after irradiation are as follows Figure 5 As shown, NAGly can improve inflammatory infiltration and fibrous deposition in the lung tissue of mice induced by ionizing radiation.

[0066] Respiratory function test results Figure 6 As shown in the figure, MV refers to minute ventilation, and TV refers to tidal volume. Since the detection instruments for 14-day-old and 1-month-old mice are different from those for 4-month-old mice, the values ​​of the same indicators are different.

[0067] The above results showed that mice developed radiation pneumonia 14 days and 30 days after irradiation, and radiation pulmonary fibrosis 120 days after irradiation. The damage was improved after administration of NAGly reagent.

[0068] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of N-acetylglycine in the preparation of drugs for preventing and / or treating radiation-induced lung injury.

2. The application according to claim 1, characterized in that: The working concentration of N-acetylglycine in the radiation lung injury drug is not less than 10 μM.

3. The application according to claim 2, characterized in that: The administration methods of the radiation lung injury drug include cell administration and body administration.

4. The use according to claim 3, characterized in that: When the cells are administered, DMSO is used as a solvent, and the working solution concentration is 10-40 μM.

5. The application according to claim 3, characterized in that: When administering the drug to the body, 0.2 mg of N-acetylglycine is administered to mice each time.

6. The use according to claim 5, characterized in that: When the drug is administered to the body, a mixed solution of DMSO, PEG3000, Tween-80 and ddH2O is used as solvent.

7. The use according to claim 6, characterized in that: In terms of volume percentage, the solvent includes 5% DMSO, 40% PEG300, 5% Tween-80 and 50% ddH2O.

8. A drug for preventing and / or treating radiation-induced lung injury, characterized in that: The invention comprises N-acetylglycine and pharmaceutically acceptable excipients.

Images