Fusion protein capable of simultaneously editing four basic groups and application of fusion protein

Abstract

The invention discloses a fusion protein capable of simultaneously editing four basic groups and application of the fusion protein, and relates to the technical field of gene editing. The fusion protein is combined with gGBE, DAF-TBE and TadDE, deaminase and glycosidase of the gGBE, the DAF-TBE and the TadDE are fused in nCas9, and the fusion protein capable of editing four basic groups (A, T, C and G) at the same time is developed. The fusion protein can realize base conversion and transversion from A to G, from A to C, from A to T, from T to G, from T to C, from T to A, from C to T, from C to G, from C to A, from G to A, from G to C and from G to T, and has wide application prospects in the aspects of protein directed evolution, cell tracing, construction of complex disease models and the like.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and in particular to a fusion protein capable of simultaneously editing four bases and applications thereof. Background Art

[0002] Natural evolution is a long and random process. Only under certain circumstances can we obtain certain traits. The main reason is that the mutation efficiency of the genome is too low under natural conditions. For example, the mutation rate of each base in the human genome is only 1.61±0.13×10 -8 , while the mutation rate of each base in the bacterial genome can reach 1×10 -3 . Although this lower mutation efficiency ensures the stability of the genome, it is unlikely to obtain enough mutations or traits over a long period of time in biological research. Therefore, there are a series of means and strategies in the laboratory to accelerate this process. For example, acetylnitrosourea (ENU) randomly induces G to A mutations in the genome, but this method cannot direct or evolve only a certain protein. In order to obtain higher mutations, some error-prone DNA polymerases can usually be used to introduce mutations during the PCR process, and then introduced into bacteria and other species for screening. The orthogonal replication system (OrthoRep) also relies on error-prone DNA polymerases to cause DNA mutations in targeted regions. Phage-assisted continuous evolution (PAGE) and phage-assisted discontinuous evolution (PANCE) introduce MPs into bacteria to cause genomic mutations, and use phages to enrich and screen favorable mutations. T7 polymerase-driven continuous editing (TRACE) and TaRgeted In vivo Diversification ENabled by T7 RNAP (TRIDENT) rely on T7 RNA polymerase, and the in vivo confined mutagenesis technology based on the Type I-ECRISPR-Cas system (CoMuTER) relies on the environment of single-stranded DNA formed by Cas3 protein, etc., and the base conversion is achieved under the action of deaminase to introduce mutations. EvolvR fused PoII3M on the basis of nCas9 to introduce mutations near the incision. Similarly, within 1500bp downstream of the incision of nCas9, the introduction of a helicase fused with a deaminase can also achieve base conversion. However, these strategies for directed evolution of proteins have low mutation efficiency (TRACE mutation rate 1.47~3.1×10 -3, TRIDENT mutation rate 1×10 -4 , CoMuTER mutation rate 3×10 -4 ), the type of base conversion is single (it can only realize the base conversion of A and C), and it cannot convert the four bases of A, T, C, and G.

[0003] Compared with TRACE and TRIDENT, although both rely on deaminases to introduce mutations, the efficiency of base conversion is much lower than that of base editors. David Liu's laboratory first developed a cytosine base editor for C·G to T·A conversion and an adenine base editor for A·T to G·C conversion (Base Editor). With the development and modification of deaminases and glycosylases, base editors that can currently achieve conversion and transversion of four bases of A, T, C, and G include gGBE and TBE in addition to ABE and CBE. Although base editors can achieve conversion and transversion of four DNA bases, only single or two substrates can be edited for a single base editor. Although this base editor for one or two substrates enriches the types of base conversions, it cannot meet all base conversions or transversions within the same editing window, limiting its application in protein directed evolution and binding to specific protein sites.

[0004] In order to break through and enrich the application of base editing, especially directed protein evolution, different deaminases can be fused to achieve multi-base modification. Early studies have been able to simultaneously achieve A to G and C to T conversions by fusing two different deaminases, such as APOBEC1 and TadA, into nCas9. The earliest ABE had a small amount of C to T editing, suggesting that the deaminase TadA can edit with C as a substrate. Therefore, Td-CBE can be developed through rational protein design. And through evolution, the ability of TadA to modify A and C substrates can be retained at the same time, so that double base conversion can be achieved in one deaminase, and a dual base editor (TadDE) is developed. AGBE, which combines CGBE and ABE, can achieve conversion and transversion from C to G, C to T, C to A and A to G. This method can be used to achieve resistance screening for diphtheria toxin. In summary, base editors can simultaneously modify two substrates, but cannot achieve editing of more substrates. Combining the development strategy of the above-mentioned multifunctional base editor, we added the glycosidase MPG of gGBE on the basis of the dual-substrate base editor to achieve the editing of the G base (three-base editor). However, the current directed evolution of proteins, cell tracing, and the construction of complex genetic disease models are inefficient using traditional directed evolution systems. Base editors mostly modify one or two bases, especially the simultaneous modification of four bases on DNA, which cannot produce enough mutation types. Summary of the invention

[0005] In view of the shortcomings of the prior art, the present invention is based on gGBE, DAF-TBE and TadDE, and TadA-dual (a deaminase capable of recognizing A and C), glycosidase MPG v6.3 and glycosidase TDG3 are fused into nCas9 to develop a fusion protein capable of simultaneously editing four bases (A, T, C, G). This fusion protein overcomes the limitation of the single substrate of the base editor and can achieve base conversion and transversion from A to G, A to C, A to T, T to G, T to C, T to A, C to T, C to G, C to A, G to A, G to C and G to T. The specific contents of the present invention are as follows:

[0006] The first aspect of the present invention provides a fusion protein capable of simultaneously editing four bases, the fusion protein comprising a nuclease inactive Cas9 (nCas9) domain and a nucleic acid editing domain, the nucleic acid editing domain comprising a deaminase and a glycosidase. The fusion protein can achieve at least one of base conversions and transversions including A to G, A to C, A to T, T to G, T to C, T to A, C to T, C to G, C to A, G to A, G to C and G to T. Preferably, the fusion protein can achieve all mutations in base conversions and transversions including A to G, A to C, A to T, T to G, T to C, T to A, C to T, C to G, C to A, G to A, G to C and G to T. In a specific embodiment of the present invention, a fusion protein capable of simultaneously editing four bases is also referred to as a four-base editor.

[0007] Further, the deaminase includes gGBE, DAF-TBE and TadDE; the glycosidase includes glycosidase MPGv6.3 and glycosidase TDG3. Preferably, the fusion protein also includes a nuclear localization signal NLS, which can help the protein enter the cell nucleus; preferably, the NLS is located at at least one end of the fusion protein; more preferably, the NLS is located at both ends of the fusion protein, and more preferably, the NLS can also be located between the glycosidase and the deaminase. In a specific embodiment of the present invention, the NLS is located at both ends of the fusion protein, and the glycosidase and the deaminase can be directly connected or linked through the NLS or through other linkers. Preferably, at least one NLS is included between the glycosidase and the deaminase.

[0008] Further, the fusion protein fuses the deaminase and the glycosidase at the N-terminus and the C-terminus of nCas9. Preferably, the structure of the fusion protein includes at least one of X1-TDG3-Y1-TadA(dual)-Y2-nCas9-Y3-MPG v6.3-X2 or X1-TadA(dual)-Y1-TDG3-Y2-nCas9-Y3-MPG v6.3-X2, wherein: at least one of X1 and X2 is NLS; Y1, Y2 and Y3 are selected from at least one of NLS, linker or none. Preferably, the structure of the fusion protein is selected from at least one of TDG3-TadA (dual) -nCas9-MPG v6.3 or TadA (dual) -TDG3-nCas9-MPG v6.3, and more preferably, the structure of the fusion protein includes NLS-TDG3-TadA-dual-nCas9-MPG v6.3-NLS, NLS-TadA-dual-TDG3-nCas9-MPG v6.3-NLS,

[0009] At least one of NLS-TDG3-TadA-dual-nCas9-NLS-MPG v6.3-NLS or NLS-TadA-dual-TDG3-nCas9-NLS-MPG v6.3-NLS, more preferably, different deaminases and glycosidases are fused and expressed directly or through a linker. In a specific embodiment of the present invention, the combination effect of TDG3-TadA (dual) -nCas9-MPG v6.3 is better than TadA (dual) -TDG3-nCas9-MPG v6.3.

[0010] Furthermore, the amino acid sequence of the fusion protein is selected from at least one of the following:

[0011] (1) The fusion protein comprises the amino acid sequence shown in SEQ ID NO: 1 or SEQ D NO: 3;

[0012] (2) The fusion protein comprises an amino acid sequence having at least 98% sequence identity with the amino acid sequence shown in SEQ ID NO.1 or SEQ D NO:3.

[0013] A second aspect of the present invention provides a biomaterial, wherein the biomaterial comprises at least one of the following:

[0014] A. A nucleic acid encoding any one of the fusion proteins;

[0015] B. An expression cassette, comprising the nucleic acid described in A;

[0016] C. A recombinant vector comprising the nucleic acid described in A or the expression cassette described in B;

[0017] D. A recombinant cell capable of expressing the fusion protein or comprising the nucleic acid described in A, the expression cassette described in B or the recombinant vector described in C.

[0018] Furthermore, the sequence of the nucleic acid in A is shown in SEQ SEQ ID NO: 2 or SEQ D NO: 4, or has at least 98% sequence identity with SEQ SEQ ID NO: 2 or SEQ D NO: 4.

[0019] A third aspect of the present invention provides a gene editing system capable of simultaneously editing four bases, wherein the gene editing system comprises at least one of the fusion protein or the biological material.

[0020] The fourth aspect of the present invention provides the use of the fusion protein, the biomaterial or the gene editing system in gene editing for non-disease diagnosis and treatment purposes and / or preparation of gene editing products. Preferably, the application includes at least one of protein directed evolution, cell tracing and construction of complex disease models.

[0021] Further, the type of gene editing includes at least one of base transitions and transversions of A to G, A to C, A to T, T to G, T to C, T to A, C to T, C to G, C to A, G to A, G to C and G to T. Preferably, the type of gene editing includes all mutations in base transitions and transversions of A to G, A to C, A to T, T to G, T to C, T to A, C to T, C to G, C to A, G to A, G to C and G to T.

[0022] The fifth aspect of the present invention provides a gene editing method for non-disease diagnosis and treatment purposes, the method comprising the steps of combining gGBE, DAF-TBE and TadDE, and fusing the deaminases and glycosidases of the three into nCas9.

[0023] The beneficial effects of the present invention include but are not limited to:

[0024] 1. The present invention solves the defect of single editing substrate of base editor in the prior art, combines gGBE, DAF-TBE and TadDE, fuses TadA-dual, glycosidase MPG v6.3 and glycosidase TDG3 into nCas9, and develops a fusion protein that can simultaneously edit four bases (A, T, C, G). Among them, TadA-dual of TadDE can modify A and C bases at the same time, and when UGI is not present, the type of C base conversion can be further enriched. The glycosidase MPG v6.3 of gGBE can achieve the replacement of G to Y (C or T) base and has the ability to remove I (hypoxanthine), and the modified I base in TadA (dual) is replaced, thereby achieving A to Y transversion. TDG3 in DAF-TBE can remove the T base and achieve transversion or conversion of G or C. By fusing all three deaminases and glycosidases into nCas9, the modification of 4 bases can be achieved simultaneously, resulting in conversion and transversion of more types of bases.

[0025] 2. The fusion protein of the present invention can achieve base conversion and transversion from A to G, A to C, A to T, T to G, T to C, T to A, C to T, C to G, C to A, G to A, G to C and G to T. It has broad application prospects in the field of gene editing, especially in protein directed evolution, cell tracing and the construction of complex disease models. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0027] Figure 1 is a schematic diagram of the construction structure of the fusion protein in the embodiment of the present invention;

[0028] Figure 2 is a schematic diagram of the structure of the fusion protein inducing endogenous target mutation in an embodiment of the present invention;

[0029] Figure 3 Schematic diagram of the results of the ratio of Indels induced by fusion proteins in the embodiments of the present invention, wherein TS44 is a schematic diagram of the results of GDI2-TS44, TS47 is a schematic diagram of the results of ZNF839-TS47, and TS20 is a schematic diagram of the results of SMDT1-TS20;

[0030] Figure 4 It is a schematic diagram of the results of the ability of the fusion protein in the embodiment of the present invention to simultaneously edit four bases, wherein TS44 is a schematic diagram of the results of GDI2-TS44, and TS47 is a schematic diagram of the results of ZNF839-TS47. DETAILED DESCRIPTION

[0031] The present invention is described in detail below with reference to examples, but the present invention is not limited to these examples. Unless otherwise specified, the raw materials and catalysts in the examples of the present invention are purchased through commercial channels.

[0032] Example 1 Fusion protein induces target mutation

[0033] 1.1 Plasmid design and construction

[0034] 1.1.1. Amplify the TDG3 fragment from DAF-TDG3 and construct the plasmid shown in Figure 1 by Gibson assembly. The plasmid was prepared by fusing TDG3 to our previous three-base editor (202311666216.7). The plasmid was verified to be correct by Sanger sequencing. The specific sequence is shown in Table 1.

[0035] 1.1.2. Artificially synthesize the primers of the targets GDI2-TS44, ZNF839-TS47, and SMDT1-TS20 shown in Table 2, and connect them to the BbsⅠ site of the sgRNA expression plasmid U6-sgRNA-EF1α-GFP-P2A-PuroR (used to express the sgRNA of the corresponding target) by enzyme digestion to obtain the recombinant target plasmid.

[0036] Table 1 Recombinant plasmid sequences

[0037]

[0038] Table 2. Targets and sequences used

[0039] Target name Sequence (5'-3') GDI2-TS44 AGTCAATCGAAAGTCAGGTG ZNF839-TS47 CCTCAGCCGAGACATGGATG SMDT1-TS20 ACATCTGCAGAGGGTCAGAG

[0040] 1.2 Cell transfection

[0041] HEK293T 2×10 5 The cells were plated in 24-well plates. When the cells grew to 70%-80%, the plasmid combination was transfected according to the working system plasmid:sgRNA=750ng:250ng. At the same time, a blank control without transfection of any plasmid was set up. After 72 hours of transfection, the cell genome was extracted.

[0042] 1.3. Genome extraction and preparation of amplicon libraries

[0043] 72h after transfection, BIOSEARCH QuickExtract TMThe cell genomic DNA was extracted using a DNA extraction kit (QE09050). The Hitom kit was then used to design the corresponding identification primers (Table 3), i.e., a bridge sequence 5'-ggagtgagtacggtgtgc-3' was added to the 5' end of the forward identification primer, and a bridge sequence 5'-gagttggatgctggatgg-3' was added to the 5' end of the reverse identification primer, to obtain a first-round PCR product. The first-round PCR product was then used as a template for a second-round PCR, mixed together, cut and recovered, purified, and then sent to a sequencing company for NGS sequencing.

[0044] Table 3. Primers used to identify the targets

[0045]

[0046] 1.4. NGS sequencing results analysis and statistics

[0047] The NGS sequencing results of step 1.3 were analyzed using the BE-analyzer website (http: / / www.rgenome.net / be-analyzer / #!) to calculate the efficiency of base conversion, the ratio of four bases edited simultaneously, and the ratio of each Indels.

[0048] The results showed that the TDG3-TadA-dual-nCas9-MPG v6.3 and TadA-dual-TDG3-nCas9-MPGv6.3 we developed can achieve the conversion or transversion of four bases ( Figure 2 and Figure 4 ), but compared with DAF-TDG3, the editing efficiency of substrate T was significantly reduced ( Figure 2 ). Compared with TadA-dual-nCas9-MPG v6.3, although the fusion protein of the present invention can achieve the editing of T, the editing efficiency of A, C and G is also reduced to a certain extent ( Figure 2 ). From the perspective of introducing Indels, the fusion protein of the present invention can be lower than the three-base editor and higher than DAF-TDG3. The possible reason is that the reduction in editing efficiency leads to lower Indels ( Figure 3 ). The fusion protein of the present invention has more mutation types (theoretically, it can achieve the transformation of any amino acid) and has a higher editing efficiency than the protein evolution strategy. And overall, the combination of TDG3-TadA (dual) -nCas9-MPG v6.3 is better than TadA (dual) -TDG3-nCas9-MPG v6.3. Therefore, the fusion protein can be used for directed evolution of proteins, cell tracing, and construction of complex genetic diseases.

[0049] The above description is only an embodiment of the present invention. The protection scope of the present invention is not limited by these specific embodiments, but is determined by the claims of the present invention. For those skilled in the art, the present invention may have various changes and variations. Any modification, equivalent substitution, improvement, etc. made within the technical ideas and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A fusion protein capable of simultaneously editing four bases, characterized in that: The fusion protein comprises a nuclease inactive Cas9 (nCas9) domain and a nucleic acid editing domain, wherein the nucleic acid editing domain includes a deaminase and a glycosidase.

2. The fusion protein according to claim 1, characterized in that The fusion protein can achieve at least one of base transitions and transversions including A to G, A to C, A to T, T to G, T to C, T to A, C to T, C to G, C to A, G to A, G to C and G to T. Preferably, the fusion protein can achieve all mutations among base transitions and transversions including A to G, A to C, A to T, T to G, T to C, T to A, C to T, C to G, C to A, G to A, G to C and G to T.

3. The fusion protein according to claim 1, characterized in that The deaminase includes gGBE, DAF-TBE and TadDE; the glycosidase includes glycosidase MPG v6.3 and glycosidase TDG3, preferably, the fusion protein also includes NLS; preferably, the NLS is located at at least one end of the fusion protein; more preferably, the NLS is located at both ends of the fusion protein, and more preferably, the NLS can also be located between the glycosidase and the deaminase.

4. The fusion protein according to claim 1, characterized in that The fusion protein fuses the deaminase and the glycosidase at the N-terminus and the C-terminus of nCas9. Preferably, the structure of the fusion protein includes at least one of X1-TDG3-Y1-TadA (dual)-Y2-nCas9-Y3-MPG v6.3-X2 or X1-TadA (dual)-Y1-TDG3-Y2-nCas9-Y3-MPGv6.3-X2, wherein: At least one of X1 and X2 is NLS; Y1, Y2 and Y3 are selected from at least one of NLS, linker or none.

5. The fusion protein according to claim 1, characterized in that The amino acid sequence of the fusion protein is selected from at least one of the following: (1) The fusion protein comprises the amino acid sequence shown in SEQ ID NO: 1 or SEQ D NO: 3; (2) The fusion protein comprises an amino acid sequence having at least 98% sequence identity with the amino acid sequence shown in SEQ ID NO.1 or SEQ D NO:

3.

6. A biomaterial, characterized in that The biological material comprises at least one of the following: A. A nucleic acid encoding the fusion protein according to any one of claims 1 to 5, preferably, the sequence of the nucleic acid is as shown in SEQ SEQ ID NO: 2 or SEQ D NO: 4, or has at least 98% sequence identity with SEQ SEQ ID NO: 2 or SEQ D NO: 4; B. An expression cassette, comprising the nucleic acid described in A; C. A recombinant vector comprising the nucleic acid described in A or the expression cassette described in B; D. A recombinant cell capable of expressing the fusion protein described in any one of claims 1 to 5 or comprising the nucleic acid described in A, the expression cassette described in B or the recombinant vector described in C.

7. A gene editing system capable of simultaneously editing four bases, characterized in that: The gene editing system comprises at least one of the fusion protein described in any one of claims 1 to 5 or the biological material described in any one of claim 6.

8. Use of the fusion protein as described in any one of claims 1 to 5, or the biomaterial as described in any one of claim 6, or the gene editing system as described in claim 7 in gene editing for non-disease diagnosis and treatment purposes and / or preparation of gene editing products, preferably, the application includes at least one of protein directed evolution, cell tracing and construction of complex disease models.

9. The use according to claim 8, characterized in that: The types of gene editing include A to G, A At least one of base transitions and transversions from A to C, A to T, T to G, T to C, T to A, C to T, C to G, C to A, G to A, G to C and G to T. Preferably, the type of gene editing includes all mutations in base transitions and transversions from A to G, A to C, A to T, T to G, T to C, T to A, C to T, C to G, C to A, G to A, G to C and G to T.

10. A gene editing method for purposes other than disease diagnosis and treatment, characterized in that: The method comprises the steps of combining gGBE, DAF-TBE and TadDE, and fusing the deaminases and glycosidases of the three into nCas9.

Images