Fusion protein, leading editing system, gene editing kit, gene editing method and cell

Abstract

The invention discloses a fusion protein, a pilot editing system, a gene editing kit, a gene editing method and a cell, and relates to the technical field of gene editing. The amino acid sequence of the fusion protein is as shown in SEQ ID NO: 1. The fusion protein provided by the invention can improve histone crotonyl acylation at a fixed point, improve the openness of chromatin and promote the combination of the fusion protein and the fixed-point chromatin, and when the fusion protein is used for gene editing, the fusion protein can have relatively high action efficiency and improve the gene editing efficiency under the condition that the cell state is not influenced.

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and in particular to fusion proteins, lead editing systems, gene editing kits, gene editing methods and cells. Background Art

[0002] At present, gene editing technology is widely used. Genetic modifications such as substitutions, insertions, and deletions are introduced into the genome through gene editing technology, which can improve agricultural traits, accelerate the improvement and breeding of plants and animals; build disease models, explore the occurrence and progression of diseases, and conduct drug screening; repair or modify endogenous pathogenic mutations to achieve the purpose of gene therapy. Among them, Prime editing (PE) is a precise gene editing technology that can programmatically install substitutions, insertions, and deletions in cells and animals without double-stranded DNA breaks. Compared with methods based on homology-directed repair, the mechanism of prime editing makes it less dependent on cell replication and endogenous DNA repair, and it can accurately install edits without creating double-stranded DNA breaks, thereby minimizing insertions and deletions and other adverse outcomes. However, in mammals, the gene editing efficiency of prime editing is still relatively low.

[0003] Therefore, the prior art still needs to be improved and developed. Summary of the invention

[0004] Based on the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a fusion protein, a lead editing system, a gene editing kit, a gene editing method and a cell, aiming to solve the problem that the gene editing efficiency of lead editing is still relatively low.

[0005] The technical solution of the present invention is as follows: In a first aspect, the present invention provides a fusion protein, wherein the amino acid sequence of the fusion protein is shown as SEQ ID NO:1.

[0006] A second aspect of the present invention provides a lead editing system, wherein the lead editing system comprises pegRNA and the fusion protein of the present invention as described above.

[0007] Optionally, the nucleotide sequence of the pegRNA is as shown in SEQ ID NO: 2.

[0008] The third aspect of the present invention provides a gene editing kit, wherein the gene editing kit comprises an expression vector for expressing pegRNA and an expression vector for expressing the fusion protein of the present invention as described above.

[0009] A fourth aspect of the present invention provides a method for gene editing, comprising the steps of: The lead editing system of the present invention as described above is introduced into host cells for gene editing.

[0010] Alternatively, the prime editing system is introduced into bovine fetal fibroblasts for gene editing.

[0011] Optionally, the step of introducing the lead editing system into bovine fetal fibroblasts for gene editing specifically includes: A fusion protein expression vector is provided, wherein the nucleotide sequence of the fusion protein expression vector is shown in SEQ ID NO: 3; Inserting the nucleotide sequence of pegRNA into the pU6-pegRNA-GG-acceptor plasmid to obtain a pegRNA expression vector, wherein the nucleotide sequence of the pegRNA expression vector is shown in SEQ ID NO: 4; The fusion protein expression vector and the pegRNA expression vector are transfected into bovine fetal fibroblasts for gene editing.

[0012] Optionally, the step of transfecting the fusion protein expression vector and the pegRNA expression vector into bovine fetal fibroblasts for gene editing specifically includes: Mixing serum-free culture medium and transfection reagent to obtain a first mixture; Mixing the serum-free culture medium, the fusion protein expression vector and the pegRNA expression vector to obtain a second mixture; Add the first mixture dropwise to the second mixture, mix well, and let stand for 15 to 20 minutes to obtain a third mixture; The third mixture is added to a well plate containing bovine fetal fibroblasts, so that the fusion protein expression vector and the pegRNA expression vector are transfected into the bovine fetal fibroblasts for gene editing.

[0013] Optionally, the gene editing is IGF2 The G in intron 3 of the gene mutated to A.

[0014] A fifth aspect of the present invention provides a cell, wherein the cell is obtained by gene editing using the method of the present invention as described above.

[0015] Beneficial effects: The fusion protein provided by the present invention can increase histone crotonylation at a specific site, improve the openness of chromatin, and promote its binding to the chromatin at a specific site. When used for gene editing, the fusion protein can have a higher action efficiency without affecting the cell state, thereby improving the gene editing efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1These are cell fluorescence images after transfection with different fusion protein expression vectors and pegRNA expression vectors, where (a) is transfection with PE2-P300M1 expression vector and pegRNA expression vector, (b) is transfection with PE2-P300M2 expression vector and pegRNA expression vector, and (c) is transfection with PE2-P300M3 expression vector and pegRNA expression vector.

[0017] Figure 2 This is the result of detecting crotonylation modification of the site by Chip-qPCR.

[0018] Figure 3 (a) is after gene editing IGF2 Sequencing results of the mutation of G to A in intron 3 of the gene, (b) is without gene editing IGF2 Figure 2 shows the sequencing results when no mutation occurs in intron 3 of the gene.

[0019] Figure 4 This is the editing efficiency result diagram. DETAILED DESCRIPTION

[0020] The present invention provides fusion proteins, lead editing systems, gene editing kits, gene editing methods and cells. To make the purpose, technical solutions and effects of the present invention clearer and more specific, the present invention is further described in detail below. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0021] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0022] If there are descriptions involving "first", "second", etc. in the embodiments of the present invention, the descriptions of "first", "second", etc. are only used for descriptive purposes and cannot be understood as indicating or implying their relative importance or implicitly indicating the number of the indicated technical features.

[0023] An embodiment of the present invention provides a fusion protein, wherein the amino acid sequence of the fusion protein is shown as SEQ ID NO: 1.

[0024] At present, the genomic DNA of eukaryotic cells is tightly packaged and wrapped around histones, further compacted to form a higher-level chromatin structure. This complex structure affects the binding of the lead editing protein (i.e., PE protein, which is a protein obtained by fusing a programmable gap enzyme (such as nCas9, etc.) with a reverse transcriptase (RT)) to the DNA target sequence, thereby reducing the accessibility of the repair template. Histone crotonylation (Kcr) modification is a modification produced by the transfer of the crotonyl group to a lysine residue by histone crotonyl transferase using crotonyl coenzyme A as a substrate. This modification can neutralize the positive charge of the residue, and the loss of positive charge on the histone lysine residue weakens the DNA interaction, thereby reducing the compactness of the chromatin and facilitating transcriptional activation. The fusion protein described in the present invention is a protein obtained by fusing the P300M protein (i.e., a mutant of the transcriptional coactivator P300 protein) and the PE protein. Among them, the P300M protein lacks histone acetyltransferase (HAT) activity, but has strong histone crotonyltransferase (HCT) activity, which can catalyze the crotonylation of histones and directly stimulate gene transcription. Therefore, the fusion protein provided by the present invention can increase histone crotonylation at a fixed point, improve the openness of chromatin (i.e., promote the openness of chromatin by increasing local crotonylation modification), promote the fusion protein (or the PE protein part of the fusion protein) to bind to the chromatin at the fixed point, and when used for gene editing, the fusion protein can have a higher efficiency without affecting the cell state, thereby improving the efficiency of gene editing.

[0025] The embodiment of the present invention also provides a lead editing system, wherein the lead editing system includes pegRNA (i.e., lead editing guide RNA) and the fusion protein described above in the embodiment of the present invention. The lead editing system provided by the present invention has high activity in precise site-specific gene editing, and when used for gene editing, the fusion protein therein is used to increase local crotonylation modification, promote the openness of chromatin, improve the efficiency of the lead editing system binding to the DNA target sequence, and improve the gene editing efficiency.

[0026] In the present invention, under the guidance of pegRNA, the fusion protein targets the DNA editing site, and after the fusion protein and DNA bind to each other, the target fragment containing the PAM sequence is cut to produce a single-stranded DNA. Then, the base is replaced, inserted or deleted through the reverse transcription primer binding site (PBS) on the pegRNA and the reverse transcriptase template.

[0027] The fusion protein provided by the present invention can increase the crotonylation of histones at a specific site, improve the openness of chromatin (i.e., promote the openness of chromatin by increasing local crotonylation modification), and promote the binding of the fusion protein to the chromatin at a specific site, thereby improving the efficiency of the fusion protein without affecting the cell state, improving the binding efficiency of the lead editing system with the DNA target sequence, improving the activity of the gene editing system, and improving the gene editing efficiency, effectively solving the problem of low activity of the lead editing system in precise site-specific gene editing, and providing a method for the efficient use of gene editing in mammalian cells.

[0028] In some embodiments, the nucleotide sequence of the pegRNA is as shown in SEQ ID NO: 2.

[0029] In this embodiment, when the sequence used by the pegRNA in the prime editing system is as shown in SEQ ID NO: 2, base replacement can be performed through the reverse transcription primer binding site on the pegRNA and the reverse transcriptase template.

[0030] The embodiment of the present invention also provides a gene editing kit, wherein the gene editing kit comprises an expression vector for expressing pegRNA and an expression vector for expressing the fusion protein as described above in the embodiment of the present invention. The gene editing kit provided by the present invention has a high gene editing efficiency when used for gene editing.

[0031] In some specific embodiments, in the gene editing kit, the nucleotide sequence of the pegRNA is as shown in SEQ ID NO: 2.

[0032] The present invention also provides a gene editing method, which comprises the following steps: The lead editing system described in the embodiment of the present invention is introduced into the host cell for gene editing.

[0033] The present invention in fact also provides a method for locally increasing crotonylation to improve the editing efficiency of the lead editing system. When using the lead editing system for gene editing, the openness of chromatin is promoted by increasing the local crotonylation modification, and the binding of the fusion protein to the chromatin at the fixed point is promoted, thereby improving the efficiency of the fusion protein without affecting the cell state, improving the activity of the gene editing system, and improving the gene editing efficiency.

[0034] IGF2 The gene encodes insulin-like growth factor 2 (IGF2), which is a polypeptide that promotes cell division, participates in growth and development, and affects skeletal muscle mass and fat deposition. IGF2The gene is highly conserved, and the destruction of the repressor zinc finger protein 6 (Zinc finger bed domain containing, ZBED6) binding site on intron 3 (i.e., a single base mutation in intron 3 can destroy the repressor zinc finger protein 6 binding site) will cause an increase in the expression of IGF2 in skeletal muscle, thereby affecting muscle growth and fat deposition. IGF2 Gene editing at intron 3 of the gene to achieve mutation will be of great significance. Based on this, in some embodiments, the lead editing system is introduced into bovine fetal fibroblasts for gene editing. IGF2 The G on intron 3 of the gene is mutated to A. Specifically, the steps of introducing the lead editing system into bovine fetal fibroblasts for gene editing specifically include: S1. providing a fusion protein expression vector (i.e., inserting a nucleotide sequence encoding the P300M protein into a pCMV-PE2-P2A-GFP plasmid to obtain a fusion protein expression vector), wherein the nucleotide sequence of the fusion protein expression vector is shown in SEQ ID NO: 3; S2. inserting the nucleotide sequence of pegRNA into the pU6-pegRNA-GG-acceptor plasmid to obtain a pegRNA expression vector, wherein the nucleotide sequence of the pegRNA expression vector is shown in SEQ ID NO: 4; S3. Transfecting the fusion protein expression vector and the pegRNA expression vector into bovine fetal fibroblasts for gene editing.

[0035] In this embodiment, the fusion protein expression vector and the pegRNA expression vector are transfected into bovine fetal fibroblasts for gene editing, which has a high gene editing efficiency. IGF2 The G in intron 3 of the gene mutated to A.

[0036] In step S1, the nucleotide sequence encoding the P300M protein is shown in SEQ ID NO:5.

[0037] In step S2, the nucleotide sequence of pegRNA is shown in SEQ ID NO: 2.

[0038] In step S3, in some embodiments, the step of transfecting the fusion protein expression vector and the pegRNA expression vector into bovine fetal fibroblasts for gene editing specifically includes: S31, mixing the serum-free culture medium and the transfection reagent to obtain a first mixture; S32, mixing the serum-free culture medium, the fusion protein expression vector and the pegRNA expression vector to obtain a second mixture; S33, adding the first mixture dropwise to the second mixture, mixing well, and standing for 15 to 20 minutes to obtain a third mixture; S34. Add the third mixture to a well plate containing bovine fetal fibroblasts, so that the fusion protein expression vector and the pegRNA expression vector are transfected into the bovine fetal fibroblasts for gene editing.

[0039] An embodiment of the present invention further provides a cell, wherein the cell is obtained by gene editing using the method of the present invention as described above.

[0040] The present invention will be further described below by means of specific examples.

[0041] Unless otherwise specified in the following examples, the materials used are all commercially available products.

[0042] In the following examples, the pCMV-PE2-P2A-GFP plasmid used was obtained from Addgene with a catalog number of #132776.

[0043] The pU6-pegRNA-GG-acceptor plasmid used was obtained from Addgene with catalog number #132777.

[0044] The opti-MEM medium (a serum-free medium) used was purchased from Gibco with a catalog number of 11058021.

[0045] The DNA purification kit used was purchased from Beyotime Biotechnology Co., Ltd. with the catalog number D0041S.

[0046] The magnetic chromatin immunoprecipitation analysis kit (Pierce Magnetic ChIP Kit) used was purchased from Thermo Fisher Scientific with the catalog number of 26157X.

[0047] Example (1) Construction of fusion protein expression vector The PE2-P300M1 expression vector, PE2-P300M2 expression vector, and PE2-P300M3 expression vector were constructed respectively, as follows: Using the NotI restriction site, the nucleotide sequence encoding the P300M protein (as shown in SEQ ID NO: 5) was inserted before the cas9-RT sequence in the pCMV-PE2-P2A-GFP plasmid to obtain the PE2-P300M1 expression vector (whose nucleotide sequence is shown in SEQ ID NO: 3).

[0048] Using the KpnI restriction site, the nucleotide sequence encoding P300M (as shown in SEQ ID NO: 5) was inserted into the middle of the cas9-RT sequence in the pCMV-PE2-P2A-GFP plasmid to obtain the PE2-P300M2 expression vector (whose nucleotide sequence is shown in SEQ ID NO: 6).

[0049] The nucleotide sequence encoding P300M (as shown in SEQ ID NO: 5) was inserted into the pCMV-PE2-P2A-GFP plasmid after the cas9-RT sequence using the PmeI restriction site to obtain the PE2-P300M3 expression vector (whose nucleotide sequence is shown in SEQ ID NO: 7).

[0050] (2) Construction of pegRNA expression vector The nucleotide sequence of pegRNA (as shown in SEQ ID NO: 2) was inserted into the pU6-pegRNA-GG-acceptor plasmid (backbone double-digested with BsaAI and BsaBI) to obtain a pegRNA expression vector (the nucleotide sequence of which is shown in SEQ ID NO: 4).

[0051] (3) Gene editing The fusion protein expression vector and the pegRNA expression vector are transfected into bovine fetal fibroblasts to cause gene editing at the genomic DNA target site, specifically comprising the following steps: a. Take out the cryopreserved tube containing bovine fetal fibroblasts from liquid nitrogen, immediately put it in a 37°C water bath, shake it slightly, and centrifuge it at 1500rpm for 5min after the liquid is completely melted; discard the supernatant, add 1mL of cell culture medium to resuspend the cells, and then transfer them to a 10cm culture dish containing 7mL of cell culture medium and shake it gently from front to back and left to right to evenly distribute the cells in the culture dish; place it in a 37°C, 5% CO2 incubator for culture, and after the cells adhere to the wall and grow full, subsequent operations can be performed. In this step a and the following step b, the cell culture medium used is composed of DMEM culture medium and fetal bovine serum (FBS), and the mass of FBS accounts for 10% of the mass of DMEM culture medium. DMEM culture medium is purchased from Gibco, with the item number C119995500BT, and FBS is purchased from Gibco, with the item number 10099-141C.

[0052] b. 1.1×10 6 Bovine fetal fibroblasts were inoculated in a 6-well plate containing cell culture medium at a seeding density of 10 cells and grown. After the cells grew for 24 hours, the PE2-P300M1 expression vector and the pegRNA expression vector were transfected with a transfection reagent. The transfection method is: Add 200 μL of opti-MEM medium and 10 μL of transfection reagent (ExFect Transfecion Reagent, purchased from Nanjing Novogene Biotech Co., Ltd., catalog number #T101) to a 1.5 mL sterile centrifuge tube (referred to as the first sterile centrifuge tube), and mix gently with a pipette; In another 1.5 mL sterile centrifuge tube (recorded as the second sterile centrifuge tube), add 200 μL of opti-MEM medium, 3.75 μg of PE-P300M1 expression vector and 1.25 μg of pegRNA expression vector, and mix gently with a pipette; The mixture in the first sterile centrifuge tube was added dropwise to the second sterile centrifuge tube, mixed by pipetting, and allowed to stand at room temperature for 20 min, and then slowly added to the above 6-well plate inoculated with bovine fetal fibroblasts for transfection.

[0053] Repeat step b, except that the PE2-P300M1 expression vector is replaced by the PE2-P300M2 expression vector; repeat step b again, except that the PE2-P300M1 expression vector is replaced by the PE2-P300M3 expression vector.

[0054] c. Collect cells 48 hours after transfection and extract DNA genome. At the same time, the fluorescence images of cells after transfection with different fusion protein expression vectors and pegRNA expression vectors are shown in Figure 2. Figure 1 As shown, it can be seen that the fusion protein expression vector and the pegRNA expression vector are transfected into the cells, among which the transfection efficiency is the highest when the PE2-P300M1 expression vector and the pegRNA expression vector are transfected.

[0055] (4) Detection of crotonylation expression Design primers for chromatin immunoprecipitation coupled with quantitative polymerase chain reaction (Chip-qPCR) IGF2 Detecting the expression of crotonylation near the editing site of intron 3 of the gene includes the following steps: Take 4×10 transfected cells (i.e. gene-edited cells) 6 The cells were cross-linked with formaldehyde at a final concentration of 1% (mass concentration) for 10 min.

[0056] A magnetic chromatin immunoprecipitation assay kit was used for immunoprecipitation. The primary antibody was lysine acetylated rabbit polyclonal antibody (i.e., Anti-Crotonyllysine Rabbit pAb, purchased from Hangzhou Jingjie Biotechnology Co., Ltd.) and the secondary antibody was immunoglobulin G (i.e., Rabbit Ig G, purchased from Cell Signaling Technology (CST) in the United States). The selection of the primary and secondary antibodies was carried out according to the instructions of the magnetic chromatin immunoprecipitation assay kit.

[0057] The immunoprecipitated DNA fragments were purified using a DNA purification kit to obtain purified DNA fragments, which were used as templates for quantitative PCR (qPCR).

[0058] Among them, the qPCR system: 1 μL of cDNA (i.e., the purified DNA fragments mentioned above), 1 μL of upstream primer IGF2-qPCR-F (1 μM), 1 μL of downstream primer IGF2-qPCR-R (1 μM), 10 μL of SYBR qPCR master mix (purchased from Nanjing Novozymes Biotech Co., Ltd., catalog number Q711-07) and 7 μL of RNase-free water (RNase-free H2O), a total of 20 μL.

[0059] The sequences of the primers are as follows: IGF2-qPCR-F: AAATTGGGTTCGCCTTCGTC (as shown in SEQ ID NO: 8); IGF2-qPCR-R: GCTCTGGGCTCCCTGCTC (as shown in SEQ ID NO: 9).

[0060] The specific procedures are as follows: Pre-denaturation at 95°C for 30 seconds; Denaturation at 95°C for 5 seconds; Annealing at 60℃ for 34s, 72°C extension for 30 s; 40 cycles in total.

[0061] By Chip-qPCR IGF2 The results of detecting crotonylation modification near the editing site of gene intron 3 are shown in the figure Figure 2 As shown, ** indicates P < 0.01, ns indicates no statistical significance, and WT indicates wild-type bovine fetal fibroblasts (not transfected with fusion protein expression vector and pegRNA expression vector). It can be seen that the PE2-P300M1-based lead editing system has the best crotonylation modification effect.

[0062] (5) Sequencing First, the genomic DNA of bovine fetal fibroblasts transfected with the PE2-P300M1 expression vector and the pegRNA expression vector was extracted, specifically including the following steps: The original liquid of the transfected cells was discarded, and the cells were washed twice with 1.5 mL of phosphate buffer, and then 1.5 mL of trypsin (i.e., 0.05% trypsin-EDTA, purchased from Gibco, catalog number 25300-062) was added, and the cells were collected in a 15 mL centrifuge tube, and centrifuged at 1500 rpm for 5 min, and the liquid above was discarded, and 1 mL of phosphate buffer was added to resuspend, and the cells were centrifuged again for 5 min, and the liquid above was discarded, and 1 mL of phosphate buffer was added to obtain the digested cells; The digested cells were added to a 1.5 mL centrifuge tube, and then 20 μL of proteinase K solution was added to the centrifuge tube and mixed, and a DNA extraction system was added. The DNA extraction system was derived from a DNA extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number DP348).

[0063] Then, the extracted DNA was used as a template for PCR amplification, and the PCR reaction system was prepared for first-generation sequencing and second-generation sequencing. At the same time, the results of direct transfection using pCMV-PE2-P2A-GFP plasmid (referred to as PE expression vector) and pegRNA expression vector were used as controls.

[0064] Among them, the primers for first-generation sequencing (Sanger sequencing) are: IGF2-F: GGCCCGAGAAGGCC (as shown in SEQ ID NO: 10); IGF2-R: CTCTGGGCTCCCTGC (as shown in SEQ ID NO: 11).

[0065] The PCR reaction system used for first-generation sequencing (20 μL in total) included: 1 μL DNA template, 1 μL upstream primer IGF2-F (1 μM), 1 μL downstream primer IGF2-R (1 μM), 10 μL Green Taq Mix (purchased from Nanjing Novogene Biotech Co., Ltd., catalog number P131-02), and 7 μL RNase-free water (RNase-free H2O); The PCR reaction procedure is as follows: Pre-denaturation at 95°C for 3 min; Denaturation at 95°C for 10 seconds; Anneal at 59°C for 30 seconds. 72°C extension for 25 s; Extension at 72°C for 10 min; 30 cycles in total.

[0066] Primers for next generation sequencing: IGF2-F-1: ggagtgagtacggtgtgcGGCCCGAGAAGGCC (as shown in SEQ ID NO: 12); IGF2-R-1: gagttggatgctggatggCTCTGGGCTCCCTGC (as shown in SEQ ID NO: 13).

[0067] The PCR reaction system used for next-generation sequencing (20 μL in total) included: 1 μL DNA template, 1 μL upstream primer IGF2-F-1 (1 μM), 1 μL downstream primer IGF2-R-1 (1 μM), 10 μL Green Taq Mix (purchased from Nanjing Novogene Biotech Co., Ltd., catalog number P131-02), and 7 μL RNase-free water (RNase-free H2O); The PCR reaction procedure is as follows: Pre-denaturation at 95°C for 3 min; Denaturation at 95°C for 10 seconds; Anneal at 59°C for 30 seconds. 72°C extension for 25 s; Extension at 72°C for 10 min; 30 cycles in total.

[0068] The PCR product library was purified using the Agencourt AMPure XP Nucleic Acid Purification Kit (purchased from Beckman Coulter, Inc.), and the purified PCR product library was mixed for next-generation sequencing.

[0069] The results are as follows Figure 3 and Figure 4 As shown by Figure 3 It can be seen that IGF2 Intron 3 of the gene is the editing site, specifically the G in it is mutated to A; Figure 4 It can be seen that compared with the existing pilot editing system (i.e., the pilot editing system based on pCMV-PE2-P2A-GFP plasmid, whose gene editing efficiency is 0.5%), the gene editing efficiency of the gene editing system provided by the present invention (0.82%) is greatly improved.

[0070] It should be understood that the application of the present invention is not limited to the above examples. For ordinary technicians in this field, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A fusion protein, characterized in that The amino acid sequence of the fusion protein is shown in SEQ ID NO:

1.

2. A pilot editing system, characterized in that: The lead editing system comprises pegRNA and the fusion protein of claim 1.

3. The lead editing system according to claim 2, characterized in that: The nucleotide sequence of the pegRNA is shown in SEQ ID NO:

2.

4. A gene editing kit, characterized in that: The gene editing kit comprises an expression vector for expressing pegRNA and an expression vector for expressing the fusion protein according to claim 1.

5. A gene editing method, characterized in that: Includes steps: The lead editing system according to any one of claims 2 to 3 is introduced into a host cell for gene editing.

6. The method according to claim 5, characterized in that The prime editing system was introduced into bovine fetal fibroblasts for gene editing.

7. The method according to claim 6, characterized in that The steps of introducing the lead editing system into bovine fetal fibroblasts for gene editing specifically include: A fusion protein expression vector is provided, wherein the nucleotide sequence of the fusion protein expression vector is shown in SEQ ID NO: 3; Inserting the nucleotide sequence of pegRNA into the pU6-pegRNA-GG-acceptor plasmid to obtain a pegRNA expression vector, wherein the nucleotide sequence of the pegRNA expression vector is shown in SEQ ID NO: 4; The fusion protein expression vector and the pegRNA expression vector are transfected into bovine fetal fibroblasts for gene editing.

8. The method according to claim 7, characterized in that The step of transfecting the fusion protein expression vector and the pegRNA expression vector into bovine fetal fibroblasts for gene editing specifically includes: Mixing serum-free culture medium and transfection reagent to obtain a first mixture; Mixing the serum-free culture medium, the fusion protein expression vector and the pegRNA expression vector to obtain a second mixture; Add the first mixture dropwise to the second mixture, mix well, and let stand for 15 to 20 minutes to obtain a third mixture; The third mixture is added to a well plate containing bovine fetal fibroblasts, so that the fusion protein expression vector and the pegRNA expression vector are transfected into the bovine fetal fibroblasts for gene editing.

9. The method according to any one of claims 7-8, characterized in that: The gene editing is IGF2 The G in intron 3 of the gene mutated to A.

10. A cell, characterized in that The cell is obtained by gene editing using the method according to any one of claims 5 to 9.

Images