Application of T7 exonuclease in eliminating nucleic acid pollution caused by PCR (Polymerase Chain Reaction) product

Abstract

The invention relates to the technical field of biology, in particular to application of T7 exonuclease to elimination of nucleic acid pollution caused by PCR (polymerase chain reaction) products. According to the method, PCR products polluted by aerosol or other ways in PCR reaction liquid are degraded by utilizing the specific enzyme digestion activity of the T7 exonuclease to dsDNA fragments, but plasmid or circular DNA similar to bacterial genomes are not degraded, so that the aims of preventing and eliminating nucleic acid pollution caused by the PCR products and improving the accuracy of PCR reaction detection results are fulfilled.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to use of T7 exonuclease in eliminating nucleic acid contamination caused by PCR products. Background Art

[0002] PCR is a technology used to rapidly amplify specific DNA fragments in vitro. It is widely used in scientific research, medical treatment and other fields. Therefore, the accuracy of PCR test results is particularly important. However, aerosol contamination formed by PCR amplification products often occurs and causes false positive test results. Because the sample solution undergoes multiple temperature changes, such as denaturation, annealing and extension, this rapid heating and cooling process causes the liquid in the sample tube to expand and contract, and it is likely that trace amounts of DNA droplets will be released into the air to form aerosols. At the same time, due to many factors such as experimental operations or experimental environment, sample DNA droplets will also escape, thereby contaminating the operating environment and ultimately causing false positive test results. Since PCR technology is a highly sensitive technology, even trace amounts of aerosol contamination will affect the test results. Environmental contamination caused by PCR products in the form of aerosols or other pathways is usually not easy to detect and can persist for months, posing a huge threat to the epidemic monitoring of major epidemics. Therefore, preventing and eliminating nucleic acid contamination caused by PCR products has always been a difficult problem in the field of PCR nucleic acid detection technology.

[0003] The prior art discloses a method for preventing PCR products from forming aerosol contamination, which uses low-melting-point agarose to prevent a large number of target gene fragments from being amplified and forming aerosol contamination, but cannot eliminate the influence of the formed aerosol contamination on the accuracy of PCR detection. Summary of the invention

[0004] Therefore, the technical problem to be solved by the present invention is to overcome the defect in the prior art that nucleic acid contamination caused by PCR products in the form of aerosols or other pathways cannot be eliminated, resulting in inaccurate PCR detection results. Based on T7 nuclease, a use of a T7 nuclease in eliminating nucleic acid contamination caused by PCR products is provided.

[0005] In one aspect, the present invention provides a use of T7 exonuclease in eliminating nucleic acid contamination caused by PCR products.

[0006] In some embodiments, the final concentration of T7 exonuclease in the PCR reaction mixture is 0.5-1 U / μL.

[0007] On the other hand, the present invention also provides a method for eliminating nucleic acid contamination of PCR products, comprising the following steps: mixing a sample to be tested and T7 exonuclease to obtain a mixed solution, and incubating the mixed solution at a temperature of 16-50°C.

[0008] In some embodiments, the mixture further includes primers, a premix and a buffer.

[0009] In some embodiments, the mixture further includes a probe.

[0010] In some embodiments, based on a volume of 20 μL, the volume of the sample to be tested in the mixed solution is 0.8 μL-1.5 μL, the volume of the primer is 0.8 μL-2 μL, the volume of the premix is ​​8 μL-10 μL, the volume of the buffer is 0.1 μL-0.5 μL, and the volume of the probe is 0.1 μL-0.5 μL.

[0011] In some embodiments, the incubation time is 2 min-5 min.

[0012] In some embodiments, the final concentration of T7 exonuclease in the mixture is 0.5U / μL-1U / μL.

[0013] On the other hand, the present invention also provides a kit for eliminating nucleic acid contamination of PCR products, wherein the kit comprises T7 exonuclease.

[0014] In some embodiments, the final concentration of the T7 exonuclease is 0.5 U / μL-1 U / μL.

[0015] Furthermore, the present invention also provides a PCR detection method, characterized in that it includes the following steps: performing PCR amplification on the nucleic acid of the DNA template solution, and determining whether the nucleic acid of the sample to be tested contains the target nucleic acid based on the obtained amplification result, wherein the DNA template solution includes the sample to be tested and T7 nuclease.

[0016] The technical solution of the present invention has the following advantages:

[0017] 1. The present invention provides a use of a T7 exonuclease in eliminating nucleic acid contamination caused by PCR products. The present invention utilizes the specific enzymatic activity of T7 exonuclease on dsDNA fragments to degrade PCR products contaminated by aerosols or other pathways in the PCR reaction solution, but does not degrade plasmids or circular DNA such as bacterial genomes, thereby preventing and eliminating nucleic acid contamination caused by PCR products and improving the accuracy of PCR reaction detection results.

[0018] 2. The present invention provides a method for eliminating nucleic acid contamination of PCR products, comprising the following steps: mixing a sample to be tested and T7 exonuclease to obtain a mixed solution, and incubating the mixed solution at a temperature of 16-50°C. The present invention can eliminate aerosol contamination by mixing the sample to be tested and T7 exonuclease, and incubating the mixture at a temperature of 16-50°C, thereby improving the accuracy of the PCR reaction structure determination. The present invention is easy to operate, has low environmental requirements, and does not affect the subsequent PCR reaction efficiency and reaction products. The inactivation of T7 exonuclease can be achieved by utilizing the denaturation step of the PCR reaction, which will not affect the subsequent PCR reaction and does not require the addition of additional operating steps. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 is a gel electrophoresis diagram of the PCR amplification reaction products of test solution 2-7 in Experimental Example 1 of the present invention;

[0021] Figure 2 is the PCR amplification reaction curve of test solution 1 in Experimental Example 1 of the present invention;

[0022] Figure 3 is the PCR amplification reaction curve of test solution 2 in Experimental Example 1 of the present invention;

[0023] Figure 4 is the PCR amplification reaction curve of test solution 6 in Experimental Example 1 of the present invention;

[0024] Figure 5 is the PCR amplification reaction curve of test solution 8 in Experimental Example 1 of the present invention;

[0025] Figure 6 is a result analysis chart of the PCR amplification reaction Ct values ​​of test solutions 1, 2, 6, and 8 in Experimental Example 1 of the present invention, wherein NP represents the Ct value of the baseline of the amplification curve;

[0026] Figure 7 is a gel electrophoresis diagram of the PCR amplification reaction products of test solutions 1, 9-14 in Experimental Example 1 of the present invention;

[0027] Figure 8 is the PCR amplification reaction curve of test solution 2 in Experimental Example 2 of the present invention;

[0028] Fig. 9is the PCR amplification reaction curve of test solution 3 in Experimental Example 1 of the present invention;

[0029] Fig.10 is the PCR amplification reaction curve of test solution 4 in Experimental Example 1 of the present invention;

[0030] Fig.11 is the PCR amplification reaction curve of test solution 1 in Experimental Example 1 of the present invention;

[0031] Fig.12 This is a result analysis chart of the Ct value of the PCR amplification reaction of the test solutions 1-4 in Experimental Example 2 of the present invention. DETAILED DESCRIPTION

[0032] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0033] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be purchased commercially.

[0034] T7 exonuclease and NEBuffer 2.1 in the present invention were purchased from NEB.

[0035] Experimental Example 1

[0036] This experimental example provides a detection method for eliminating PCR nucleic acid contamination by T7 exonuclease. The specific steps and parameters are as follows:

[0037] 1. Prepare the test solution according to the following components and repeat each test solution 3 times:

[0038] 1uL of Salmonella pullorum bacterial genome (400CFU / uL), 1uL of T7 exonuclease (10U / uL, NEB) and 0.2uL of NEBuffer 2.1 were mixed, and 1uL of dsDNA (350 copies / uL) was added thereto. The PCR reaction solution was prepared according to the PCR reaction system in Table 1, and the PCR reaction solution was incubated at 37°C for five minutes, which was recorded as test solution 1.

[0039] 1uL of Salmonella pullorum bacterial genome (400CFU / uL) and 0.2uL of NEBuffer 2.1 were quantified to 3.2μL using enzyme-free water, and a PCR reaction solution was prepared according to the PCR reaction system in Table 1. The PCR reaction solution was incubated at 37°C for five minutes and recorded as test solution 2.

[0040] 1uL of Salmonella pullorum bacterial genome (400CFU / uL), 1uL of T7 exonuclease (10U / uL, NEB) and 0.2uL of NEBuffer 2.1 were quantified to 3.2μL using enzyme-free water, and a PCR reaction solution was prepared according to the PCR reaction system in Table 1. The PCR reaction solution was incubated at 37°C for five minutes and recorded as test solution 3.

[0041] 1uL of Salmonella pullorum bacterial genome (400CFU / uL), 1uL of T7 exonuclease (10U / uL, NEB) and 0.2uL of NEBuffer 2.1 were added thereto, and 1uL of pUC-19 plasmid (500 copies / uL) was added thereto. The PCR reaction solution was prepared according to the PCR reaction system in Table 1, and the PCR reaction solution was incubated at 37°C for five minutes, which was recorded as test solution 4.

[0042] 1uL of Salmonella pullorum bacterial genome (400CFU / uL) and 0.2uL of NEBuffer 2.1 were mixed, and 1uL of pUC-19 plasmid (500 copies / uL) was added thereto, quantified to 3.2μL with enzyme-free water, and PCR reaction solution was prepared according to the PCR reaction system in Table 1, the PCR reaction solution was incubated at 37°C for five minutes, and the mixed solution was incubated at 37°C for five minutes, which was recorded as test solution 5.

[0043] 1 uL dsDNA (350 copies / uL) and 0.2 uL NEBuffer 2.1 were quantified to 3.2 μL using enzyme-free water, and a PCR reaction solution was prepared according to the PCR reaction system in Table 1. The PCR reaction solution was incubated at 37° C. for five minutes and recorded as test solution 6.

[0044] 1uL dsDNA (350 copies / uL), 1uL T7 exonuclease (10U / uL, NEB) and 0.2uL NEBuffer2.1 were quantified to 3.2μL with enzyme-free water, and the PCR reaction solution was prepared according to the PCR reaction system in Table 1. The PCR reaction solution was incubated at 37°C for five minutes and recorded as test solution 7.

[0045] 1uL of Salmonella pullorum bacterial genome (400CFU / uL) and 0.2uL of NEBuffer 2.1 were mixed, and 1uL of dsDNA (350 copies / uL) was added thereto, and quantified to 3.2μL with enzyme-free water. The PCR reaction solution was prepared according to the PCR reaction system in Table 1, and the PCR reaction solution was incubated at 37°C for five minutes, which was recorded as test solution 8.

[0046] The formula was the same as that of Test Solution 7, except that the incubation temperature was 16°C, and was recorded as Test Solution 9.

[0047] The formula was the same as that of test solution 7, except that the incubation temperature was 25°C, and was recorded as test solution 10.

[0048] The formula was the same as that of test solution 7, except that the incubation temperature was 42°C, and was recorded as test solution 11.

[0049] The formula was the same as that of test solution 7, except that the incubation temperature was 50°C, and was recorded as test solution 12.

[0050] The formula was the same as that of test solution 7, except that the incubation temperature was 0°C, and was recorded as test solution 13.

[0051] The formula was the same as that of Test Solution 7, except that the incubation temperature was 90°C, and was recorded as Test Solution 14.

[0052] The method for extracting the bacterial genome of Salmonella pullorum in this experimental example is as follows:

[0053] The strain of Salmonella pullorum to be detected was inoculated into a sterile LB liquid culture medium and placed in a shaker at 37°C and 180 rpm for overnight fermentation to obtain a bacterial solution; the fermented bacterial solution was centrifuged in a centrifuge at 4°C at 7000 rpm for 15 minutes, the supernatant was discarded, and the genomic DNA was extracted from the bacterial precipitate using a commercial genomic DNA extraction kit (DR0301250, EasyStud, China), and then the genomic DNA concentration was determined using an ultra-micro nucleic acid protein spectrophotometer, and the genomic DNA concentration was adjusted to an applicable concentration using enzyme-free water and stored in a -20°C refrigerator for later use.

[0054] In this experimental example, the dsDNA fragment is the product obtained by amplifying the above-mentioned Salmonella Pullorum (SP) genome by TaqMan qPCR (see Table 1 for the reaction system and Table 2 for the reaction procedure). The dsDNA fragment purification method is obtained according to the instructions of the AxyPrep Mag PCR product purification kit. The dsDNA sequence is shown in SEQ ID NO: 1, and the specific sequence is as follows: 3'-CCGTCGACATCGCCACCTCCAGCCCGCGCATGGTGGCAATTGCGCAGTG CTGCATGCGGCGCGCGTTGCGGGTATTGCCGCCTATGATGTCGTTTGGTC GGATATCAATAATGAAGAAGGCTTCCTGAAGGAAGTGCAGTTGGCGAAA GGG-5'.

[0055] Table 1 PCR reaction system (I)

[0056] Reaction components Reaction volume Primer 1-F (10 μM) 0.5μL Primer 1-R (10 μM) 0.5μL PCR master mix 10μL DNA template (test solution 1-14) 3.2μL Probe (10 μM) 0.3μL Enzyme-free water 5.5μL

[0057] Wherein, the sequence of primer 1-F is shown in SEQ ID NO: 2,

[0058] The specific sequence is 5′-CCGTCGACATCGCCACCTCCAG-3′;

[0059] The sequence of primer 1-R is shown in SEQ ID NO: 3,

[0060] The specific sequence is 5′-CCCTTTCGCCAACTGCACTTCCTTCAG-3′;

[0061] The sequence of the probe is:

[0062] FAM-TGGCAAT(BHQ1)TGCGCAGTGCTGCATGCGGCGCGC;

[0063] Primer-F and Primer-R were synthesized by Hangzhou Shangya Company;

[0064] The probe was synthesized by Qingke Biotechnology Co., Ltd.

[0065] The PCR premix was 2× Taq Pro HS Probe Master purchased from Nanjing Novozymes.

[0066] 2. PCR reaction

[0067] According to the PCR reaction program in Table 2, PCR reaction was performed on the above test solutions.

[0068] Table 2 PCR reaction program

[0069]

[0070] 3. Results and Analysis

[0071] The reaction product obtained after the amplification reaction of the test solution 2-7 was subjected to electrophoresis using 2% wt agarose gel. Figure 1 It can be seen that T7 nuclease can specifically degrade dsDNA fragments, but cannot degrade circular DNA such as plasmids or bacterial genomes, indicating that this nuclease has good potential to resist nucleic acid contamination.

[0072] The amplification reaction curves of test solutions 1, 2, 6, and 8 are shown in Figure 2-Figure 5It can be seen that by adding dsDNA to the reaction system to simulate aerosol pollution, after the experiment, the Ct value of the test solution 2 that was not contaminated by aerosol was 31.85±0.475, the Ct value of the test solution 6 that simulated aerosol pollution was 25.28±0.227, and the aerosol dsDNA fragment was added to the test solution 8 containing the formation of the test solution of the pullorum genome, the Ct value was 25.13±0.085, and the test solution 1 that added T7 nuclease to the reaction solution simulating aerosol pollution had a Ct value of 31.39±0.261. After statistical analysis, the results are shown in Figure 6 ( Figure 6 In the figure, ns indicates no significant difference, *** indicates significant difference), indicating that there are significant differences in the Ct values ​​of test solution 2 (no contamination) and test solution 6 (contamination) and test solution 8 (contamination), while there is no significant difference between test solution 2 (no contamination) and test solution 1 (contamination, but T7 nuclease was added), which indicates that T7 nuclease quickly removes dsDNA contaminants in the reaction system without affecting the detection efficiency.

[0073] The reaction products obtained after the amplification reaction of the test solutions 1 and 9-14 were subjected to electrophoresis using 2 wt% agarose gel. Figure 7 ( Figure 7 The test solution of the control group was test solution 6). It can be seen that T7 exonuclease can maintain its activity within the temperature range of 16°C to 50°C, which means that this enzyme can perform its function of degrading dsDNA aerosols at room temperature without the need for special equipment and special treatment.

[0074] Experimental Example 2

[0075] This experimental example provides a method for detecting the elimination of nucleic acid contamination of PCR products by T7 exonuclease. The specific steps and parameters are as follows:

[0076] 1uL of Escherichia coli genome (400CFU / uL), 1uL of T7 exonuclease (10U / uL, NEB) and 0.2uL of NEBuffer 2.1 were mixed, and 1uL of dsDNA (350 copies / uL) was added thereto. The PCR reaction solution was prepared according to the PCR reaction system in Table 3, and the PCR reaction solution was incubated at 37°C for five minutes, which was recorded as test solution 1.

[0077] 1uL of E. coli genome (400CFU / uL) and 0.2uL of NEBuffer 2.1 were quantified to 3.2μL with enzyme-free water, and a PCR reaction solution was prepared according to the PCR reaction system in Table 3. The PCR reaction solution was incubated at 37°C for five minutes and recorded as test solution 2.

[0078] 1 uL dsDNA (350 copies / uL) and 0.2 uL NEBuffer 2.1 were quantified to 3.2 μL using enzyme-free water, and a PCR reaction solution was prepared according to the PCR reaction system in Table 3. The PCR reaction solution was incubated at 37° C. for five minutes and recorded as test solution 3.

[0079] 1uL of Escherichia coli genome (400CFU / uL) and 0.2uL of NEBuffer 2.1 were mixed, and 1uL of dsDNA (350 copies / uL) was added thereto, quantified to 3.2μL with enzyme-free water, and the PCR reaction solution was prepared according to the PCR reaction system in Table 3. The PCR reaction solution was incubated at 37°C for five minutes and recorded as test solution 4.

[0080] According to the PCR reaction program in Table 2, PCR reaction was performed on the above test solutions.

[0081] Among them, the extraction method of Escherichia coli genome is as follows:

[0082] The strain of Escherichia coli to be tested was inoculated into a sterile LB liquid medium, and placed in a shaking incubator at 37°C and 180 rpm for overnight fermentation to obtain a bacterial liquid;

[0083] The fermented bacterial liquid was centrifuged at 7000 rpm in a centrifuge at 4°C for 15 min, the supernatant was discarded, and the genomic DNA was extracted from the bacterial precipitate using a commercial genomic DNA extraction kit (DR0301250, EasyStud, China). The genomic DNA concentration was then determined using an ultra-micro nucleic acid protein spectrophotometer, and the genomic DNA concentration was adjusted to an appropriate concentration using enzyme-free water and stored in a -20°C refrigerator for later use.

[0084] The dsDNA fragment of this example is the product of TaqMan qPCR amplification of the Escherichia coli (Salmonella Pullorum, SP) genome. The dsDNA fragment purification method is obtained according to the instructions of the AxyPrep Mag PCR product purification kit. The dsDNA sequence is shown in SEQ ID NO: 4, 5′-GTGCCGGAGGTTGGTTCATAGATACCAGCCAACAGCTTCAGTAGCGTAGA TTTTCCCGCGCCATTGTTTCCAATAAGTCCGAGTTTATCACCTTCTTTCAGA CTAAACGTTAAACCGTCTAATGATTTAACCGTAACCGTGCTGCTT-3′.

[0085] Table 3 PCR reaction system (II)

[0086] Reaction components Reaction volume Primer 2-F (10 μM) 0.5μL Primer 2-R (10 μM) 0.5μL PCR master mix 10μL DNA template (test solution 1-4) 3.2μL Enzyme-free water 5.8μL

[0087] In Table 3,

[0088] The sequence of primer 2-F is shown in SEQ ID NO:5,

[0089] The specific sequence is 5′-AAGCAGCACGGTTACGGTTA-3′;

[0090] The sequence of primer 2-R is shown in SEQ ID NO:6,

[0091] The specific sequence is 5′-GTGCCGGAGGTTGGTTCATA-3′;

[0092] Primer-F and Primer-R were synthesized by Hangzhou Shangya Company;

[0093] The PCR premix was ChamQ Universal SYBR qPCR Master Mix purchased from Nanjing Novozymes, and the premix contained Syber Green fluorescent dye.

[0094] Results Figure 8-Figure 11 It can be seen that by adding dsDNA to the reaction system to simulate aerosol pollution, after the experiment, the Ct value of the E. coli genome in test solution 2 that was not contaminated by aerosol was 30.98±0.61, the Ct value of test solution 3 that simulated aerosol pollution was 24.93±0.37, the Ct value of test solution 4 formed by adding aerosol dsDNA fragments containing E. coli genome to simulate dsDNA aerosol pollution was 24.40±0.49, and the Ct value of test solution 1 that added T7 nuclease to the reaction solution simulating aerosol pollution was 30.47±0.41. After statistical analysis, the results are shown in Fig.12 ( Fig.12 In the figure, ns indicates no significant difference, *** indicates significant difference), indicating that there are significant differences in the Ct values ​​of test solution 2 (no contamination) and test solution 3 (contamination) and test solution 4 (contamination), while there is no significant difference between test solution 2 (no contamination) and test solution 1 (contamination, but T7 nuclease was added), which indicates that T7 nuclease quickly removes dsDNA contaminants in the reaction system and does not affect the detection efficiency.

[0095] Example 1

[0096] This example provides a method for eliminating nucleic acid contamination of PCR products using T7 exonuclease, and the specific steps and parameters are as follows:

[0097] 1uL of Salmonella pullorum bacterial genome (400CFU / uL), 1uL of T7 exonuclease (10U / uL, NEB), 0.2uL of NEBuffer 2.1, 0.5uL of primer 1-F (sequence as shown in SEQ ID NO:3, 10uM), 0.5uL of primer 1-R (sequence as shown in SEQID NO:4, 10uM), 10uL of PCR premix (2×Taq Pro HS Probe Master), 0.3uL of probe (sequence as shown in SEQ ID NO:5, 10uM), and the rest of enzyme-free water, a total of 20uL of PCR reaction solution, and incubate the PCR reaction solution at 20°C for 5 minutes.

[0098] The incubated PCR reaction solution was reacted according to the reaction program in Table 2.

[0099] Example 2

[0100] This example provides a method for eliminating nucleic acid contamination of PCR products using T7 exonuclease, and the specific steps and parameters are as follows:

[0101] 1uL of Salmonella pullorum bacterial genome (400CFU / uL), 1uL of T7 exonuclease (10U / uL, NEB), 0.2uL of NEBuffer 2.1, 0.5uL of primer 1-F (sequence as shown in SEQ ID NO:3, 10uM), 0.5uL of primer 1-R (sequence as shown in SEQID NO:4, 10uM), 10uL of premix (2×Taq Pro HS Probe Master), and the rest of enzyme-free water, a total of 20uL of PCR reaction solution, and incubate the PCR reaction solution at 20°C for 5 minutes.

[0102] The incubated PCR reaction solution was reacted according to the reaction program in Table 2.

[0103] Example 3

[0104] This example provides a method for eliminating nucleic acid contamination of PCR products using T7 exonuclease. The specific steps and parameters are the same as those in Example 1, except that the PCR reaction solution is incubated at 20° C. for 2 minutes.

[0105] Example 4

[0106] This example provides a method for eliminating nucleic acid contamination of PCR products using T7 exonuclease. The specific steps and parameters are the same as those in Example 1, except that the PCR reaction solution is incubated at 16° C. for 5 minutes.

[0107] Example 5

[0108] This example provides a method for eliminating nucleic acid contamination of PCR products using T7 exonuclease. The specific steps and parameters are the same as those in Example 1, except that the PCR reaction solution is incubated at 50° C. for 5 minutes.

[0109] Example 6

[0110] This example provides a method for eliminating nucleic acid contamination of PCR products using T7 exonuclease, and the specific steps and parameters are as follows:

[0111] 0.8uL of Salmonella pullorum bacterial genome (400CFU / uL), 2uL of T7 exonuclease (10U / uL, NEB), 0.5uL of NEBuffer 2.1, 0.4uL of primer 1-F (sequence as shown in SEQ ID NO:3, 10uM), 0.4uL of primer 1-R (sequence as shown in SEQ ID NO:4, 10uM), 8uL of premix (2×Taq Pro HS Probe Master), 0.5uL of probe (sequence as shown in SEQ ID NO:5, 10uM), and the rest of enzyme-free water, a total of 20uL of PCR reaction solution, and incubate the PCR reaction solution at 27°C for 5 minutes.

[0112] The incubated PCR reaction solution was reacted according to the reaction program in Table 2.

[0113] Example 7

[0114] This example provides a method for eliminating nucleic acid contamination of PCR products using T7 exonuclease, and the specific steps and parameters are as follows:

[0115] 1.5uL of Salmonella pullorum bacterial genome (400CFU / uL), 1uL of T7 exonuclease (10U / uL, NEB), 0.1uL of NEBuffer 2.1, 1uL of primer 1-F (sequence as shown in SEQ ID NO:3, 10uM), 1uL of primer 1-R (sequence as shown in SEQ ID NO:4, 10uM), 9uL of premix (2×Taq Pro HS Probe Master), 0.1uL of probe (sequence as shown in SEQID NO:5, 10uM), and the rest of enzyme-free water, a total of 20uL of PCR reaction solution, and incubate the PCR reaction solution at 27°C for 5 minutes.

[0116] The incubated PCR reaction solution was reacted according to the reaction program in Table 2.

[0117] Example 8

[0118] This example provides a method for eliminating nucleic acid contamination of PCR products using T7 exonuclease, and the specific steps and parameters are as follows:

[0119] 1uL of Escherichia coli genome (400CFU / uL), 1uL of T7 exonuclease (10U / uL, NEB), 0.2uL of NEBuffer 2.1, 0.5uL of primer 2-F (sequence as shown in SEQ ID NO:5, 10uM), 0.5uL of primer 2-R (sequence as shown in SEQ ID NO:6, 10uM), 10uL of PCR premix (ChamQ Universal SYBR qPCR Master Mix), and the rest of enzyme-free water, a total of 20uL of PCR reaction solution, and incubate the PCR reaction solution at 20°C for 5 minutes.

[0120] The incubated PCR reaction solution was reacted according to the reaction program in Table 2.

[0121] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. The use of T7 exonuclease in eliminating nucleic acid contamination caused by PCR products.

2. The use according to claim 1, characterized in that The final concentration of T7 exonuclease in the PCR reaction mixture is 0.5-1 U / μL.

3. A method for eliminating nucleic acid contamination of PCR products, characterized in that: The following steps are included: The sample to be tested and T7 exonuclease are mixed to obtain a mixed solution, and the mixed solution is incubated at a temperature of 16-50°C.

4. The method for eliminating nucleic acid contamination of PCR products according to claim 3, characterized in that: The mixed solution also includes primers, premix solution and buffer solution.

5. The method for eliminating nucleic acid contamination of PCR products according to claim 4, characterized in that: The mixed solution also includes a probe.

6. The method for eliminating nucleic acid contamination of PCR products according to claim 5, characterized in that: Based on a volume of 20 μL, the volume of the sample to be tested in the mixed solution is 0.8 μL-1.5 μL, the volume of the primer is 0.8 μL-2 μL, the volume of the premix is ​​8 μL-10 μL, the volume of the buffer is 0.1 μL-0.5 μL, and the volume of the probe is 0.1 μL-0.5 μL; and / or, The incubation time is 2 min-5 min.

7. The method for eliminating nucleic acid contamination of PCR products according to claim 5, characterized in that: The final concentration of T7 exonuclease in the mixed solution is 0.5U / μL-1U / μL.

8. A kit for eliminating nucleic acid contamination of PCR products, characterized in that: The kit includes T7 exonuclease.

9. The kit for eliminating aerosol contamination in PCR according to claim 8, characterized in that: The final concentration of the T7 exonuclease is 0.5U / μL-1U / μL.

10. A PCR detection method, characterized in that: The following steps are included: The nucleic acid in the DNA template solution is amplified by PCR, and the presence of the target nucleic acid in the nucleic acid of the sample to be tested is determined according to the obtained amplification result, wherein the DNA template solution includes the sample to be tested and T7 exonuclease.

Images