Detection method of chicken back hair follicle density character, PCR detection primer pair and detection kit

Abstract

The invention discloses a chicken back hair follicle density character detection method, a PCR detection primer pair and a detection kit, and relates to the technical field of poultry genetic breeding and biologication.The chicken back hair follicle density character detection method comprises the following steps that (1) the genotype of chicken SNP-FAT1 to be detected is detected, the SNP-FAT1 is located at the 61238343th site of a chicken chromosome 4, the basic group of the site is A or C, and the corresponding genotypes comprise CC, CA and AA; and (2) judging the back hair follicle character of the chicken to be detected according to the detection genotype. According to the method, the relation between the specific gene SNP-FAT1 of the chicken and the chicken back hair follicle density character is found, living body seed selection of the chicken back hair follicle density character can be achieved according to the detected genotype, compared with traditional sib selection, the accuracy of seed selection can be obviously improved, the hair follicle density of the variety can be stably improved by continuously applying the method, and the breeding efficiency of the chicken back hair follicle density character is improved. The breeding benefit of the variety is increased.

Description

Technical Field

[0001] The invention relates to the field of poultry genetic breeding and biotechnology, and in particular to a method for detecting the trait of hair follicle density on the back of a chicken, a PCR detection primer pair, and a detection kit. Background Art

[0002] Improving the appearance of broiler carcasses has also attracted more and more attention from breeders. The density of hair follicles can affect the appearance of yellow-feathered broiler carcasses, and thus affect consumers' purchasing desire. Therefore, in-depth research on the regulatory mechanism of chicken hair follicle density traits, exploring the key genes and molecular markers that affect hair follicle density traits, and applying them to breeding practice are of great significance for accelerating the genetic improvement of broiler carcass appearance traits. The determination of chicken hair follicle density traits is currently mainly determined by counting after slaughter and plucking, and can only be indirectly selected through sibling relationships. The high cost of determination increases the difficulty of breeding for this trait.

[0003] With the development of modern breeding technology, single nucleotide polymorphism (SNP) has been widely used as a genetic marker in gene mapping, cloning, breeding, genetic diversity and other research fields. Therefore, it is of great significance to identify molecular markers related to chicken hair follicle density traits.

[0004] The FAT1 gene (Dystrophin) encodes FAT atypical cadherin 1, a member of the atypical cadherin superfamily, which is widely expressed in epithelial tissues, including skin and glomerular epithelial cells. It is involved in the regulation of cell morphology and the formation and maintenance of various tissues and organs, such as the polarization of epithelial cells and cochlear hair cells. FAT1 participates in the planar cell polarity (PCP) signaling pathway. Members of this pathway, such as Fuz, Rac1 and Frizzled6, have been shown to play an important role in the morphogenesis, cycle and orientation of hair follicles in mammals. Studies in mice have found that knockout of the Fuz gene can significantly reduce the number of dorsal hair follicles and delay the morphogenesis of hair follicles; knockout of the Rac1 gene can cause hair loss in mice; knockout of Frizzled6 can change the direction of dorsal hair follicles; and studies have found that FAT1 gene expression and site polymorphism are significantly correlated with traits such as wool length and diameter. The above evidence suggests that the FAT1 gene is closely related to mammalian hair follicle traits, but it is still unknown whether the FAT1 molecular marker can be applied to the genetic improvement of chicken carcass appearance traits.

[0005] Therefore, although it is feasible to identify molecular markers related to the chicken hair follicle density trait at present, further research is needed on how to identify the chicken hair follicle density trait through molecular markers. Summary of the invention

[0006] The invention discloses a detection method for the chicken back hair follicle density trait, a PCR detection primer pair, and a detection kit, so as to improve the molecular breeding method for the chicken hair follicle density trait, improve the accuracy of chicken hair follicle density trait selection, and accelerate the progress of breeding of new yellow-feathered broiler varieties.

[0007] The technical solution adopted by the present invention is as follows:

[0008] First, the present invention provides a method for detecting the characteristics of hair follicles on the back of a chicken, comprising the following steps:

[0009] (1) Detecting the genotype of the chicken SNP-FAT1 to be tested, wherein the SNP-FAT1 is located at position 61238343 of chicken chromosome 4, the base of which is A or C, and the corresponding genotypes include CC, CA, and AA;

[0010] (2) The back hair follicle traits of the tested chickens were determined based on the detected genotypes. The density relationships between the three genotypes and the chicken hair follicle density traits were as follows:

[0011]

[0012] Furthermore, the detection method of the genotype of SNP-FAT1 is a PCR detection method, wherein the PCR detection primer pair consists of Primer-FAT1-F and Primer-FAT1-R, and the nucleotide sequences of Primer-FAT1-F and Primer-FAT1-R are shown in SEQ ID No: 1 and SEQ ID No: 2, respectively;

[0013] Among them, Primer-FAT1-F (SEQ ID No: 1): CTCCTCCATCTGTGGCTTTC;

[0014] Primer-FAT1-R (SEQ ID No: 2):ATGTCACCCATGTGCTGTGT.

[0015] Furthermore, the detection process of the genotype of SNP-FAT1 includes the following steps:

[0016] (1) using a PCR detection primer pair to perform PCR amplification on the genomic DNA of the chicken to be tested;

[0017] (2) Sequencing the obtained PCR amplification product can obtain the genotype of the 61238343th site of the tested chicken chromosome 4.

[0018] Secondly, the present invention limits the application of the method for detecting the chicken back hair follicle traits in broiler genetic breeding.

[0019] Furthermore, the direction of broiler genetic breeding is the selection of the trait of hair follicle density on the chicken's back.

[0020] Furthermore, the present invention designs a PCR detection primer pair for detecting genes related to the chicken back hair follicle density trait, and the PCR detection primer pair consists of Primer-FAT1-F and Primer-FAT1-R, and the nucleotide sequences of Primer-FAT1-F and Primer-FAT1-R are shown in SEQ ID No: 1 and SEQ ID No: 2, respectively.

[0021] Furthermore, the present invention limits the application of the PCR detection primer pair in broiler genetic breeding.

[0022] The present invention further discloses a PCR detection kit for detecting the trait of hair follicle density on the back of chickens. The kit comprises a PCR detection primer pair Primer-FAT1-F and Primer-FAT1-R.

[0023] Furthermore, the present invention limits the application of the PCR detection kit in broiler genetic breeding.

[0024] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0025] (1) The present invention discovered the connection between the specific gene SNP-FAT1 of chicken and the trait of hair follicle density on the back of chicken. According to the genotype obtained by detection, the live selection of the trait of hair follicle density on the back of chicken can be realized. Compared with the traditional sibling selection, the accuracy of selection can be significantly improved. The continuous application of this method can stably improve the hair follicle density of the breed and increase the breeding efficiency of the breed.

[0026] (2) The detection scheme provided by the present invention can be used to achieve early selection of chicken hair follicle density traits, reduce the number of groups that need to be raised, reduce breeding costs, and at the same time reduce the generation interval of breeding, thereby accelerating breeding progress. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a Manhattan plot of the genome-wide association analysis of the dorsal hair follicle density trait of the Zhonglihua Huangjiao Ma chicken population in Example 1 of the present invention;

[0028] Figure 2 This is a QQ plot of the genome-wide association analysis of the dorsal hair follicle density trait of the Zhonglihua yellow-footed chicken population in Example 1 of the present invention. DETAILED DESCRIPTION

[0029] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0030] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0031] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0032] Example 1

[0033] This example uses genome-wide association analysis to mine SNP sites associated with chicken hair follicle density traits, and the specific steps are as follows:

[0034] 1. Experimental animal population and hair follicle density trait phenotype determination

[0035] The experimental subjects selected in this study are the terminal paternal line of Lihua yellow-footed chickens. The main selected traits of this line are body weight, feed conversion rate and slaughter rate. It has undergone nine generations of closed breeding. The experimental chickens were raised at the Jintan breeding base of Lihua Company. All experimental chickens were hatched and raised in the same chicken house in the same batch. The feeding method and immunization program all adopted the standard program established by Lihua Company.

[0036] 1.5 ml of blood was collected from the right wing vein of all experimental animals. After the blood was collected, it was transferred into a blood collection tube containing EDTA, and the tube was slowly shaken up and down to fully mix the EDTA and blood. The tube was then stored at -20°C for later use.

[0037] After 60 days of age, the back skin 2х2cm was uniformly counted. 2 The number of hair follicles in the chickens was measured, and a total of 400 chickens were tested. All the phenotypic values ​​of hair follicle density were then cleaned to remove abnormal and duplicate values, and finally 378 hair follicle density trait data were obtained for genome-wide association analysis.

[0038] 2. Genome-wide association analysis

[0039] 378 individuals with valid hair follicle density phenotypic data were selected, and genomic DNA was extracted using the phenol-chloroform method, and the quality of DNA extraction was evaluated using an ND-1000 spectrophotometer. DNA library construction and whole-genome sequencing were performed according to the standard BGISEQ procedure. Genomic library preparation was performed on qualified DNA samples, and whole-genome resequencing was performed using the DNBSEQT7 platform with a sequencing depth of 10×.

[0040] After obtaining the raw sequencing data, FASTP software was used to filter and remove low-quality reads, and the obtained Clean Reads were quality controlled. The reads obtained after quality control were then aligned to the reference genome GRcg7b using BWA software. Duplicate alignment reads were removed using Picard software. High-quality SNP sites were obtained through GATK4 software analysis, and 10,266,594 SNPs were finally obtained for subsequent analysis.

[0041] Before conducting the whole genome association analysis, the principal component analysis (PCA) of the population was performed using PLINK software to eliminate false positives caused by the population structure, and the first three principal components were added to the genetic statistical model as covariate parameters. The mixed linear model of the GEMMA program was used to conduct the whole genome association analysis of hair follicle density traits, and the statistical model used was as follows:

[0042] y=Wα+xβ+u+∈

[0043] Among them, y represents the phenotypic value of the dorsal hair follicle density trait of 378 individuals, W is the fixed effect matrix containing the first three principal components from PCA, α is the fixed effect vector, x represents the genotype vector, β is the effect vector of SNPs, u is the random effect vector, and ∈ is the residual.

[0044] A total of 432,529 independent SNP markers were obtained through linkage disequilibrium analysis. Using Bonferroni correction, the significance threshold of this test at the genome level was set to 1.16e-07, and the significance threshold of the genome potential level was set to 2.31e-06.

[0045] The results of genome-wide association analysis are as follows Figure 1 , Figure 2 As shown. Figure 1 As shown in Table 1, there is a locus on chromosome 4 that is significantly associated with the dorsal hair follicle density trait at the genomic level, specifically located at locus 61238343 on chromosome 4. Gene annotation found that the locus is located in the 17th intron of the FAT1 gene, with bases A or C, and the corresponding registration number in the dbSNP database is rs15598338. QQ diagram ( Figure 2 ) confirmed that the test results are reliable.

[0046] Table 1 Molecular markers at genomic significance level for the trait of hair follicle density on the back of chicken

[0047] Tag Name Genomic location Gene SNP location Base mutation P-value SNP-FAT1 4:61238343 FAT1 Intron A / C 1.38E-06

[0048] Example 2

[0049] This example detects and verifies the gene loci screened in Example 1, and uses the locus SNP-FAT1 to perform association analysis on the back hair follicle density trait in the Lihua Huangjiao Ma chicken breeding population. The specific steps are as follows:

[0050] 1. PCR primer design and synthesis: According to the DNA sequence information of the FAT1 gene included in the NCBI website, PCR amplification primers were designed using the primer3 online tool. The primer sequence information is shown in Table 2. PCR primer synthesis was completed by Shanghai Sangon Biotechnology Co., Ltd.

[0051] Table 2 Primer sequences

[0052]

[0053] 2. Genomic DNA extraction: Genomic DNA was extracted using the phenol-chloroform method, and the quality of DNA extraction was evaluated using an ND-1000 spectrophotometer.

[0054] 3. PCR amplification and sequencing: 10 μL reaction system includes 50 ng of DNA to be amplified, 10 ng of forward and reverse primers, 5 μL of 2×power Taq MasterMix, and the remaining volume is filled with deionized water. The reaction procedure includes 94°C denaturation for 30 s, annealing temperature of 54°C, annealing time of 30 s, and extension of 72°C for 30 s, for a total of 5 cycles; then 94°C denaturation for 30 s, annealing temperature of 54°C, annealing time of 30 s, and extension of 72°C for 30 s, for a total of 30 cycles; 72°C extension for 5 min, and storage at 4°C. The amplified product was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequence polymorphism detection.

[0055] 4. Determination of back hair follicle density: After 60-day-old slaughter and plucking, count the back skin of the individual (2×2 cm) 2 The density of hair follicles within an area.

[0056] 5. Association analysis: The GLM procedure of SAS statistical analysis software package was used for statistical analysis. The genotype of the test chickens and the dorsal hair follicle density trait at 60 days of age were analyzed by variance according to the generalized linear model. P-value < 0.05 indicated significant differences.

[0057] Statistical analysis model:

[0058] y=μ+G+e

[0059] Where y represents the individual phenotypic value; μ represents the population mean; G represents the genotype effect; and e represents the remaining residual effect.

[0060] The results are shown in Table 3.

[0061] Table 3 Hair follicle density traits on the back of individuals with different genotypes at 60 days of age

[0062]

[0063] As can be seen from Table 3, there are significant differences in the back hair follicle density of the three genotypes. The back hair follicle density of individuals with AA genotype is higher than that of individuals with CA and CC genotypes, among which the back hair follicle density of individuals with CA genotype is significantly higher than that of individuals with CC genotype. Therefore, AA is the dominant genotype of the genetic marker SNP-FAT1, which can be used as a molecular marker for the selection of back hair follicle density traits and carcass appearance traits.

[0064] Finally, it should be noted that the terms "comprises," "comprising," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or device comprising a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article, or device. Although preferred embodiments of the present invention have been described, additional changes and modifications may be made to these embodiments by those skilled in the art once the basic inventive concepts are known. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0065] The above-mentioned embodiments only express the specific implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the protection scope of the present application. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the technical solution concept of the present application, and these all belong to the protection scope of the present application.

Claims

1. A method for detecting the characteristics of hair follicles on the back of a chicken, characterized in that: The steps include: (1) Detecting the genotype of the chicken SNP-FAT1 to be tested, wherein the SNP-FAT1 is located at position 61238343 of chicken chromosome 4, the base of which is A or C, and the corresponding genotypes include CC, CA, and AA; (2) The back hair follicle traits of the tested chickens were determined based on the detected genotypes. The density relationships between the three genotypes and the chicken hair follicle density traits were as follows: 。 2. The method for detecting the properties of chicken back hair follicles as claimed in claim 1, characterized in that: The method for detecting the genotype of SNP-FAT1 is a PCR detection method, wherein the PCR detection primer pair consists of Primer-FAT1-F and Primer-FAT1-R, and the nucleotide sequences of Primer-FAT1-F and Primer-FAT1-R are shown in SEQ ID No: 1 and SEQ ID No: 2, respectively.

3. The method for detecting the properties of chicken back hair follicles as claimed in claim 2, characterized in that: The detection process of the genotype of SNP-FAT1 includes the following steps: (1) using a PCR detection primer pair to perform PCR amplification on the genomic DNA of the chicken to be tested; (2) Sequencing the obtained PCR amplification product can obtain the genotype of the 61238343th site of the tested chicken chromosome 4.

4. Use of the detection method according to any one of claims 1 to 3 in broiler genetic breeding.

5. The use according to claim 4, characterized in that The direction of broiler genetic breeding is the selection of the trait of hair follicle density on the chicken's back.

6. A PCR primer pair for detecting the hair follicle density trait on the back of a chicken, characterized in that: The PCR detection primer pair consists of Primer-FAT1-F and Primer-FAT1-R, and the nucleotide sequences of Primer-FAT1-F and Primer-FAT1-R are shown in SEQ ID No: 1 and SEQ ID No: 2, respectively.

7. Use of the PCR detection primer pair as claimed in claim 6 in broiler genetic breeding.

8. A PCR detection kit for detecting the trait of hair follicle density on the back of a chicken, characterized in that: The kit comprises the PCR detection primer pair as described in claim 6.

9. Use of the PCR detection kit as claimed in claim 8 in broiler genetic breeding.

Images