InDel molecular marker for identifying sunshine No.1 tangelo and application of InDel molecular marker

Abstract

The invention discloses an InDel molecular marker for identifying sunshine No.1 tangelo and application of the InDel molecular marker. The nucleotide sequence of the InDel molecular marker is as shown in SEQ ID No. 1. According to the invention, the InDel molecular marker for identifying the sunshine No.1 tangelo is successfully screened, a primer pair or a kit is developed based on the InDel molecular marker, and the breeding workload can be reduced and the correctness of the variety of the nursery stock can be ensured by applying the identification of the sunshine No.1 tangelo nursery stock.

Description

Technical Field

[0001] The present invention relates to the technical field of citrus molecular markers, and in particular to an InDel molecular marker for identifying Sunshine No. 1 tangerine and grapefruit and an application thereof. Background Art

[0002] Sunshine No. 1 tangerine and pomelo is a hybrid of Ehime 28 as the female parent and Chunxiang tangerine and pomelo as the male parent, and obtained the new plant variety rights in 2021. Sunshine No. 1 tangerine and pomelo has orange flesh, very thin and transparent valve membrane, crisp and tender flesh, strong flavor, sweet and sour taste, seedless, excellent quality, and extremely durable in storage and transportation after harvest. It is a "newcomer" among citrus varieties in recent years.

[0003] Sunshine No. 1 pomelo is very popular in the market due to its excellent quality and storage resistance, and the demand for seedlings is far greater than the supply of seedlings. Sunshine No. 1 pomelo belongs to the category of hybrid citrus in the citrus classification. Its leaves are very similar to those of varieties such as Nashi, Harumi, and Haruka. It is difficult to distinguish them from the morphology during the seedling stage. This gives some merchants an opportunity to pass off other hybrid citrus varieties as Sunshine No. 1 pomelo, which seriously damages the rights and interests of growers. If DNA molecular markers can be used to achieve early selection during the seedling stage, it will greatly reduce the losses of growers and reduce the occurrence of "inferior products as good ones" and seedling confusion. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the prior art and provide an InDel molecular marker for identifying Sunshine No. 1 pomelo and its application. The present invention can effectively distinguish Sunshine No. 1 pomelo from other citrus varieties, and provide a simple, fast and effective auxiliary breeding method for the identification of early varieties of Sunshine No. 1 pomelo seedlings.

[0005] To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0006] The present invention provides an InDel molecular marker for identifying Sunshine No. 1 pomelo, and the nucleotide sequence of the InDel molecular marker is shown as SEQ ID No.1.

[0007] The present invention also provides a primer pair for obtaining the above-mentioned InDel molecular marker, wherein the primer pair is:

[0008] Forward primer F: AGTTGTGTAGTGTTCAGGACGTAG,

[0009] Reverse primer R: CAAGTGTGATGGAGTCCTGATAGA.

[0010] The present invention also provides an application of the primer pair in identifying Sunshine No. 1 pomelo or in preparing a kit for identifying Sunshine No. 1 pomelo.

[0011] The present invention also provides a kit for identifying Sunshine No. 1 pomelo, wherein the kit contains the above-mentioned primer pair.

[0012] The present invention also provides a method for identifying Sunshine No. 1 pomelo, comprising the following steps:

[0013] 1) Extracting genomic DNA from the sample to be tested,

[0014] 2) using the above genomic DNA as a template, and using the primers described in claim 2 or the kit described in claim 4 to perform PCR amplification to obtain a PCR product;

[0015] 3) PCR product electrophoresis detection, the detection results are analyzed as follows:

[0016] When a band 1 of 1231 bp is displayed, the band 1 contains an InDel molecular marker (the nucleotide sequence is shown as SEQ ID No. 1), and the variety to be tested is Sunshine No. 1 Citrus pomelo.

[0017] Alternatively, when any one or two small fragment bands smaller than 500 bp are displayed, the variety to be tested is another citrus variety.

[0018] Furthermore, in step 2), the system of PCR amplification is as follows:

[0019] Mix 7μl Forward primer F (10mmol / L) 0.3μl Reverse primer R (10mmol / L) 0.3μl Genomic DNA 1.5μl <![CDATA[dd H2O]]> 5.9μl total 15μl

[0020] The PCR amplification procedure included: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles; and extension at 72°C for another 5 min.

[0021] When the primer pair or kit of the present invention is used for variety identification, PCR amplification and agarose gel electrophoresis are used to retain the primers with clear gel images and sizes that are completely consistent with the predictions (i.e., a band of 1231 bp, containing an InDel molecular marker, whose nucleotide sequence is as shown in SEQ ID No. 1), the variety to be tested is Sunshine No. 1 tangerine pomelo; when one or two bands less than 500 bp are visible in primer amplification, it indicates that the variety to be tested is other citrus varieties, and there is a size difference that can be distinguished by the gel image, which can be determined as a marker with good effect that can be used. The agarose gel electrophoresis of the present invention preferably uses a 2% agarose gel by mass, a voltage of 120V, and electrophoresis for 15-20min.

[0022] The present invention also provides an application of the primer or the kit in early identification of Sunshine No. 1 tangerine and pomelo.

[0023] The present invention also provides an application of the primer or the kit in tangerine and pomelo breeding.

[0024] The primer pair or kit of the present invention can be applied to the early identification of Sunshine No. 1 tangerine pomelo, and the young leaves of young trees can be used, so the genomic DNA is preferably extracted from young leaves. The present invention does not specifically limit the method for extracting the genomic DNA, and preferably uses the CTAB method or the kit method.

[0025] Beneficial effects of the present invention:

[0026] The present invention successfully screened and obtained an InDel molecular marker for identifying Sunshine No. 1 pomelo, and developed a pair of primer pairs or a kit based on the InDel molecular marker. By using the identification of Sunshine No. 1 pomelo seedlings, the breeding workload can be reduced to ensure the correctness of the seedling variety. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The electrophoresis diagram of PCR products of 48 samples to be tested is shown in Figure 2.

[0028] Among them, 1 represents 439 orange; 2 represents Yuan Xiaochun; 3 represents seedless orange; 4 represents Asumimi; 5 represents Ehime 68; 6 represents Ehime 46; 7 represents Haruhime; 8 represents Ehime 28 (Sunshine No. 1 tangerine and grapefruit female parent); 9 represents Kiyomi; 10 represents Sunshine No. 1 tangerine and grapefruit; 11 represents Amakusa; 12 represents Tsu no Kaori; 13 represents Yang Kaori; 14 represents Nishi no Kaori; 15 represents Ganping; 16 represents Golden Autumn Sugar Mandarin; 17 represents Qiu Hui; 18 represents Nichi Hui; 19 represents W. Murcott; 20 represents Wogan; 21 represents Shiranui; 22 represents Harumi; 23 represents Ehime 34; 24 represents Haru Kaori tangerine and grapefruit (Sunshine No. 1 25 represents Ou orange; 26 represents Mandarin orange; 27 represents Mantouhong Zhu orange; 28 represents Rinan No. 1; 29 represents Four Seasons orange; 30 represents Hongguang; 31 represents Kishu; 32 represents Xingjin; 33 represents Miguang; 34 represents Zhuhong orange; 35 represents Yamashita red; 36 represents Sandang orange; 37 represents Oita No. 1; 38 represents Nangan No. 20; 39 represents Shuangjin No. 1; 40 represents Dapu No. 5; 41 represents Xinyu Mandarin orange; 42 represents Sanhu red orange; 43 represents Sanhu Huahong; 44 represents Ponkan; 45 represents Zhuju; 46 represents Jian orange; 47 represents Yangxiao 26; 48 represents Miyakawa. DETAILED DESCRIPTION

[0029] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0030] Example 1

[0031] Based on the results of whole genome resequencing, compared with the genomes of other varieties, it was found that Sunshine No. 1 pomelo had a unique fragment with good polymorphism at 18687885bp on chromosome 6. The fragment was named InDel molecular marker, and its nucleotide sequence was shown in SEQ ID No. 1:

[0032]

[0033] Example 2

[0034] The above InDel molecular markers are designed with primer pairs:

[0035] Forward primer F: AGTTGTGTAGTGTTCAGGACGTAG, as shown in SEQ ID No. 2;

[0036] Reverse primer R: CAAGTGTGATGGAGTCCTGATAGA, as shown in SEQ ID No. 3;

[0037] The primers synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. were commissioned to perform PCR amplification using the genome of Sunshine No. 1 pomelo as a template. The PCR product was detected by electrophoresis. When the detection showed a 1231 bp band, the band contained an InDel molecular marker (the nucleotide sequence is shown in SEQ ID No. 1), and the nucleotide sequence of the band is shown in SEQ ID No. 4:

[0038]

[0039] Example 3

[0040] A kit for identifying Sunshine No. 1 tangerine contains the primer pair of Example 2. A method for identifying Sunshine No. 1 tangerine based on the kit comprises the following steps:

[0041] 1) Extracting genomic DNA from the sample to be tested,

[0042] 2) using the above genomic DNA as a template and using a primer pair to perform PCR amplification to obtain a PCR product; wherein,

[0043] The PCR amplification system is as follows:

[0044]

[0045]

[0046] The PCR amplification procedure included: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles; extension at 72°C for another 5 min;

[0047] 3) PCR product electrophoresis detection (using 2% agarose gel, voltage 120V, electrophoresis 15-20min), the detection results are analyzed as follows:

[0048] When a band 1 of 1231 bp is displayed, the band 1 contains an InDel molecular marker (the nucleotide sequence is shown as SEQ ID No. 1), and the variety to be tested is Sunshine No. 1 Citrus pomelo.

[0049] When any one small fragment band or two small fragment bands are displayed, the variety to be tested is another citrus variety; wherein the two small fragment bands are respectively a band 2 of 298 bp and a band 3 of 350 bp;

[0050] The nucleotide sequence of band 2 of 298 bp is shown in SEQ ID No.5:

[0051] AGTTGTGTAGTGTTCAGGACGTAGAAAGTTTTGTTCAGGATTTTGGCTAACCGCACCATTTTTTTTTTCAAAAATCATTTCACAAGATAAATGCCCCATTTTGGATTTTCAAAAAATTAAAATAATACTTTTGATTTTGGTCAAACACG GTCAAAATAAAATTCCTATCATAATATTTGTGACTGAGTTAATTACTATCATACACATATTATAAATTCTTGATATATAAATATTCTATCACAAGTACATCATTAATCGTTTGATAGACAACAATTCTATCAGGACTCCATCACACTTG;

[0052] The nucleotide sequence of band 3 of 350 bp is shown in SEQ ID No.6:

[0053] AGTTGTGTAGTGTTCAGGACGTAGAAAGTTTTGTTCAGGATTTTGGCTAACCGCACCATTTTTTTTTTCAAAAATCATTTCACAAGATAAATGCCCCATTTTGGATTTTCAAAAAATTAAAATAATACTTTTGATTTTGGTCAAACACGGTCAAAATAAAATTCCTATCATAATA TTTGTGACTGAGTTAATTACTACATGGTCAAAATAAAATTCCTATCATAATATTTTTGACTGAGTTAATTACTATCATACACATATTATAAATTCTTGATATATAAATATTCTATCACAAGTACATCATTAATCGTTTGATAGACAACAATTCTATCAGGACTCCATCACACTTG.

[0054] Example 4

[0055] The kit of Example 3 is used to detect Sunshine No. 1 tangerine and other citrus varieties, and the specific steps are as follows:

[0056] 1) Extracting genomic DNA from leaves of Sunshine No. 1 tangerine, other hybrid citrus varieties and wide-skinned citrus;

[0057] 2) using the above genomic DNA as a template and using a primer pair to perform PCR amplification to obtain a PCR product; wherein,

[0058] The PCR amplification system is as follows:

[0059] Mix 7μl Forward primer F (10mmol / L) 0.3μl Reverse primer R (10mmol / L) 0.3μl Genomic DNA 1.5μl <![CDATA[dd H2O]]> 5.9μl total 15μl

[0060] The PCR amplification procedure included: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles; extension at 72°C for another 5 min;

[0061] 3) PCR product electrophoresis detection (using 2% agarose gel, voltage 120V, electrophoresis 15-20min), the detection results are analyzed as follows:

[0062] The results are as follows Figure 1 As shown: the bands of PCR products in other lanes are all 298bp bands and / or 350bp bands, which correspond to other varieties (including hybrid citrus varieties and wide-skinned citrus). Only lane 10 amplified a 1231bp fragment band, which is Sunshine No. 1 Pomelo, and can be determined as a marker with good effect that can be used.

[0063] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. An InDel molecular marker for identifying Sunshine No. 1 tangerine pomelo, characterized in that: The nucleotide sequence of the InDel molecular marker is shown as SEQ ID No.

1.

2. A primer pair for obtaining the InDel molecular marker according to claim 1, characterized in that: The primer pairs are: Forward primer F: AGTTGTGTAGTGTTCAGGACGTAG, Reverse primer R: CAAGTGTGATGGAGTCCTGATAGA.

3. Use of the primer pair according to claim 2 in identifying Sunshine No. 1 Pomelo or in preparing a kit for identifying Sunshine No. 1 Pomelo.

4. A kit for identifying Sunshine No. 1 tangerine pomelo, characterized in that: The kit contains the primer pair according to claim 2.

5. A method for identifying Sunshine No. 1 tangelo, characterized in that: The following steps are involved: 1) Extracting genomic DNA from the sample to be tested, 2) using the above genomic DNA as a template, and using the primers described in claim 2 or the kit described in claim 4 to perform PCR amplification to obtain a PCR product; 3) PCR product electrophoresis detection, the detection results are analyzed as follows: When a 1231 bp band is displayed, the band contains an InDel molecular marker, and the variety to be tested is Sunshine No. 1 Tangelo; Alternatively, when any one or two small fragment bands smaller than 500 bp are displayed, the variety to be tested is another citrus variety.

6. The method according to claim 5, characterized in that: In the step 2), the system of PCR amplification is as follows: The PCR amplification procedure included: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, and 35 cycles; and extension at 72°C for another 5 min.

7. Use of the primer according to claim 2 or the kit according to claim 4 in early identification of Sunshine No. 1 pomelo.

8. Use of the primer according to claim 2 or the kit according to claim 4 in tangerine and pomelo breeding.

Images