Method for producing oligonucleotide

Abstract

The present invention relates to a method for producing an oligonucleotide, the present invention relates to a method for producing an aromatic hydrocarbon compound, which comprises a step for condensing a compound represented by formula (2) in which G2 represents a protecting group for a hydroxyl group, Ba represents a nucleic acid base that may be protected by a protecting group, R represents a protected hydroxyl group or the like, and a 2 '-OMe-U amide represented by formula (4) in which the 2'-OMe-U amide is dissolved in a mixed solution containing acetonitrile and an aromatic hydrocarbon represented by formula (3), in the presence of an activator. X represents an oxygen atom or the like, and the bond having * represents a bond directed toward the 3'end side of a nucleic acid (in formula (4), G1 represents a protecting group for a hydroxyl group, and in formula (3), Y1 to Y6 represent a hydrogen atom, a methyl group or the like) # imgabs0 #

Description

Technical Field

[0001] This patent application claims priority and benefits under the Paris Convention based on Japanese Patent Application No. 2022-117422 (filed on July 22, 2022), and the entire contents described in the above application are incorporated into this specification by reference.

[0002] The present invention relates to a method for producing an oligonucleotide using the phosphoramidite method. Background Art

[0003] Oligonucleotides, which are nucleic acid oligomers, are useful raw materials used in various fields, such as nucleic acid probes for gene detection, DNA probes used in PCR, antisense nucleic acids, siRNAs, and aptamers as pharmaceuticals.

[0004] Oligonucleotides can be produced by a solid phase synthesis method using the phosphoramidite method. In the phosphoramidite method, phosphoramidites (hereinafter referred to as "amides") of nucleosides as monomers are sequentially connected on glass or resin supports to produce oligonucleotides with arbitrary sequences. The specific production steps include: a deprotection step of deprotecting the protecting group of the hydroxyl group at the 5' end of the nucleotide using an acidic solution; a condensation step of reacting the hydroxyl group at the 5' end of the deprotected nucleotide with the amide group of the amide in the presence of an activator; an oxidation step of oxidizing the bond between the newly generated nucleosides from trivalent phosphorus to pentavalent phosphorus; and a capping step of acylating the unreacted hydroxyl group at the 5' end. By repeating these steps in sequence, the amides are connected in an arbitrary order to produce an oligonucleotide with a desired sequence.

[0005] As disclosed in Patent Document 1, etc., the amide used in the condensation step is dissolved in acetonitrile and used in the form of an amide solution. On the other hand, in the case of an amide having low solubility in acetonitrile, it is difficult to use this method.

[0006] As one of the amides with low solubility in acetonitrile, 2'-OMe-U amide can be cited. It is reported that in order to improve the solubility of 2'-OMe-U amide, dichloromethane is added to acetonitrile to prepare an amide solution (Patent Document 2, Non-Patent Document 1). By adding these solvents, the solubility of 2'-OMe-U amide is improved.

[0007] Such a method for manufacturing oligonucleotides has been developed, but the purity of the synthesized oligonucleotides may not be satisfactory. One of the reasons is the presence of n-1mer impurities. The n-1mer impurity is an impurity produced during the manufacture of oligonucleotides, and is an impurity with a chain length that is shorter than the target chain length by 1. It is known that the n-1mer impurity is difficult to separate from the oligonucleotide of the target chain length (Non-Patent Document 2). Therefore, it is important to reduce the n-1mer impurity produced during the manufacture in the efficient manufacture of oligonucleotides.

[0008] Prior art literature

[0009] Patent Literature

[0010] Patent Document 1: International Publication No. 2019 / 170731

[0011] Patent Document 2: Chinese Patent Application Publication No. 112007040

[0012] Non-patent literature

[0013] Non-patent document 1: Bioorganic & Medicinal Chemistry Letters 28 (2018) 3774-3779

[0014] Non-patent document 2: Mass Spectrometry Reviews 40(2021)75-109 Summary of the invention

[0015] Problems to be solved by the invention

[0016] An object of the present invention is to provide a method for producing a high-purity oligonucleotide having one or more 2'-OMe-U.

[0017] Means for solving problems

[0018] The inventors of the present application have conducted intensive studies to achieve the above-mentioned object, and as a result, have provided a method for producing a nucleic acid, characterized in that acetonitrile and an aromatic hydrocarbon are used as solvents for a 2'-OMe-U amide solution.

[0019] The present invention includes the following aspects, but is not limited to these.

[0020] 1. A method for producing an oligonucleotide, comprising the step of condensing a compound represented by formula (2) with 2'-OMe-U amide represented by formula (4) in the presence of an activator,

[0021] [Chemical formula 1]

[0022]

[0023] 〔In the formula,

[0024] G 2 represents a protecting group for a hydroxyl group,

[0025] B a represents a nucleic acid base that can be protected by a protecting group,

[0026] R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group,

[0027] Q' represents an alkylene group bonded to the carbon atom at the 4' position of ribose,

[0028] X represents an oxygen atom or a sulfur atom, and,

[0029] The bonds with * indicate the bonds toward the 3' end of the nucleic acid. ]

[0030] [Chemical formula 2]

[0031]

[0032] 〔In the formula,

[0033] G 1 represents a protecting group for a hydroxyl group. ]

[0034] The 2'-OMe-U amide is dissolved in a mixed solution containing acetonitrile and an aromatic hydrocarbon represented by formula (3).

[0035] [Chemical formula 3]

[0036]

[0037] 〔In the formula, Y 1 ~Y 6 are the same or different from each other and each independently represents a hydrogen atom, a methyl group, an ethyl group or a halogen atom. 〕

[0038] 2. A method for producing an oligonucleotide as described in [1], wherein the aromatic hydrocarbon represented by formula (3) is benzene having one or two substituents selected from the group consisting of a methyl group, an ethyl group and a halogen atom, and when benzene has two substituents, the substituents may be the same or different.

[0039] 3. The method for producing an oligonucleotide according to [1], wherein the aromatic hydrocarbon represented by formula (3) is selected from the group consisting of toluene, o-xylene, m-xylene, p-xylene, chlorobenzene, o-dichlorobenzene, m-dichlorobenzene, p-dichlorobenzene, and a mixture of two or more thereof.

[0040] 4. A method for producing an oligonucleotide as described in any one of [1] to [3], wherein the volume ratio of acetonitrile and the aromatic hydrocarbon represented by formula (3) contained in the mixed solution in which 2'-OMe-U amide represented by formula (4) is dissolved is 99:1 to 1:99 in terms of acetonitrile:aromatic hydrocarbon represented by formula (3).

[0041] 5. A method for producing an oligonucleotide as described in any one of [1] to [3], wherein the volume ratio of acetonitrile and the aromatic hydrocarbon represented by formula (3) contained in the mixed solution in which 2'-OMe-U amide represented by formula (4) is dissolved is 90:10 to 10:90 in terms of acetonitrile:aromatic hydrocarbon represented by formula (3).

[0042] 6. A method for producing an oligonucleotide as described in any one of [1] to [3], wherein the volume ratio of acetonitrile and the aromatic hydrocarbon represented by formula (3) contained in the mixed solution in which 2'-OMe-U amide represented by formula (4) is dissolved is 90:10 to 40:60 in terms of acetonitrile:aromatic hydrocarbon represented by formula (3).

[0043] 7. The method for producing an oligonucleotide according to any one of [1] to [6], wherein the concentration of 2'-OMe-U amide in the 2'-OMe-U amide solution represented by formula (4) is 0.01 to 0.4 M.

[0044] 8. The method for producing an oligonucleotide according to any one of [1] to [6], wherein the concentration of 2'-OMe-U amide in the 2'-OMe-U amide solution represented by formula (4) is 0.05 to 0.2 M.

[0045] 9. The method for producing an oligonucleotide according to any one of [1] to [8], wherein the activator is 5-benzylthio-1H-tetrazole.

[0046] 10. The method for producing an oligonucleotide according to any one of [1] to [9], wherein, when R in the compound represented by formula (2) is a protected hydroxyl group, the protecting group of the hydroxyl group is a protecting group represented by formula (10):

[0047] [Chemical formula 4]

[0048]

[0049] 〔In the formula,

[0050] q represents an integer from 0 to 5,

[0051] R a and R b are the same or different from each other, each representing a methyl group, an ethyl group or a hydrogen atom,

[0052] The bonds marked with * are bonded to the oxygen of the 2' hydroxyl group.

[0053] Ew represents an electron withdrawing group. 〕

[0054] 11. The method for producing an oligonucleotide according to any one of [1] to

[10] , wherein in the 2'-OMe-U amide represented by formula (4), G 1 It is 4,4'-dimethoxytrityl.

[0055] 12. The method for producing an oligonucleotide according to any one of [1] to

[11] , which is carried out by a solid phase synthesis method.

[0056] 13. A solution comprising 2'-OMe-U amide represented by formula (4), acetonitrile and an aromatic hydrocarbon represented by formula (3),

[0057] [Chemical formula 5]

[0058]

[0059] 〔In the formula,

[0060] G 1 represents a protecting group for a hydroxyl group. ]

[0061] [Chemical formula 6]

[0062]

[0063] 〔In the formula, Y 1 ~Y 6 are the same or different from each other and each independently represents a hydrogen atom, a methyl group, an ethyl group or a halogen atom. 〕

[0064] 14. A method for producing an oligonucleotide using the solution comprising 2'-OMe-U amide represented by formula (4), acetonitrile and an aromatic hydrocarbon represented by formula (3) as described in

[13] .

[0065] Effects of the Invention

[0066] The present invention provides a method for producing a high-purity oligonucleotide containing one or more 2'-OMe-U amides. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] [ Figure 1 ] is a drawing showing the route (route A) of steps (1) to (6) of the preparation method of the present invention. DETAILED DESCRIPTION

[0068] The method for producing an oligonucleotide of the present invention relates to the following method for producing an oligonucleotide, comprising the step of condensing a compound represented by formula (2) with 2'-OMe-U amide represented by formula (4) in the presence of an activator,

[0069] [Chemical formula 7]

[0070]

[0071] 〔In the formula,

[0072] G 2 represents a protecting group for a hydroxyl group,

[0073] B a represents a nucleic acid base that can be protected by a protecting group,

[0074] R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group,

[0075] Q' represents an alkylene group bonded to the carbon atom at the 4' position of ribose,

[0076] X represents an oxygen atom or a sulfur atom, and,

[0077] The bonds with * indicate the bonds toward the 3' end of the nucleic acid. ]

[0078] [Chemical formula 8]

[0079]

[0080] 〔In the formula,

[0081] G 1 represents a protecting group for a hydroxyl group. ]

[0082] The 2'-OMe-U amide is dissolved in a mixed solution containing acetonitrile and an aromatic hydrocarbon represented by formula (3).

[0083] [Chemical formula 9]

[0084]

[0085] 〔In the formula, Y 1 ~Y 6 are the same or different from each other and each independently represents a hydrogen atom, a methyl group, an ethyl group or a halogen atom. 〕

[0086] The method for producing an oligonucleotide may include the step of reacting a 2'-OMe-U amide solution prepared by dissolving 2'-OMe-U amide represented by formula (4) in a mixed solution of acetonitrile and an aromatic hydrocarbon represented by formula (3) with an activator. The method for producing an oligonucleotide is described below.

[0087] In the present invention, a mixed solution containing acetonitrile and an aromatic hydrocarbon represented by formula (3) is used as the solvent of the 2'-OMe-U amide solution, thereby reducing the n-1mer contained in the manufactured oligonucleotide. The mixing ratio in the mixed solution containing acetonitrile and the aromatic hydrocarbon represented by formula (3) is not particularly limited, and the volume ratio of acetonitrile to the aromatic hydrocarbon is, for example, 99:1 to 1:99, preferably 90:10 to 10:90, and more preferably 90:10 to 40:60.

[0088] As the aromatic hydrocarbon, benzene having a substituent selected from the group consisting of methyl, ethyl or halogen atoms can be used, preferably benzene having one or two substituents selected from the group consisting of methyl, ethyl or halogen atoms can be used, and more preferably toluene, o-xylene, m-xylene, p-xylene, chlorobenzene, o-dichlorobenzene, m-dichlorobenzene, p-dichlorobenzene, and a mixture of two or more thereof can be used.

[0089] The 2'-OMe-U amide solution may be mixed with a solvent other than acetonitrile and aromatic hydrocarbons.

[0090] The concentration of 2'-OMe-U amide in the 2'-OMe-U amide solution is preferably adjusted to 0.01M to 0.4M, more preferably 0.05M to 0.2M.

[0091] 2'-OMe-U amide may be dissolved in the aforementioned mixed solvent and then used after reducing the water content using a drying material such as zeolite.

[0092] When storing the 2'-OMe-U amide solution, a glass container, a plastic container, or a metal container can be used. As a plastic container, a container made of polyethylene or polypropylene can be used, and as a metal container, a container made of SUS or Hastelloy can be used.

[0093] The reaction precursor with 2'-OMe-U amide represented by formula (4) is specifically a compound represented by the following formula (12),

[0094] [Chemical formula 10]

[0095]

[0096] (Where,

[0097] G 2 represents a protecting group for a hydroxyl group,

[0098] B a Each independently represents a nucleic acid base which may be protected by a protecting group,

[0099] R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group,

[0100] Q' represents an alkylene group bonded to the carbon atom at the 4' position of ribose,

[0101] X are the same or different from each other and each independently represents an oxygen atom or a sulfur atom,

[0102] Z represents a group formed by a solid phase support and a linker linking the solid phase support to the oxygen atom of the 3'-hydroxyl group of the ribose at the 3' end of the oligonucleotide, and,

[0103] l represents an integer from 0 to 300. )

[0104] By reacting with 2'-OMe-U amide, it is converted into an oligonucleotide represented by formula (13):

[0105] [Chemical formula 11]

[0106]

[0107] (Where,

[0108] G 1 represents a protecting group for a hydroxyl group,

[0109] G 2 , B a , R, X, Z, and l are as defined above. ).

[0110] In formulae (2), (12) and (13), when R represents an OQ' group and Q' represents an alkylene group bonded to the carbon atom at the 4' position of ribose, specific examples of the structure include the following LNA-1 to LNA-4.

[0111] [Chemical formula 12]

[0112]

[0113] (Where B a Indicates a nucleic acid base that can be protected. )

[0114] Examples of nucleosides (ribose and deoxyribose) contained in the oligonucleotide used in the present invention include DNA, RNA, 2'-O-MOE (2'-O-methoxyethyl), 2'-O-Me, 2'-F RNA, and the aforementioned LNA, but the aforementioned nucleosides are not limited to these.

[0115] More specifically, the group represented by Z, which is formed by the solid phase carrier and the linker connecting the solid phase carrier and the oxygen atom of the hydroxyl group at the 2' or 3' position of the ribose at the 3' end of the nucleic acid oligomer, includes the structure represented by the following formula (18).

[0116] [Chemical formula 13]

[0117]

[0118] In formula (18), Sp represents a spacer group.

[0119] As the spacer (Sp), for example, a group having a structural formula represented by the following formula (19) can be exemplified.

[0120] [Chemical formula 14]

[0121]

[0122] The linker may be, for example, a structure represented by the following formula (20), or a structure in which the structure of formula (20) does not have a hexamethyleneamino moiety, that is, an aminopropyl group is bonded to Si. Alternatively, the linker may be a structure represented by the following formula (21).

[0123] [Chemical formula 15]

[0124]

[0125] (Where,

[0126] A can be any one of hydroxyl, alkoxy or alkyl. Examples of alkoxy include methoxy and ethoxy. Examples of alkyl include methyl, ethyl, isopropyl and n-propyl. represents the oxygen bonding of Si to the hydroxyl group on the surface of the carrier.

[0127] As solid supports, inorganic porous supports, organic resin supports, etc. can be cited. Among inorganic porous supports, for example, controlled pore glass (CPG) and zeolite can be cited. Among organic resin supports, for example, supports formed of polystyrene can be cited.

[0128] The method for synthesizing oligonucleotides typically includes the following steps.

[0129] (1) deprotecting the hydroxyl group at the 5' position of the hydroxyl-protected nucleoside bonded to the solid phase support via a linker;

[0130] (2) a step of subjecting the 5'-hydroxyl group generated in the above step to a condensation reaction with an amide compound to obtain a phosphite triester compound;

[0131] (3) a step of oxidizing the phosphite triester produced in the preceding step to convert it into a phosphotriester bond to produce an extended nucleic acid molecule, or an optional step of converting it into a phosphorothioate triester;

[0132] (4) a step of synthesizing a nucleic acid molecule on a solid support by repeating any number of cycles of the above steps (1) to (3), i.e., a step of deprotecting the 5'-hydroxyl group of the generated nucleic acid molecule, a step of condensing the 5'-hydroxyl group with an amide compound, and a step of oxidizing the generated phosphite triester;

[0133] (5) subjecting the nucleic acid molecule on the solid phase support generated in step (4) to a cleavage and deprotection step to release it from the solid phase support, thereby producing an oligonucleotide from which the protecting group has been removed; and

[0134] (6) A step of deprotecting the protecting group of the 2' hydroxyl group of ribose constituting the nucleic acid molecule.

[0135] In the above-mentioned oligonucleotide synthesis method, after step (2) or (3), a step of capping the 5'-hydroxyl group that has not undergone condensation reaction with the amide compound may be included, and a capping step may be added between any steps in the cycle of a series of reactions constituting step (4).

[0136] More specifically, the nucleic acid molecule on the solid phase carrier generated in step (4) is subjected to the following steps (5-1) and (5-2) in the order of reaction. Here, the reaction of step (5-1) can be carried out arbitrarily, and the reaction of step (5-2) can also be carried out using the method described in Japanese Patent Gazette No. 4705716. As a result, an oligonucleotide with a protective group removed or an oligonucleotide with a protected hydroxyl group at the 5' end can be produced from the nucleic acid molecule freed from the solid phase carrier.

[0137] (5-1) a reaction of deprotecting the protective group of the hydroxyl group at the 5' end of the nucleic acid molecule; and

[0138] (5-2) A reaction in which the nucleic acid molecule is cut out from the solid phase support and released.

[0139] The route of the above steps (1) to (6) is shown in Figure 1 Route A. The substituent G in the chemical formula of Route A 1 , G 2 , B a , and R are as defined above. In addition, G 3 , G 4 , G 5 , B c , and R' are defined as described below. In addition, in the chemical formula of route A,

[0140] Y are the same or different from each other and each independently represents an oxygen atom or a sulfur atom,

[0141] X represents an R group, or represents an OZ group, where Z is as defined above,

[0142] When X represents an R group, W represents an OZ group, where Z is as defined above, or, when X represents an OZ group, W represents an OV group, where V represents a protective group for a hydroxyl group,

[0143] W 1 is a W group, or a group derived from a W group (e.g., a residue cleaved from a solid support, a deprotected group, etc.),

[0144] W10 W 1 Based on or by W 1 A group derived from a base (e.g., a residue cleaved from a solid support, a deprotected group, etc.),

[0145] X 1 is an X group, or a group derived from an X group (for example, a residue cleaved from a solid support, a deprotected group, etc.),

[0146] X 10 For X 1 Base, or by X 1 A group derived from a base (e.g., a residue cleaved from a solid support, a deprotected group, etc.),

[0147] n represents an integer from 1 to 300, and

[0148] m represents an integer of 1 to 300.

[0149] For the nucleic acid compound of formula (A5), it is possible to further use the amide method to extend only any chain length using a nucleotide-type or non-nucleotide-type linker, and use it to produce the nucleic acid compound shown in formula (A5'). It is also possible to cut out only the nucleic acid compound from the nucleic acid compound bonded to the solid phase support of formula (A5') to obtain the oligonucleotide shown in formula (A6), and then further deprotect to obtain the oligonucleotide shown in formula (A7).

[0150] Hereinafter, the substituents in each formula will be described in further detail.

[0151] As G 1 Any group that can function as a protecting group can be used without particular limitation, and any known protecting group used in amide compounds can be widely used. 1 Preferred is a protecting group represented by the following formula (14).

[0152] [Chemical formula 16]

[0153]

[0154] (Where R 1 , R 2 and R 3 are the same or different from each other and each independently represents hydrogen or alkoxy. )

[0155] R 1 , R 2 and R 3 Preferably, one of the alkoxy groups is hydrogen and the remaining two are the same or different (preferably the same) alkoxy groups, and a methoxy group is particularly preferred. 1Specifically, 4,4'-dimethoxytrityl (DMTr group), 4-monomethoxytrityl, and 4,4',4"-trimethoxytrityl are preferred, and 4,4'-dimethoxytrityl is particularly preferred.

[0156] As G 2 As long as it can function as a protecting group, it can be used without particular limitation, and a wide range of known protecting groups used in amide compounds can be used. 2 For example, there can be mentioned an alkyl group, an alkenyl group, an alkynyl group, a cycloalkyl group, a haloalkyl group, an aryl group, a heteroaryl group, an aralkyl group, a cycloalkenyl group, a cycloalkylalkyl group, a cyclylalkyl group, a hydroxyalkyl group, an aminoalkyl group, an alkoxyalkyl group, a heterocyclylalkenyl group, a heterocyclylalkyl group, a heteroaralkyl group, a silyl group, a silyloxyalkyl group, a monoalkylsilyl group, a dialkylsilyl group or a trialkylsilyl group, a monoalkylsiloxyalkyl group, a dialkylsiloxyalkyl group or a trialkylsiloxyalkyl group, and they may be substituted with one or more electron withdrawing groups.

[0157] G 2 It is preferably an alkyl group substituted with an electron-withdrawing group. Examples of the electron-withdrawing group include cyano, nitro, alkylsulfonyl, halogen, arylsulfonyl, trihalomethyl, and trialkylamino groups, and cyano is preferred. 2 , 2-cyanoethyl (a group represented by the following formula) is particularly preferred.

[0158] [Chemical formula 17]

[0159]

[0160] G 3 For alkyl, 2 G 3 They are bonded to each other to form a ring structure, and preferably both are isopropyl groups.

[0161] The aforementioned R 1 , R 2 , R 3 and G 2 , G 3 The alkyl group in the definition of may be straight-chain or branched, preferably an alkyl group having 1 to 12 carbon atoms, and more preferably an alkyl group having 1 to 6 carbon atoms. Specific examples of the alkyl group include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, and hexyl. The alkyl part constituting the alkoxy group in the definition of the above substituent has the same definition as the alkyl group herein.

[0162] G 4Represents a hydrogen atom, an alkali metal ion, an ammonium ion, an alkylammonium ion, or a hydroxyalkylammonium ion. As the alkali metal ion, for example, a sodium ion and a lithium ion can be mentioned. In addition, as for the alkylammonium ion, as specific examples of alkyl groups, for example, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an n-butyl group, an isobutyl group, a tert-butyl group, an n-pentyl group, an isopentyl group, and a hexyl group can be mentioned. More specifically, for example, a diethylammonium ion, a triethylammonium ion, a tetrabutylammonium ion, a hexylammonium ion, and a dibutylammonium ion can be mentioned. In addition, as for the hydroxyalkylammonium ion, as specific examples of the hydroxyalkyl moiety, for example, a hydroxymethyl group, a hydroxyethyl group, a hydroxyn-propyl group, a hydroxyisopropyl group, a hydroxyn-butyl group, and a trihydroxymethyl group can be mentioned. As more specific examples of the hydroxyalkylammonium ion, a trihydroxymethylammonium ion can be mentioned.

[0163] G 5 represents a hydrogen atom or a protecting group. When a protecting group is represented, it represents the same as G 1 The same protecting group. In the case of deprotection, G 5 In the case where the nucleotide compound is a hydrogen atom, it can be used again in a series of nucleic acid extension reaction steps.

[0164] In addition, in the method of the present invention, the amide compound can be used in a free state or in a salt state. As the salt of the amide compound, base addition salts or acid addition salts can be cited, without particular limitation. As base addition salts, specifically, salts formed with inorganic bases such as sodium salts, magnesium salts, potassium salts, calcium salts, aluminum salts, etc.; salts formed with organic bases such as methylamine, ethylamine, ethanolamine, etc.; salts formed with basic amino acids such as lysine, ornithine, arginine; and ammonium salts. As acid addition salts, specifically, inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, phosphoric acid, etc.; organic acids such as formic acid, acetic acid, propionic acid, oxalic acid, malonic acid, malic acid, tartaric acid, fumaric acid, succinic acid, lactic acid, maleic acid, citric acid, methanesulfonic acid, trifluoromethanesulfonic acid, ethanesulfonic acid, etc.; and acid addition salts formed with acidic amino acids such as aspartic acid and glutamic acid. Amide compounds also include salts, hydrates, solvates, polymorphs, and the like.

[0165] In the present specification, a nucleic acid base refers to a group having a natural or non-natural nucleic acid base backbone. The aforementioned nucleic acid base also includes a modified form in which the natural or non-natural nucleic acid base backbone is modified.

[0166] B aThe nucleic acid base that can be protected by the protective group shown is not particularly limited. As the nucleic acid base, adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, 1-methylpseudouracil etc. can be enumerated. In addition, the nucleic acid base can be substituted by a substituent. As such a substituent, for example, a halogen atom such as a fluorine group, a chlorine group, a bromine group, an iodine group, an acyl group such as an acetyl group, an alkyl group such as a methyl group, an ethyl group, an aralkyl group such as a benzyl group, an alkoxy group such as a methoxy group, an alkoxyalkyl group such as a methoxyethyl group, a cyanoalkyl group such as a cyanoethyl group, a hydroxyl group, a hydroxyalkyl group, an acyloxymethyl group, an amino group, a monoalkylamino group, a dialkylamino group, a carboxyl group, a cyano group, a nitro group, and the like, and a combination of two or more substituents therein can be enumerated.

[0167] As B a More specifically, the nucleic acid base represented by can be exemplified by the following structures.

[0168] [Chemical formula 18]

[0169]

[0170] (In the above formula,

[0171] R 4 represents a hydrogen atom, a methyl group, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group or a benzoyl group,

[0172] R 5 represents a hydrogen atom, an acetyl group, an isobutyryl group or a benzoyl group,

[0173] R 6 represents a hydrogen atom, a phenoxyacetyl group, a 4-tert-butylphenoxyacetyl group, a 4-isopropylphenoxyacetyl group, a phenylacetyl group, an acetyl group or an isobutyryl group,

[0174] R 7 represents 2-cyanoethyl,

[0175] R 8 represents a hydrogen atom, a methyl group, a benzoyl group, a 4-methoxybenzoyl group or a 4-methylbenzoyl group, and

[0176] R 9 represents dimethylaminomethylene. )

[0177] When the nucleic acid base has an amino group outside the ring, the protecting group of the amino group is not particularly limited, and the protecting groups used in known nucleic acid chemistry can be used. As such protecting groups, for example, benzoyl, 4-methoxybenzoyl, acetyl, propionyl, butyryl, isobutyryl, phenylacetyl, phenoxyacetyl, 4-tert-butylphenoxyacetyl, 4-isopropylphenoxyacetyl, and (dimethylamino)methylene, and combinations of two or more of these protecting groups can be mentioned.

[0178] B c "represents an unprotected nucleic acid base, and its type is not particularly limited. As the nucleic acid base, adenine, cytosine, guanine, uracil, thymine, 5-methylcytosine, pseudouracil, 1-methylpseudouracil etc. can be enumerated. In addition, the nucleic acid base can also be substituted by a substituent. As such a substituent, for example, a halogen atom such as a fluorine group, a chlorine group, a bromine group, an iodine group, an acyl group such as an acetyl group, an alkyl group such as a methyl group, an ethyl group, an aralkyl group such as a benzyl group, an alkoxy group such as a methoxy group, an alkoxyalkyl group such as a methoxyethyl group, a cyanoalkyl group such as a cyanoethyl group, a hydroxyl group, a hydroxyalkyl group, an acyloxymethyl group, an amino group, a monoalkylamino group, a dialkylamino group, a carboxyl group, a cyano group, a nitro group, etc., and a combination of two or more substituents therein can be enumerated.

[0179] When R represents a protected hydroxyl group, its protecting group can be used as long as it can be used in the amide method, for example, 2'-tert-butyldimethylsilyl (TBDMS group), 2'-bis (2-acetoxy) methyl (ACE group), 2'-(triisopropylsilyloxy) methyl (TOM group), 2'-(2-cyanoethoxy) ethyl (CEE group), 2'-(2-cyanoethoxy) methyl (CEM group) (International Publication No. 2006 / 022323), 2'-toluenesulfonylethoxymethyl (TEM group), 2'-EMM group (International Publication No. 2013 / 027843), and the groups described in International Publication No. 2019 / 208571 can also be used. Among the 2' protecting groups of these ribonucleosides (RNA), the protecting group shown in formula (10) can be exemplified as a preferred protecting group. It is further preferred to exemplify a group having a cyano group as E W The protecting group represented by formula (15) is an electron withdrawing group represented by the above.

[0180] [Chemical formula 19]

[0181]

[0182] [Chemical formula 20]

[0183]

[0184] (Where,

[0185] q represents an integer from 0 to 5,

[0186] R a and R b are the same or different from each other, each representing a methyl group, an ethyl group or a hydrogen atom,

[0187] The bonds marked with an * are bonded to the oxygen of the 2' hydroxyl group.

[0188] And, Ew represents an electron withdrawing group. )

[0189] The protecting group represented by formula (15) can be synthesized according to the description in, for example, International Publication Nos. 2013 / 027843 and 2019 / 208571, and the amide compound having the protecting group can be used for the production of oligonucleotides.

[0190] Nucleotides and amides in which the R group is a substituent other than a hydroxyl group can also be produced from nucleosides synthesized using known methods described in Japanese Patent No. 3745226, International Publication No. 2001 / 053528 or Japanese Patent Application Laid-Open No. 2014-221817, and known methods cited therein, or can be produced using substances available as commercial products, based on the methods described in the Examples described below, or by appropriately modifying these methods.

[0191] R' represents a hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, and Q' represents a methylene group bonded to the carbon atom at the 4' position of ribose, an ethylene group bonded to the carbon atom at the 4' position, or an ethylidene group bonded to the carbon atom at the 4' position.

[0192] In the synthesis of the aforementioned oligonucleotide, except for the condensation step using 2'-OMe-U amide involved in the present invention, a nucleic acid extension reaction can be carried out by repeating the deprotection step and the condensation step according to a generally known method (for example, the method described in the aforementioned Japanese Patent No. 5157168 or Japanese Patent No. 5554881). Each step is described below.

[0193] (Nucleic acid extension reaction)

[0194] In this specification, "nucleic acid extension reaction" refers to a reaction in which nucleotides are sequentially bonded via a phosphodiester bond to extend a nucleic acid molecule. The nucleic acid extension reaction can be carried out according to the steps of the usual amide method (phosphoramidite method). The nucleic acid extension reaction can also be carried out using an automatic nucleic acid synthesis device using the amide method, or by liquid phase synthesis.

[0195] The chain length of the oligonucleotide can be, for example, 20mer or more, 40mer or more, 50mer or more, 60mer or more, 80mer or more, 100mer or more, 200mer or more, 2-300mer, 2-250mer, 2-200mer, 10-300mer, 10-250mer, 10-200mer, 10-150mer, 15-300mer, 15-250mer, 15-200mer, 15-150mer, or 15-110mer.

[0196] The deprotection step of step (1) is a step of deprotecting the protecting group of the 5' hydroxyl group at the end of the RNA chain supported on the solid phase carrier (see Figure 1 Route A). As G 1 As the common protecting group represented by , 4,4'-dimethoxytrityl (DMTr group), 4-monomethoxytrityl, 4,4',4"-trimethoxytrityl can be used. Deprotection can be carried out using an acid. Examples of the acid used for deprotection include trifluoroacetic acid, dichloroacetic acid, trifluoromethanesulfonic acid, trichloroacetic acid, methanesulfonic acid, hydrochloric acid, acetic acid, p-toluenesulfonic acid, and the like.

[0197] The condensation step of step (2) is to make Figure 1 The reaction of bonding the nucleoside phosphoramidite represented by the following formula (A3) recorded in the route A with the 5' hydroxyl group at the end of the oligonucleotide chain deprotected by the aforementioned deprotection step. It should be noted that as the phosphoramidite represented by the following formula (A3) used in nucleic acid extension, there can be cited substances in which R is a protected hydroxyl group, 2'-OMe, 2'-F, 2'-O-tert-butyldimethylsilyl, 2'-O-methoxyethyl, 2'-H, 2'-fluoro-2'-deoxy-β-D-arabinofuranosyl, etc. As the aforementioned nucleoside phosphoramidite, a nucleoside phosphoramidite in which the 5' hydroxyl group is protected by a protecting group (e.g., a DMTr group) is used. The condensation step can be carried out using an activator that activates the aforementioned nucleoside phosphoramidite. As the activator, for example, 5-benzylthio-1H-tetrazole (BTT), 1H-tetrazole, 4,5-dicyanoimidazole (DCI), 5-ethylthio-1H-tetrazole (ETT), N-methylbenzimidazolium trifluoromethanesulfonate (N-MeBIT), benzimidazolium trifluoromethanesulfonate (BIT), N-phenylimidazolium trifluoromethanesulfonate (N-PhIMT), imidazolium trifluoromethanesulfonate (IMT), 5-nitrobenzimidazolium trifluoromethanesulfonate (NBT), 1-hydroxybenzotriazole (HOBT) or 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole, etc., preferably 5-benzylthio-1H-tetrazole (BTT).

[0198] Figure 1The nucleoside phosphoramidite (hereinafter referred to as amide) represented by formula (A3) described in route A is as follows.

[0199] The compound represented by formula (A3):

[0200] [Chemical formula 21]

[0201]

[0202] (Where,

[0203] G 1 , G 2 , G 3 , B a , and R are as described above. ).

[0204] In the present invention, as the amide of formula (A3), 2'-OMe-U amide (compound represented by formula (4)) is used in at least one condensation step. In addition, in the condensation step, a solution of 2'-OMe-U amide dissolved in a mixed solution containing acetonitrile and an aromatic hydrocarbon represented by formula (3) can be used. An activator can be added to the aforementioned mixed solution. The activator can also be dissolved in the aforementioned mixed solution.

[0205] After the condensation step, the unreacted 5' hydroxyl group may be capped as appropriate. The capping can be performed using a known capping solution such as an acetic anhydride-tetrahydrofuran solution or a phenoxyacetic anhydride / N-methylimidazole solution.

[0206] The oxidation step of step (3) is a step of converting the phosphite group formed by the above-mentioned condensation step into a phosphate group or a thiophosphorothioate group. This step is a reaction of converting trivalent phosphorus into pentavalent phosphorus using an oxidant, and can be implemented by allowing the oxidant to act on the oligonucleic acid derivative supported on the solid phase carrier.

[0207] In the case of converting a phosphite group into a phosphate group, as an "oxidant", for example, iodine can be used. The oxidant can be prepared and used in a concentration of 0.005 to 2M. As an oxygen source for oxidation, water can be used, and as a base for the reaction, pyridine, N-methylimidazole (NMI), N-methylmorpholine, and triethylamine can be used. In addition, as a solvent, as long as it does not participate in the reaction, it is not particularly limited, and acetonitrile, tetrahydrofuran (THF) or a mixture thereof in any proportion can be used. For example, iodine / water / pyridine / acetonitrile, or iodine / water / pyridine, or iodine / water / pyridine / NMI, or iodine / water / pyridine / THF can be used. The reaction temperature is preferably 5°C to 50°C. The reaction time is generally preferably 1 minute to 30 minutes. The amount of the reagent used is preferably 1 to 100 mol, more preferably 1 to 10 mol, relative to 1 mol of the compound supported on the solid phase carrier.

[0208] When converting a phosphite triester group into a thiophosphoric acid group, as an "oxidant", for example, sulfur, 3H-1,2-benzodithiol-3-one-1,1-dioxide (Beaucage reagent), 3-amino-1,2,4-dithiazole-5-thione (ADTT), 5-phenyl-3H-1,2,4-dithiazol-3-one (POS), [(N,N-dimethylaminomethylene)amino]-3H-1,2,4-dithiazoline-3-thione (DDTT), and phenylacetyl disulfide (PADS) can be used. The oxidant can be used by diluting it with an appropriate solvent in a concentration of 0.001 to 2M. As a solvent used in the reaction, there is no particular limitation as long as it does not participate in the reaction, and for example, dichloromethane, acetonitrile, pyridine, or any mixed solvent thereof can be cited. The oxidation step can be performed after the aforementioned capping operation, and conversely, the capping operation can also be performed after the oxidation step, and the order is not limited.

[0209] In step (5), the step of deprotecting the phosphate protecting group is to allow an amine compound to act after the synthesis of the nucleic acid having the desired sequence is completed to deprotect the protecting group of the phosphate portion. Examples of the amine compound include diethylamine described in Japanese Patent No. 4705716.

[0210] The protecting group of the 5' hydroxyl group of the nucleoside introduced at the end of the extension can be used for column purification using the 5' protecting group as a tag after cleavage from the solid phase support and deprotection of the protecting group as described below, or the protecting group of the 5' hydroxyl group can be deprotected after column purification.

[0211] The excision of the oligonucleotide extended to a desired chain length on the solid phase support from the solid phase support in step (5) is usually carried out using concentrated aqueous ammonia as an excision agent.

[0212] Furthermore, the oligonucleotide chain can be cleaved from the solid support and recovered using ammonia or an amine compound, for example. Examples of the amine compound include methylamine, ethylamine, isopropylamine, ethylenediamine, and diethylamine.

[0213] In step (6), the protecting group of the 2' hydroxyl group of the ribose of the nucleic acid compound (A6) cut out from the solid phase support in step (5) can be removed according to the method described in International Publication No. 2006 / 022323), International Publication No. 2013 / 027843, or International Publication No. 2019 / 208571, thereby obtaining a deprotected oligonucleotide (A7).

[0214] As oligonucleotides that can be produced using the production method of the present invention, examples include, but are not limited to, oligonucleotides in which the nucleoside contained in the oligonucleotide is RNA, DNA, RNA having 2'-O-MOE, 2'-O-Me, 2'-F, and LNA. For example, examples of various nucleosides described in Xiulong, Shen et al., Nucleic Acids Research, 2018, Vol. 46, No. 46, 1584-1600, and Daniel O'Reilly et al., Nucleic Acids Research, 2019, Vol. 47, No. 2, 546-558 can be cited.

[0215] Typical examples of the oligonucleotide that can be used in the production method of the present invention include the following examples in addition to the examples described in the Examples, but the present invention is not limited to these.

[0216] In the following description of the sequence, U represents uridine (ST.25 standard), C represents cytidine, A represents adenosine, and G represents guanosine. In addition, T represents uridine in accordance with the ST.26 standard.

[0217] Examples include oligonucleotides having the following sequences (A) and (B) described in International Publication No. 2019 / 060442.

[0218] Sequence (A): 5'-AUGGAAUmACUCUUGGUUmACdTdT-3' (complying with ST.25 standard) (5'-ATGGAATmACTCTTGGTTmACdTdT-3' (complying with ST.26 standard)) (antisense) (SEQ ID NO: 1) 21mer

[0219] Sequence (B): 5'-GUmAACmCmAAGAGUmAUmUmCmCmAUmd TdT-3' (complying with ST.25 standard) (5'-GTmAACmCmAAGAGTmATmTmC mCmATmdTdT-3' (complying with ST.26 standard)) (positive sense) (SEQ ID NO: 2) 21mer

[0220] In sequences (A) and (B), Um represents 2'-O-methyluridine (ST.25 standard), Tm represents 2'-O-methyluridine (ST.26 standard), Cm represents 2'-O-methylcytidine, and dT represents thymidine. In this specification, the abbreviations in the sequence apply to both the ST.25 standard and the ST.26 standard unless otherwise specified.

[0221] Examples include oligonucleotides described in Japanese Patent Publication No. 2017-537626. As a typical example, an oligonucleotide having the following sequence (C) can be mentioned.

[0222] Sequence (C): 5'-AmsGmsUmsCCUCAUCUCCCUCAAGCGUUUA AGAGCUAUGCUGGUAACAGCAUAGCAAGUUUAAAUAAGGCUA GUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU UmsUmsUmsU-3' (complying with ST.25 standard) (5'-AmsGmsTmsCCTCATCT CCCTCAAGCGTTTAAGAGCTATGCTGGTAACAGCATAGCAAGTT TAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGGTGCTTTTmsTmsTmsT-3' (complying with ST.26 standard)) (SEQ ID NO: 3) 113mer

[0223] In sequence (C), Um represents 2'-O-methyluridine (ST.25 standard), Tm represents 2'-O-methyluridine (ST.26 standard), Am represents 2'-O-methyladenosine, Gm represents 2'-O-methylguanosine, and s represents phosphorothioate modification.

[0224] Example

[0225] Hereinafter, the present invention will be described in further detail using examples, but the technical scope of the present invention is not limited to these examples.

[0226] Determination method

[0227] First, various measurement methods used in the following experiments are shown below.

[0228] (Measurement method 1: Measurement of n-1mer impurities and FLP ratio in oligonucleotides)

[0229] The purity of oligonucleotides was determined by HPLC. FLP refers to the target substance (Full Length Product).

[0230] The HPLC measurement conditions are shown in Table 1 below.

[0231] [Table 1]

[0232] Table 1

[0233]

[0234] (Measurement method 2: measurement of oligonucleotide yield)

[0235] Determine the OD of the crude product 260 OD260 It indicates the absorbance at UV260nm per 10mm pathlength in 1mL solution (pH=7.5). Generally, it is known that 1OD=40μg in RNA, so based on the above OD 260 The yield is calculated based on the measured value.

[0236] Solid phase synthesis of oligonucleotides

[0237] Sequence (I): 5'-UmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUmUm-3' (in accordance with ST.25 standard) (5'-TmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTmTm-3' (in accordance with ST.26 standard)) (SEQ ID NO: 4) 25mer

[0238] In the sequence (I), Um represents 2'-O-methyluridine (ST.25 standard), and Tm represents 2'-O-methyluridine (ST.26 standard).

[0239] The above sequence (I) represents the following structure (16).

[0240] [Chemical formula 22]

[0241]

[0242] As a solid phase carrier, controlled pore glass (CPG) was used, and as a nucleic acid synthesizer, AKTA oligopilotplus100 (manufactured by GE Healthcare) was used. The oligonucleotide consisting of the above sequence (I) was synthesized from the 3' side toward the 5' side using the phosphoramidite solid phase synthesis method. The synthesis was carried out on a scale of about 53 μmol. In addition, in the synthesis, a 2'-OMe-U amide solution obtained by dissolving the 2'-OMe-U amide shown in formula (4) in an arbitrary solvent was used, a high-purity dichloroacetic acid toluene solution was used as a deprotection solution, a 5-benzylthio-1H-tetrazole solution was used as a condensing agent, an iodine solution was used as an oxidant, and a phenoxyacetic anhydride solution and an N-methylimidazole solution were used as a capping solution.

[0243] Next, a specific example of producing an oligonucleotide produced by the production method of the present invention is shown. Here, the oligonucleotide produced by the production method of the present invention in the following examples is an oligonucleotide having the sequence (I) shown in the above SEQ ID NO: 4.

[0244] The 2'-OMe-U derivative CPG described in the following Examples and Comparative Examples refers to a compound represented by the following formula (17): wherein the circle shown in the formula (17) schematically represents CPG.

[0245] [Chemical formula 23]

[0246]

[0247] Example 1

[0248] Using 53.7 μmol of 2'-OMe-U derivative CPG and 2'-OMe-U amide solution adjusted to 75 mM with acetonitrile:toluene 9:1 as solvent, the oligonucleotide shown in sequence (I) was automatically synthesized from the 3' side to the 5' side using AKTA oligopilot plus100 (manufactured by GE Healthcare). For the automatic synthesis step, first, a 3% dichloroacetic acid toluene solution was added to CPG to deprotect the trityl protecting group at the 5' position, and then a 2'-OMe-U amide solution and a condensing agent 5-benzylmercapto-1H-tetrazole acetonitrile solution were added to CPG to react with the hydroxyl group at the 5' position. Then, a 50 mM iodine solution was added to convert the phosphite group into a phosphate group. Next, as a capping solution, 0.1M phenoxyacetic anhydride acetonitrile solution and 10wt% N-methylimidazole / 10wt% 2,6-dimethylpyridine acetonitrile solution were used to perform capping at the reaction point where the condensation reaction did not occur. These steps were repeated a total of 24 times to synthesize a nucleic acid oligonucleotide of the sequence shown in sequence (I) on a CPG carrier. Then, the trityl protecting group at the 5' position was deprotected using a 3% dichloroacetic acid toluene solution. Then, 4.09g of ammonia water and 1.21g of ethanol were used on the CPG carrier carrying 8.0μmol of the oligonucleotide to free the oligonucleotide from the solid phase carrier. Then, the solid phase carrier was removed by filtration, and the ammonia water and ethanol were removed by vacuum drying to obtain the desired oligonucleotide in the form of a dry solid. The measurement result based on the measurement method 2 was 57.3mg, and the measurement result based on the measurement method 1 was 76.04% for the FLP ratio and 7.17% for the n-1mer ratio.

[0249] Example 2

[0250] In the method of Example 1, except that 55.6 μmol of 2'-OMe-U derivative CPG and 4:1 acetonitrile:toluene were used as the solvent of the 2'-OMe-U amide solution, the oligonucleotide of sequence (I) was obtained in the same manner. The yield was 58.3 mg, the FLP ratio was 78.01%, and the n-1mer ratio was 5.24%.

[0251] Example 3

[0252] In the method of Example 1, except that 53.5 μmol of 2'-OMe-U derivative CPG and 4:6 acetonitrile:toluene were used as the solvent of 2'-OMe-U amide solution, the oligonucleotide of sequence (I) was obtained in the same manner. The yield was 54.3 mg, the FLP ratio was 74.24%, and the n-1mer ratio was 4.14%.

[0253] Example 4

[0254] In the method of Example 1, except that 53.1 μmol of 2'-OMe-U derivative CPG and acetonitrile: o-xylene 4:1 were used as the solvent of 2'-OMe-U amide solution, the oligonucleotide of sequence (I) was obtained in the same manner. The yield was 58.6 mg, the FLP ratio was 77.84%, and the n-1mer ratio was 5.22%.

[0255] Example 5

[0256] In the method of Example 1, except that 53.1 μmol of 2'-OMe-U derivative CPG and 4:1 acetonitrile:chlorobenzene were used as the solvent of the 2'-OMe-U amide solution, the oligonucleotide of sequence (I) was obtained in the same manner. The yield was 57.3 mg, the FLP ratio was 77.82%, and the n-1mer ratio was 5.78%.

[0257] Example 6

[0258] In the method of Example 1, except that 52.4 μmol of 2'-OMe-U derivative CPG and acetonitrile: o-dichlorobenzene 4:1 as the solvent of 2'-OMe-U amide solution were used, the oligonucleotide of sequence (I) was obtained in the same manner. The yield was 56.4 mg, the FLP ratio was 76.62%, and the n-1mer ratio was 5.50%.

[0259] Comparative Example 1

[0260] In the method of Example 1, except that 52.8 μmol of 2'-OMe-U derivative CPG and acetonitrile: dichloromethane 4:1 were used as the solvent of 2'-OMe-U amide solution, the oligonucleotide of sequence (I) was obtained in the same manner. The yield was 59.4 mg, the FLP ratio was 76.87%, and the n-1mer ratio was 7.68%.

[0261] Table 2 shows the results of Examples 1 to 6 and Comparative Example 1 regarding the FLP ratio and the n-1mer ratio.

[0262] [Table 2]

[0263] Table 2

[0264]

[0265] From the results in Table 2, it can be seen that when acetonitrile and aromatic hydrocarbons are used as the solvent for the 2'-OMe-U amide solution, the n-1mer impurities can be relatively reduced compared to the case where the solution of Comparative Example 1 is used.

[0266] [Sequence Listing Free Text]

[0267] Sequence numbers 1 to 4 in the sequence listing represent base sequences of oligonucleotides produced by the production method of the present invention.

Claims

1. A method for producing an oligonucleotide, comprising the step of condensing a compound represented by formula (2) with 2'-OMe-U amide represented by formula (4) in the presence of an activator, [Chemical formula 1] In formula (2), G 2 represents a protecting group for a hydroxyl group, B a represents a nucleic acid base that can be protected by a protecting group, R represents a protected hydroxyl group, a hydrogen atom, a fluorine atom, a methoxy group, a 2-methoxyethyl group, or an OQ' group, Q' represents an alkylene group bonded to the carbon atom at the 4' position of ribose, X represents an oxygen atom or a sulfur atom, and, The bonds with * indicate the bonds toward the 3' side of the nucleic acid; [Chemical formula 2] In formula (4), G 1 represents a protecting group for a hydroxyl group; The 2'-OMe-U amide is dissolved in a mixed solution containing acetonitrile and an aromatic hydrocarbon represented by formula (3). [Chemical formula 3] In formula (3), Y 1 ~Y 6 are the same or different from each other and each independently represents a hydrogen atom, a methyl group, an ethyl group or a halogen atom.

2. The method for producing an oligonucleotide according to claim 1, wherein The aromatic hydrocarbon represented by formula (3) is benzene having one or two substituents selected from the group consisting of a methyl group, an ethyl group and a halogen atom. When benzene has two substituents, the substituents may be the same or different.

3. The method for producing an oligonucleotide according to claim 1, wherein The aromatic hydrocarbon represented by formula (3) is selected from the group consisting of toluene, o-xylene, m-xylene, p-xylene, chlorobenzene, o-dichlorobenzene, m-dichlorobenzene, p-dichlorobenzene, and a mixture of two or more thereof.

4. The method for producing an oligonucleotide according to any one of claims 1 to 3, wherein The volume ratio of acetonitrile to the aromatic hydrocarbon represented by the formula (3) contained in the mixed liquid in which the 2'-OMe-U amide represented by the formula (4) is dissolved is 99:1 to 1:99 in terms of acetonitrile:aromatic hydrocarbon represented by the formula (3).

5. The method for producing an oligonucleotide according to any one of claims 1 to 3, wherein The volume ratio of acetonitrile and the aromatic hydrocarbon represented by the formula (3) contained in the mixed liquid in which the 2'-OMe-U amide represented by the formula (4) is dissolved is 90:10 to 10:90 in terms of acetonitrile:aromatic hydrocarbon represented by the formula (3).

6. The method for producing an oligonucleotide according to any one of claims 1 to 3, wherein The volume ratio of acetonitrile to the aromatic hydrocarbon represented by the formula (3) contained in the mixed liquid in which the 2'-OMe-U amide represented by the formula (4) is dissolved is 90:10 to 40:60 in terms of acetonitrile:aromatic hydrocarbon represented by the formula (3).

7. The method for producing an oligonucleotide according to any one of claims 1 to 6, wherein The concentration of 2'-OMe-U amide in the 2'-OMe-U amide solution represented by formula (4) is 0.01 to 0.4M.

8. The method for producing an oligonucleotide according to any one of claims 1 to 6, wherein The concentration of 2'-OMe-U amide in the 2'-OMe-U amide solution represented by formula (4) is 0.05 to 0.2M.

9. The method for producing an oligonucleotide according to any one of claims 1 to 8, wherein The activator is 5-benzylthio-1H-tetrazole.

10. The method for producing an oligonucleotide according to any one of claims 1 to 9, wherein When R in the compound represented by formula (2) is a protected hydroxyl group, the protecting group of the hydroxyl group is a protecting group represented by formula (10), [Chemical formula 4] In formula (10), q represents an integer from 0 to 5, R a and R b are the same or different from each other, each representing a methyl group, an ethyl group or a hydrogen atom, The bonds marked with * are bonded to the oxygen of the 2' hydroxyl group. Ew represents an electron withdrawing group.

11. The method for producing an oligonucleotide according to any one of claims 1 to 10, wherein In the 2'-OMe-U amide represented by formula (4), G 1 It is 4,4'-dimethoxytrityl. 12 . The method for producing an oligonucleotide according to claim 1 , which is carried out by a solid phase synthesis method.

13. A solution comprising 2'-OMe-U amide represented by formula (4), acetonitrile and an aromatic hydrocarbon represented by formula (3), [Chemical formula 5] In formula (4), G 1 represents a protecting group for a hydroxyl group; [Chemical formula 6] In formula (3), Y 1 ~Y 6 The same as or different from each other, each independently represents a hydrogen atom, a methyl group, an ethyl group, or a halogen atom. 14 . A method for producing an oligonucleotide using the solution comprising 2′-OMe-U amide represented by formula (4), acetonitrile and an aromatic hydrocarbon represented by formula (3) according to claim 13 .

Images