Expression vector, host and application thereof in preparation of terephthalic acid

Abstract

The invention relates to the field of bioengineering, in particular to an expression vector, a host and application thereof in preparation of terephthalic acid. The invention provides a gene combination, and the gene combination comprises a tsaM gene from a Comamonas testosteroni T-2 source, a tsaB gene from the Comamonas testosteroni T-2 source, a tsaC gene from the Comamonas testosteroni T-2 source, and a tsaD gene from the Comamonas testosteroni T-2 source. The invention also provides a method for preparing the tsaM gene from the Comamonas testosteroni T-2 source, the tsaB gene from the Comamonas testosteroni T-2 source, the tsaC gene from the Comamonas testosteroni T-2 source and the tsaD gene from the Comamonas testosteroni T-2 source and the tsaD gene from the Comamonas testosteroni T-2 source. According to the invention, saccharomyces cerevisiae is used as a chassis cell, a biosynthetic pathway of terephthalic acid is constructed through a CRISPR / Cas9 technology and enhanced through a protein engineering strategy, and synthesis from p-toluic acid to terephthalic acid in a fungal chassis is realized.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering, and in particular to an expression vector, a host and the application thereof in the preparation of terephthalic acid. Background Art

[0002] Terephthalic acid is one of the important bulk organic raw materials. Its main use is to produce polyester fibers (polyester filaments and staple fibers), polyester bottle flakes and polyester films. More than 90% of the world's terephthalic acid is used to produce polyethylene terephthalate (PET for short). It takes 0.855 tons of terephthalic acid and 0.335 tons of ethylene glycol to produce 1 ton of PET. In the domestic market, 75% of terephthalic acid is used to produce polyester fibers, mainly used in clothing and home textile fabrics; 20% is used to produce bottle-grade polyester, mainly used in the packaging of various beverages, especially carbonated beverages; 5% is used for film-grade polyester, mainly used in packaging materials, films and magnetic tapes. At present, the mainstream processes for the production of terephthalic acid in the world are four patented technologies, namely BP (Amoco) in the UK, Mitsui in Japan, INVISTA (DuPont-ICI) in the US, and Lurgi-Eastman in Germany. The p-xylene oxidation process in the production of terephthalic acid involves multiple physical-chemical processes such as reaction, absorption, crystallization, heat transfer, mass transfer and mixing, and the mechanism is extremely complex; and the p-xylene production process covers almost all typical chemical units and is recognized as one of the most complex chemical plants in the world. In addition, the above methods all require catalysts, the reagents added in the reaction are easy to corrode the container, and the reaction is uncontrollable. Therefore, it is necessary to develop a greener and more environmentally friendly method to synthesize terephthalic acid. Compared with chemical processes, the biological transformation process has milder conditions and does not require expensive and toxic catalysts. There is great potential for the synthesis of p-toluic acid using microorganisms.

[0003] At present, there are not many studies on the biosynthesis of terephthalic acid. Some researchers have achieved the synthesis of terephthalic acid using p-xylene as a substrate in bacterial chassis such as Escherichia coli and Pseudomonas putida. Saccharomyces cerevisiae is a highly advantageous model fungus commonly used in industry, with clear genetic background, strong genetic operability and good acid and alkali resistance. Summary of the invention

[0004] In view of this, the present invention provides an expression vector, a host and their use in preparing terephthalic acid. The present invention uses Saccharomyces cerevisiae as a chassis cell, constructs a biosynthetic pathway of terephthalic acid through CRISPR / Cas9 technology and strengthens it through protein engineering strategy, thereby realizing the synthesis of terephthalic acid from p-toluic acid in the fungal chassis.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a gene combination, comprising: a tsaM gene derived from Comamonas testosteroni T-2, a tsaB gene derived from Comamonas testosteroni T-2, a tsaC gene derived from Comamonas testosteroni T-2 and a tsaD gene derived from Comamonas testosteroni T-2.

[0007] In some embodiments of the present invention, in the above gene combination, the tsaM gene has:

[0008] (1), the nucleotide sequence shown in SEQ ID NO: 1; or

[0009] (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or

[0010] (3) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2); and / or

[0011] The tsaB gene has:

[0012] (4) the nucleotide sequence shown in SEQ ID NO: 2; or

[0013] (5) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or

[0014] (6) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5); and / or

[0015] The tsaC gene has:

[0016] (7), the nucleotide sequence shown in SEQ ID NO: 3; or

[0017] (8) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as the nucleotide sequence shown in (7); or

[0018] (9) a nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (7) or (8); and / or

[0019] The tsaD gene has:

[0020] (10), the nucleotide sequence shown in SEQ ID NO: 3; or

[0021] (11) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (10), and having the same or similar function as the nucleotide sequence shown in (10); or

[0022] (12) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (10) or (11).

[0023]

[0024]

[0025] The present invention also provides an expression cassette, comprising: the above gene combination.

[0026] In some embodiments of the present invention, the above-mentioned expression cassette includes: one or more of expression cassettes 1 to 3;

[0027] The expression cassette 1 comprises: tsaM gene, tsaB gene and linker;

[0028] The expression cassette 2 includes: tsaC gene;

[0029] The expression cassette 3 includes: tsaD gene.

[0030] In some embodiments of the present invention, in the above expression cassette, the linker includes: a flexible linker or a rigid linker; the number of the linkers is 1 to 4.

[0031] In some embodiments of the present invention, in the above expression cassette, the linker includes one or more of GSYCGR, TPTP, GSG, EAAAK, GGGGS and GSGEAAAK.

[0032] In some embodiments of the present invention, in the above expression cassette, the number of the linkers is 1, 2, 3 or 4.

[0033] The present invention also provides an expression vector, comprising: the above expression cassette.

[0034] The present invention also provides a host for transforming and / or transfecting the above expression vector.

[0035] In some embodiments of the present invention, in the above-mentioned host, the transformed and / or transfected chassis strain includes: Saccharomyces cerevisiae.

[0036] In some embodiments of the present invention, in the above-mentioned host, the method for constructing the chassis strain comprises the following steps: knocking out the ADH6 gene, ADH7 gene, BDH1 gene, BDH2 gene, ARI1 gene and GRE2 gene of Saccharomyces cerevisiae BY4742 to obtain strain ySc01; expressing the xylM gene derived from Pseudomonas putida F1, the xylA gene derived from Pseudomonas putida F1 and the xylC gene derived from Pseudomonas putida KT2440 at the HO site of the strain ySc01 to obtain the chassis strain.

[0037] In some embodiments of the present invention, in the above-mentioned host, the Saccharomyces cerevisiae BY4742 is derived from patent CN113201465 A.

[0038]

[0039]

[0040]

[0041] The present invention also provides a method for preparing terephthalic acid, which comprises mixing a substrate with the host and fermenting the mixture to obtain terephthalic acid.

[0042] In some embodiments of the present invention, in the above preparation method, the substrate includes: p-toluic acid.

[0043] The beneficial effects of the present invention include:

[0044] (1) Compared with the existing terephthalic acid synthesis method, the treatment method of the present invention is mild, less polluting, low cost, and does not require special equipment;

[0045] (2) As a recognized safe strain, Saccharomyces cerevisiae has better biosafety than other chassis strains, mature regulation strategies, and is easier to implement subsequent optimization processes;

[0046] (3) Compared with chassis bacteria such as Pseudomonas putida, Saccharomyces cerevisiae has biosafety and good robustness, a clear genetic background, and mature molecular manipulation technology, which facilitates the introduction of exogenous pathways and metabolic regulation; Saccharomyces cerevisiae is easy to culture at high density and can effectively alleviate the problem of substrate and product inhibition;

[0047] (4) Compared with the published methods for the biosynthesis of terephthalic acid, the present invention successfully enhanced the ability of Saccharomyces cerevisiae to convert p-toluic acid by reconstructing chassis cells and performing an enzyme fusion process, providing more reference significance and research targets for the biosynthesis of terephthalic acid in fungi. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0049] Figure 1 The synthesis pathway of p-toluic acid is shown;

[0050] Figure 2 The reduction and oxidation process of p-tolualdehyde is shown;

[0051] Figure 3 The BY4742-p-methylbenzaldehyde fermentation results are shown;

[0052] Figure 4 Shown is the fermentation result of ySc01-p-methylbenzaldehyde;

[0053] Figure 5 The synthesis route of terephthalic acid is shown;

[0054] Figure 6 Shown is the expression pattern of gene tsaMBCD in Testosteronimonas T-1;

[0055] Figure 7 Schematic diagram showing the types and directions of fusion enzymes;

[0056] Figure 8 The ySc06-26 strain-toluic acid fermentation results are shown;

[0057] Fig. 9 The fermentation results of ySc27 strain-4-hydroxymethylbenzoic acid are shown;

[0058] Fig.10 Shown are the LC-MS results of ySc27 strain-p-toluic acid fermentation. DETAILED DESCRIPTION

[0059] The invention discloses an expression vector, a host and application of the expression vector in preparing terephthalic acid.

[0060] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0061] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0062] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0063] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0064] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0065] In Examples 1 to 5 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0066] The present invention will be further described below in conjunction with embodiments:

[0067] Example 1 Obtaining chassis strains

[0068] (1) Obtaining a Saccharomyces cerevisiae strain that blocks the main reduction pathway of p-tolualdehyde (p-TALD)

[0069] The starting strain is Saccharomyces cerevisiae BY4742, which is one of the most widely studied microbial chassis cells. However, Saccharomyces cerevisiae chassis cells contain more than 30 endogenous oxidoreductases, and aldehyde compounds are easily reduced or oxidized. The present invention relates to the oxidation of p-methylbenzyl alcohol (p-TALC) by p-xylene (px), which is then oxidized to p-methylbenzaldehyde (p-TALD) (such as Figure 1 In order to block the reduction process of the intermediate product p-tolualdehyde (as shown in Figure 2 As shown in the figure, this study knocked out 6 alcohol dehydrogenases, which were encoded by the following genes: ADH6 (SGD: S000004937), ADH7 (SGD: S000000702), BDH1 (SGD: S000000056), BDH2 (SGD: S000000057), ARI1 (SGD: S000003125), and GRE2 (SGD: S000005511), blocking the p-tolualdehyde reduction pathway.

[0070] Using CRISPR-Cas9 technology, six alcohol dehydrogenases were knocked out on the basis of strain BYB4742. Taking ADH6 knockout as an example, the specific method is as follows: query the base sequence of about 500bp above and below the ADH6 gene through the SGD website, and use the website to design the sgRNA targeting the ADH6 gene as CTATTCA ATCACACGAAGAT (as shown in SEQ ID NO: 8). Linearize the CRISPR-Cas9 plasmid with BsmBI restriction endonuclease, connect the obtained vector fragment with sgRNA, heat shock transform it into Escherichia coli DH5α competent cells, screen for Kana resistance, pick transformants for preliminary verification by colony PCR, activate the correct strains in the initial test by inoculating LB liquid culture medium, extract plasmid sequencing verification, and verify the correct transformants for bacterial preservation. The verified correct plasmid is named CRISPR-ADH6-HIS.

[0071] The sgRNA genes of the remaining 5 genes are as follows: ADH7 (sgRNA: CCAGAAAAATTTCA GGGCAT) (as shown in SEQ ID NO: 9); BDH1 (sgRNA: CGGTTTGGATTTCTG GCCTA) (as shown in SEQ ID NO: 10); BDH2 (sgRNA: ACCTTTACCGAAATA CGCTA) (as shown in SEQ ID NO: 11); ARI1 (sgRNA: ATGAACGATCTGTTGA AAGC) (as shown in SEQ ID NO: 12); GRE2 (sgRNA: ACAGGAGATCGACAAT GTGT) (as shown in SEQ ID NO: 13).

[0072] PCR amplification obtained 400 bp fragments of the upstream and downstream of the ADH6 gene, named ADH6-HA-up and ADH6-HA-dn, respectively. ADH6-HA-up and ADH6-HA-dn were connected by overlap extension PCR, and the obtained fragment was named overlap-ADH6-HA.

[0073] The plasmids and fragments were transformed into BY4742 strain by lithium acetate transformation method, and the same method was used to knock out the remaining 5 alcohol dehydrogenases for the verified correct strain. The final strain with 6 alcohol dehydrogenases knocked out was named ySc01.

[0074] Table 1 BY4742-p-methylbenzaldehyde fermentation results

[0075] Time (h) p-TALC(mg / L) pTA(mg / L) p-TALD (mg / L) 0 0 0 428 24 146 27 0 48 197.5 103 0 72 226.5 197.5 0 96 236 231 0

[0076] Table 2ySc01-p-methylbenzaldehyde fermentation results

[0077] Time (h) p-TALC(mg / L) pTA(mg / L) p-TALD (mg / L) 0 0 0 342 24 94.5 56 0 48 120.3 161.5 0 72 150.5 192.5 0 96 160 201.5 0

[0078] (2) Obtaining a plasmid expressing the fusion gene xylM and gene xylA

[0079] The xylM and xylA genes can jointly catalyze the conversion of p-xylene into p-methylbenzyl alcohol and then into p-methylbenzaldehyde. Therefore, based on strain ySc01, these two genes were fused and expressed through the (GGGGS)3 flexible linker.

[0080] The DNA sequence of (GGGGS)3 is ggtggtggtggttctggtggtggtggttctggtggtggtggttct (as shown in SEQ ID NO: 14).

[0081] The N-terminus of xylM was connected to the C-terminus of xylA using a flexible linker (GGGGS)3, and the yeast endogenous promoter P was amplified by PCR. FBA1 and terminator T PGI1 , overlap with xylM-(GGGGS)3-xylA to obtain module P FBA1 -xylM-(GGGGS)3-xylA-T PGI1 The pRS415 plasmid was digested with XhoI and BamHI restriction endonucleases to linearize the vector pRS415 and the module P FBA1 -xylM-(GGGGS)3-xylA-T PGI1 The cells were connected, heat-shocked and transformed into competent E. coli DH5α cells, Amp resistance screening was performed, and transformants were picked for preliminary verification by colony PCR. The correct strains were inoculated into LB liquid medium for activation, and plasmids were extracted and sequenced for verification. The correct transformants were then maintained. The verified plasmid was named pRS415-P FBA1 -xylM-(GGGGS)3-xylA-T PGI1 .

[0082] (3) Construction and verification of a strain capable of converting p-xylene into p-toluic acid

[0083] The synthetic pathway of p-toluic acid is as follows Figure 1 shown.

[0084] This pathway involves three genes, xylM, xylA, and xylC. The genes xylM and xylA are obtained by the method of Example 2 to obtain a fused expression plasmid, and the correct plasmid is verified by linearization to obtain fragment P FBA1 -xylM-(GGGGS)3-xylA-T PGI1 .

[0085] The method for obtaining the xylC expression module is as follows.

[0086] PCR amplification of the yeast endogenous promoter P PGK1 and terminator T HXT7 , overlap with xylC to obtain module P PGK1 -xylC-T HXT7 The pRS415 plasmid was digested with XhoI and BamHI restriction endonucleases to linearize the vector pRS415 and the module P PGK1 -xylC-T HXT7The cells were connected, heat-shocked and transformed into competent E. coli DH5α cells, Amp resistance screening was performed, and transformants were picked for preliminary verification by colony PCR. The correct strains were inoculated into LB liquid medium for activation, and plasmids were extracted and sequenced for verification. The correct transformants were then maintained. The verified plasmid was named pRS415-P PGK1 -xylC-T HXT7 . Linearization verifies the correct plasmid and obtains fragment P PGK1 -xylC-T HXT7 .

[0087] The two fragments obtained above were integrated into the genome of strain ySc01 delta22 (SGD: S000007175), delta15 (SGD: S000007201), delta9 (SGD: S000007145), and HO site (SGD: S000002386) to explore the effect of the integration site on the level of gene expression. The sgRNA targeting the HO site designed by the website was ACGACTATTCTGATGGCTAA (as shown in SEQ ID NO: 15), the sgRNA targeting delta22 was TTTGTTAATTCCTACATACT (as shown in SEQ ID NO: 16), the sgRNA targeting delta15 was TATACCAAAAATTCTCTC TG (as shown in SEQ ID NO: 17), and the sgRNA targeting delta9 was TGTACCAAAAGTTATCCTGT (as shown in SEQ ID NO: 18).

[0088] Taking integration into the HO site as an example, the original CRISPR plasmid was digested with BsmBI, the linearized plasmid was connected to the sgRNA, and heat-shocked into E. coli DH5α competent cells. Kana resistance screening was performed, and transformants were picked for preliminary verification by colony PCR. The initially correct strain was inoculated into LB liquid culture medium for activation, and the plasmid was extracted and sequenced for verification. The verified correct transformants were maintained for bacterial preservation. The verified correct plasmid was named CRISPR-HO-HIS. Primers were designed, and PCR was used to obtain fragments of about 500 bp above and below the HO site, named HO-HA-up and HO-HA-dn; PCR amplification obtained the promoter fragment PFBA1 and the terminator fragment T HXT7 . Overlap with HO-HA-up and HO-HA-dn to get the fragment overlap-HO-HA-up-F BA1P ,overlap-HXT7T-HO-HA-dn. Fragment T was obtained by overlapping extension PCR PGI1 -P PGK1 -xylC-T HXT7 .

[0089] The P FBA1 -xylM-(GGGGS)3-xylA-T PGI1 、T PGI1 -P PGK1 -xylC-T HXT7 、overlap-HO-HA-up-F BA1P , overlap-HXT7T-HO-HA-dn was transformed into the ySc01 strain to obtain strain ySc05.

[0090] Table 3ySc05-paraxylene fermentation results

[0091] ySc05(mg / L) 24 7 48 24.5 72 35 96 43.5

[0092] Example 2 Obtaining TsaMB fusion enzyme plasmid

[0093] The synthesis of terephthalic acid from p-toluic acid involves three steps, involving four genes: tsaM, tsaB, tsaC, and tsaD (e.g. Figure 5 These four genes are derived from prokaryotes, especially the tsaM and tsaB genes, which are in the same operon in the original genome of Testosterone Mononas T-2 and are regulated by the tsaR gene. The nucleotide sequences of the two genes overlap, and the expression process is initiated by a promoter (such as Figure 6 As shown in Figure 2 ). The genes in eukaryotic microorganisms are expressed by single cistrons. By expressing tsaM and tsaB separately under the strong constitutive promoters TDH3 and TEF1, that is, P TEF1 -tsaB-T HXT7 -P TDH3 -tsaM-T CYC1 and P TDH3 -tsaM-T CYC1 -P TEF1 -tsaB-T HXT7 The expression module was integrated into the TKL2-TEF2 locus (SGD:S000000321) to obtain strains ySc25 and ySc26. At 30°C and 220 rpm, fermentation was performed using p-toluic acid as a substrate, and only trace amounts of 4-hydroxymethylbenzoic acid were detected by HPLC.

[0094] The transformation efficiency can be further improved by expressing tsaM and tsaB genes by enzyme fusion. Figure 7 By changing the linker type, copy number and connection direction, the most efficient expression pattern can be screened out.

[0095] Using overlap extension PCR technology, 21 fusion enzymes were constructed, taking tsaB-GSG-tsaM as an example, and the specific method was as follows: design primers BMF: GTGGTGGTGGTAGATTGGTTTTAGATATTG GTTCTGGTATGTTCATCAGGAACTGTTGGTATG (as shown in SEQ ID NO: 19), BMR: CATACCAACAGTTCCTGATGAACATACCAGAACCAATATCTAAAACCAATCTACCACCACCAC (as shown in SEQ ID NO: 20). The two primer powders were added to ddH2O and dissolved to obtain a primer concentration of 100 μmol / L, and the annealing system was configured according to Table 4. The annealing process was carried out in a PCR instrument (the program is shown in Table 5), starting from 94°C with a gradient cooling, reducing 1°C every 6s, and a total of 40 cycles.

[0096] PCR amplification obtained tsaM, tsaB fragments, EcoRⅠ, NotⅠ enzyme linearized pRS413 plasmid. The obtained vector fragment was connected with tsaM, tsaB fragments and annealed products, heat-shocked and transformed into E. coli DH5α competent cells, Amp resistance screening, and transformants were picked for preliminary verification by colony PCR. The initially correct strains were inoculated into LB liquid culture medium for activation, and the extracted plasmids were sequenced and verified. The verified correct transformants were maintained. The verified correct plasmid was named B-GSG-M. Other linkers were obtained in the same way.

[0097] Table 4 Annealing reaction system

[0098]

[0099]

[0100] Table 5 Annealing reaction program

[0101]

[0102] Example 3 Obtaining a Saccharomyces cerevisiae strain for converting p-toluic acid into 4-hydroxymethylbenzoic acid

[0103] The 21 plasmids obtained in Example 2 were transformed into the strain ySc05 constructed in Example 1 by lithium acetate transformation, and transformants were selected for preliminary verification by colony PCR, and the correct transformants were maintained. The obtained strains were named as shown in the following table (Table 6).

[0104] Table 6 Strain list

[0105] Plasmids strain pRS413-tsaB-GSYCGR-tsaM ySc06 pRS413-tsaB-TPTP-tsaM ySc07 pRS413-tsaB-GSG-tsaM ySc08 pRS413-tsaB-EAAAK-tsaM ySc09 pRS413-tsaB-GGGGS-tsaM ySc10 pRS413-tsaB-(TPTP)2-tsaM ySc11 pRS413-tsaB-(GSG)2-tsaM ySc12 pRS413-tsaB-(EAAAK)2-tsaM ySc13 pRS413-tsaB-(GGGGS)2-tsaM ySc14 pRS413-tsaB-GSGEAAAK-tsaM ySc15 pRS413-tsaB-(GGGGS)4-tsaM ySc16 pRS413-tsaM-GGGGS-tsaB ySc17 pRS413-tsaM-(TPTP)2-tsaB ySc18 pRS413-tsaM-(GSG)2-tsaB ySc19 pRS413-tsaM-(EAAAK)2-tsaB ySc20 pRS413-tsaM-(GGGGS)2-tsaB ySc21 pRS413-tsaM-GSGEAAAK-tsaB ySc22 pRS413-tsaM-(GGGGS)4-tsaB ySc23 pRS413-tsaM-tsaB-split ySc24 pRS413-tsaB-tsaM-split ySc25

[0106] The fermentation was carried out at 30°C and 220 rpm with p-methylbenzoic acid as the substrate to verify the ability of the above strains to convert p-methylbenzoic acid. The results show that after 96 hours, strain ySc06 converted and produced 23.5 mg / L 4-hydroxymethylbenzoic acid.

[0107] Table 7ySc06-25 strain-toluic acid fermentation results

[0108] strain 4-CBAL(mg / L) strain 4-CBAL(mg / L) ySc06 23.5 ySc17 0 ySc07 0 ySc18 0 ySc08 1 ySc19 0 ySc09 3 ySc20 0 ySc10 0 ySc21 14 ySc11 0 ySc22 0 ySc12 0 ySc23 0 ySc13 0 ySc24 0 ySc14 0 ySc25 0 ySc15 0 ySc16 14

[0109] Example 4 Obtaining a Saccharomyces cerevisiae strain for converting 4-hydroxymethylbenzoic acid into terephthalic acid

[0110] The tsaC and tsaD genes were transformed into strain ySc06 by PCR amplification of the yeast endogenous promoter P ENO2 and terminator T CYC1 , overlap with tsaC to obtain module P ENO2 -ts aC-T CYC1 The pRS416 plasmid was digested with XhoI and BamHI restriction endonucleases to linearize the vector pRS416 and the module P ENO2 -tsaC-T CYC1 The cells were connected, heat-shocked and transformed into competent E. coli DH5α cells, Amp resistance screening was performed, and transformants were picked for preliminary verification by colony PCR. The correct strains were inoculated into LB liquid medium for activation, and the plasmids were extracted and sequenced for verification. The correct transformants were then maintained. The verified plasmid was named pRS416-P ENO2 -tsaC-T CYC1 . Linearization verifies the correct plasmid and obtains fragment P ENO2 -tsaC-T CYC1 PCR amplification of the yeast endogenous promoter P PDC1 and terminator T CYC 1. T GDP Overlap with tsaD to obtain module T CYC1 -P PDC1 -tsaD-T GDP The pRS416 plasmid was digested with XhoI and BamHI restriction endonucleases to linearize the vector pRS416 and the module T CYC1 -P PD C1 -tsaD-T GDP Connect, heat shock transform into E. coli DH5α competent cells, Amp resistance screening, pick transformants for colony PCR preliminary verification, the correct strains are inoculated into LB liquid culture medium for activation, extract plasmid sequencing verification, and verify the correct transformants for bacterial preservation. The verified correct plasmid is named pRS416-TCYC1 -P PDC1 -tsaD-T GDP . Linearization verifies the correct plasmid and obtains fragment T CYC1 -P PDC1 -tsaD-T GDP .

[0111] The tsaC and tsaD genes were integrated into the PDC5 site of the genome, and the sgRNA targeting the PDC5 site (SGD: S000004124) was designed using the website. The original CRISPR plasmid was digested with BsmBI, and the linearized plasmid was connected to the sgRNA, and heat-shocked and transformed into Escherichia coli DH5α competent cells. Ka na resistance screening was performed, and transformants were picked for preliminary verification by colony PCR. The initially correct strains were inoculated into LB liquid culture medium for activation, and the extracted plasmids were sequenced for verification. The verified correct transformants were maintained for bacterial preservation. The verified correct plasmid was named CRISPR-PDC5-HIS. Primers were designed, and PCR was used to obtain fragments of about 500 bp above and below the PDC5 site, named PDC5-HA-up and PDC5-HA-dn; PCR amplification obtained the promoter fragment P ENO2 and terminator fragment T GDP . The fragments overlapped with PDC5-HA-up and PDC5-HA-dn to obtain overlap-PDC5-HA-up-ENO2P and overlap-GDPT-PDC5-HA-dn respectively.

[0112] The fragment P was converted into ENO2 -tsaC-T CYC1 , T CYC1 -P PDC1 -tsaD-T GDP , overlap-PDC5-HA-up-ENO2P, overlap-GDPT-PDC5-HA-dn, and plasmid CRISPR-PDC5-HIS were transformed into the strain. Transformants were selected for preliminary verification by colony PCR, and the verified correct strain was named ySc27.

[0113] The ability of the strain to convert 4-hydroxymethylbenzoic acid into terephthalic acid was verified by fermentation. After 96 hours, the strain produced 70.5 mg / L terephthalic acid (e.g. Fig. 9 shown).

[0114] Table 8ySc27 strain-4-hydroxymethylbenzoic acid fermentation results

[0115] Time (h) TPA (mg / L) 48 56 96 70.5

[0116] Example 5 Obtaining a Saccharomyces cerevisiae strain capable of converting p-toluic acid into terephthalic acid

[0117] The fermentation was carried out at 30°C and 220 rpm to verify the ability of strain ySc27 to convert p-toluic acid into terephthalic acid. After 96 h, the strain successfully converted p-toluic acid into terephthalic acid as determined by LC-MS.

[0118] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A gene combination, characterized in that include: The tsaM gene derived from Comamonas testosteroni T-2, the tsaB gene derived from Comamonas testosteroni T-2, the tsaC gene derived from Comamonas testosteroni T-2, and the tsaD gene derived from Comamonas testosteroni T-2.

2. The gene combination according to claim 1, characterized in that: The tsaM gene has: (1), the nucleotide sequence shown in SEQ ID NO: 1; or (2) a nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or (3) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2); and / or The tsaB gene has: (4) the nucleotide sequence shown in SEQ ID NO: 2; or (5) a nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or (6) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5); and / or The tsaC gene has: (7), the nucleotide sequence shown in SEQ ID NO: 3; or (8) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as the nucleotide sequence shown in (7); or (9) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (7) or (8); and / or The tsaD gene has: (10), the nucleotide sequence shown in SEQ ID NO: 3; or (11) a nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (10), and having the same or similar function as the nucleotide sequence shown in (10); or (12) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (10) or (11).

3. An expression cassette, characterized in that include: The gene combination according to claim 1 or 2.

4. The expression cassette according to claim 3, characterized in that include: One or more of expression cassettes 1 to 3; The expression cassette 1 comprises: tsaM gene, tsaB gene and linker; The expression cassette 2 includes: tsaC gene; The expression cassette 3 includes: tsaD gene.

5. The expression cassette according to claim 4, characterized in that The linker includes: a flexible linker or a rigid linker; the number of the linkers is 1 to 4.

6. An expression vector, characterized in that include: The expression cassette according to any one of claims 3 to 5.

7. A host, characterized in that Transformation and / or transfection is carried out using the expression vector according to claim 6.

8. The host according to claim 7, characterized in that Strains for transformation and / or transfection include: Saccharomyces cerevisiae.

9. Use of the gene combination according to claim 1 or 2, the expression cassette according to any one of claims 3 to 5, the expression vector according to claim 6 and / or the host according to claim 7 or 8 in the preparation of terephthalic acid.

10. A method for preparing terephthalic acid, characterized in that: The substrate is mixed with the host as claimed in claim 7 or 8, and fermented to obtain terephthalic acid.

Images