Method for constructing D-p-hydroxyphenylglycine producing strain

Abstract

The invention discloses a method for constructing a D-p-hydroxyphenylglycine producing strain, which comprises the following steps: by taking escherichia coli BL21 (DE3) as a chassis strain, respectively introducing D-type mandelic acid dehydrogenase from Schleiferacibacillus harbinensis DSM 16991, L-type mandelic acid dehydrogenase from Pseudomonas putida, a transaminase mutant from Arthrobacter sp. And monooxygenase from Chromobacterium violaaceum into a genome of the BL21 (DE3), and carrying out fermentation, so as to obtain the D-p-hydroxyphenylglycine producing strain. The finally obtained engineering bacterium can be used for producing D-p-hydroxyphenylglycine through fermentation by taking DL-mandelic acid as a raw material.

Description

Technical Field

[0001] The invention belongs to the field of enzyme and metabolic engineering, and relates to a method for constructing D-p-hydroxyphenylglycine producing bacteria, namely, the use of an engineering strain. Background Art

[0002] L-4-hydroxyphenylglycine, also known as D-4-hydroxyphenylglycine, English name Dp-Hydroxyphenylglycine (D-HPG), CAS number 22818-40-2, is a pharmaceutical fine chemical with the appearance of white crystalline powder. It is an important side chain for the synthesis of β-lactam semi-synthetic antibiotics and can be used for the synthesis of broad-spectrum antibacterial antibiotics such as amoxicillin, cefoperazone, cefadroxil, cefprozil, and ceftriaxone sodium.

[0003] The preparation method of D-p-hydroxyphenylglycine is roughly divided into two categories, one of which is chemical synthesis, i.e., anisaldehyde is made into DL-p-hydroxyphenylglycine through cyclization and hydrolysis, then esterified with methanol, and split with sulfonic acid resolving agent to obtain D(-)-p-hydroxyphenylglycine. Most of the domestic D-p-hydroxyphenylglycine production enterprises currently basically adopt glyoxylic acid process production, but the resolving agent of this method is expensive, the sulfide smell is heavier, and the environmental pollution is larger. The other is prepared by biological enzyme catalysis, i.e., p-hydroxyphenylglycine is synthesized under the action of D-hydantoinase and D-carbamoylase, referring to the patent document of publication number CN115927274A, but this method is generally due to the low performance of enzyme, resulting in high product preparation cost. The patent document of publication number CN1483080A discloses a recombinant microorganism constructed by metabolic pathway, which can produce D-p-hydroxyphenylglycine (D-HPG) or D-phenylglycine (D-PG) by fermentation. The literature (Xu Tan, et al., A multi-enzyme cascade for efficient production of Dp-hydroxyphenylglycine from L-tyrosine..Bioresources and Bioprocessing, 2021, 8(1): 1-15.141.) mentioned a new type of cascade enzyme catalytic reaction to synthesize D-p-hydroxyphenylglycine. L-tyrosine was used as the substrate. Through the cascade reaction of four enzymes, L-amino acid oxidase (LAAD), S-hydroxymandelate synthase (HmaS), S-mandelate dehydrogenase (MDH), and meso-diaminopimelate dehydrogenase (DAPDH), 50 g / L substrate L-tyrosine can be catalyzed to synthesize 42.69 g / L of D-p-hydroxyphenylglycine within 24 hours. The product generation rate reached 92.5%, and the product ee value exceeded 99%. However, the substrate price of this method is relatively high, and it is difficult to apply it in actual production. Summary of the invention

[0004] In our study on the biosynthesis of D-p-hydroxyphenylglycine, we transformed Escherichia coli based on metabolic engineering and constructed an engineered bacterium that can produce D-p-hydroxyphenylglycine by fermentation using d-mandelic acid as a raw material, providing a new strategy for the construction of D-p-hydroxyphenylglycine production bacteria. Specifically, the present invention includes the following technical solutions.

[0005] A method for constructing a D-p-hydroxyphenylglycine producing bacterium comprises the following steps:

[0006] (1) Using Escherichia coli as the base bacteria, the coding genes of the following polypeptides were introduced into the genome of Escherichia coli respectively:

[0007] A D-type mandelate dehydrogenase (NAD+ dependent) (GenBank No. KRM29754.1) derived from Schleiferilactobacillus harbinensis DSM16991 (Harbin Schleiferilactobacillus DSM 16991) with an amino acid sequence of SEQ ID NO: 1, or a conservative variant polypeptide thereof, wherein the conservative variant polypeptide has more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology with the amino acid sequence of SEQ ID NO: 1, and has the function of D-type mandelate dehydrogenase or higher enzyme activity;

[0008] An L-type mandelate dehydrogenase (GenBank No. BAM38408.1) from Pseudomonas putida with an amino acid sequence of SEQ ID NO: 3, or a conservative variant polypeptide thereof, wherein the conservative variant polypeptide has 95% or more homology, preferably 96% or more homology, preferably 97% or more homology, preferably 98% or more homology, and more preferably 99% or more homology with the amino acid sequence of SEQ ID NO: 3, and has the same function or higher enzyme activity;

[0009] A transaminase having an amino acid sequence of SEQ ID NO: 5 (a transaminase mutant ATA63 from Arthrobacter sp. (Arthrobacter) reported in patent document CN202111516721.4) or a conservative variant polypeptide thereof, wherein the conservative variant polypeptide has more than 95% homology, preferably more than 96% homology, preferably more than 97% homology, preferably more than 98% homology, more preferably more than 99% homology with the amino acid sequence SEQ ID NO: 5, and has the same function or higher enzyme activity;

[0010] A monooxygenase from Chromobacterium violaceum (Chromobacterium violaceum) (GenBank No. WP_347752077.1) with an amino acid sequence of SEQ ID NO: 7, or a conservative variant polypeptide thereof, wherein the conservative variant polypeptide has 95% or more homology, preferably 96% or more homology, preferably 97% or more homology, preferably 98% or more homology, more preferably 99% or more homology with the amino acid sequence of SEQ ID NO: 7, and has the same function or higher enzyme activity;

[0011] (2) Screening positive clones to obtain engineered bacteria that can convert mandelic acid into D-p-hydroxyphenylglycine by fermentation.

[0012] The combination of the above four enzymes, namely D-mandelate dehydrogenase, L-mandelate dehydrogenase, transaminase and monooxygenase, strengthens or constructs the metabolic pathway of mandelic acid to D-p-hydroxyphenylglycine in Escherichia coli.

[0013] Preferably, the above-mentioned Escherichia coli is Escherichia coli BL21 (DE3).

[0014] In one embodiment, the polypeptide encoding gene can be introduced into the Escherichia coli genome by the following method:

[0015] A. cloning the coding gene of the polypeptide into a plasmid vector suitable for expression in Escherichia coli to form a recombinant plasmid, i.e., a target gene overexpression vector, and transforming the competent Escherichia coli to obtain a recombinant strain; and / or

[0016] B. The coding gene of the polypeptide is cloned into the Escherichia coli genome through gene editing technology to obtain a recombinant strain that overexpresses the target gene.

[0017] The plasmid transformation method in the above step A includes electroporation, chemical transformation, heat shock, etc.

[0018] The gene editing technology in the above step B can be selected from the following groups: homologous double exchange, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, MUCICAT, MuGENT (multiplex genome editing by natural transformation), etc.

[0019] Preferably, the nucleotide sequence of the gene encoding the D-type mandelate dehydrogenase whose amino acid sequence is SEQ ID NO: 1 is SEQ ID NO: 2, or the nucleotide sequence has 90% or more, preferably 92% or more, preferably 95% or more, preferably 97% or more, preferably 98% or more, more preferably 99% or more homology with SEQ ID NO: 2;

[0020] The nucleotide sequence of the gene encoding the L-type mandelate dehydrogenase whose amino acid sequence is SEQ ID NO: 3 is SEQ ID NO: 4, or the nucleotide sequence has 90% or more, preferably 92% or more, preferably 95% or more, preferably 97% or more, preferably 98% or more, and more preferably 99% or more homology with SEQ ID NO: 4;

[0021] The nucleotide sequence of the gene encoding the transaminase (mutant) having the amino acid sequence of SEQ ID NO: 5 is SEQ ID NO: 6, or the nucleotide sequence has 90% or more, preferably 92% or more, preferably 95% or more, preferably 97% or more, preferably 98% or more, more preferably 99% or more homology with SEQ ID NO: 6;

[0022] The nucleotide sequence of the gene encoding the monooxygenase whose amino acid sequence is SEQ ID NO: 7 is SEQ ID NO: 8, or the nucleotide sequence has 90% or more, preferably 92% or more, preferably 95% or more, preferably 97% or more, preferably 98% or more, and more preferably 99% or more homology with SEQ ID NO: 8.

[0023] In one embodiment, the gene encoding the D-type mandelate dehydrogenase, the gene encoding the L-type mandelate dehydrogenase, the gene encoding the aminotransferase (mutant), and the gene encoding the monooxygenase in step A are cloned into a plasmid vector, and the formed target gene expression vectors are respectively transferred into Escherichia coli; or

[0024] Two or more coding genes of the four enzymes are cloned on a plasmid vector, and the formed target gene expression vector is transferred into Escherichia coli or transferred into Escherichia coli separately.

[0025] The second aspect of the present invention provides a recombinant Escherichia coli, which is a D-p-hydroxyphenylglycine producing bacterium and is constructed by the method as described above.

[0026] Preferably, the host strain of the recombinant Escherichia coli is Escherichia coli BL21 (DE3), and the recombinant Escherichia coli is, for example, the engineered strain BL21 (DE3)-DPG12 in this article.

[0027] The third aspect of the present invention is to provide the use of the recombinant Escherichia coli as described above in the production of D-p-hydroxyphenylglycine by fermentation.

[0028] Preferably, when producing D-p-hydroxyphenylglycine by the above fermentation method, mandelic acid is added to the fermentation medium as a substrate raw material.

[0029] Furthermore, the mandelic acid is preferably low-priced rac-mandelic acid, i.e., racemic mandelic acid, to avoid using relatively expensive D- or L-chiral mandelic acid as a biosynthetic substrate raw material, thereby significantly reducing the production cost of D-p-hydroxyphenylglycine.

[0030] In one embodiment, the concentration of the substrate mandelic acid in the fermentation medium may be 2-20 g / L, preferably 3-15 g / L, preferably 4-10 g / L, for example, about 5 g / L.

[0031] The present invention constructs a genetically engineered Escherichia coli using Escherichia coli BL21 (DE3) as a base bacterium. By introducing mandelate dehydrogenase, aminotransferase and monooxygenase, D-p-hydroxyphenylglycine can be obtained by adding low-cost mixed mandelic acid during the fermentation process of the engineered bacteria, which confirms the feasibility and application prospects of the new metabolic engineering concept of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 It is a schematic diagram of the metabolic pathway map of the D-p-hydroxyphenylglycine-producing engineering bacteria constructed by the present invention.

[0033] Figure 2 It is a schematic diagram of the map structure of the plasmid PtrDonor-cargo-DPG1 constructed by the present invention.

[0034] Figure 3 It is a schematic diagram of the map structure of the plasmid PtrDonor-cargo-DPG2 constructed by the present invention.

[0035] Figure 4 It is a schematic diagram of the map structure of the plasmid PtrQCasTns-lacI constructed by the present invention.

[0036] Figure 5 The HPLC spectrum of the engineering bacteria BL21 (DE3) -DPG12 constructed by the present invention after 46 hours of shake flask fermentation. DETAILED DESCRIPTION

[0037] According to the characteristics of the biological metabolic pathway of Escherichia coli, we designed a new metabolic pathway to make Escherichia coli overexpress D-mandelate dehydrogenase (NAD+ dependent), L-mandelate dehydrogenase, R-type aminotransferase and phenylalanine monooxygenase, thus strengthening the biosynthesis of mandelic acid to D-hydroxyphenylglycine (see Figure 1 ), the experimental results showed the feasibility of the new metabolic engineering concept, thus providing a new route for constructing D-p-hydroxyphenylglycine producing bacteria or improving the production capacity of D-p-hydroxyphenylglycine producing bacteria.

[0038] It is easy to understand that the technical solution of the present invention may also be applied to microorganisms with biological metabolic characteristics similar or close to those of Escherichia coli.

[0039] In a specific embodiment, Escherichia coli BL21 (DE3) is used as the base strain, and single copies of three genes, namely D-mandelate dehydrogenase (shDMDH), L-mandelate dehydrogenase (ppLMDH) and R-type transaminase (ATA63), are first integrated into the lacI site of the base strain, and then multiple copies of the phenylalanine monooxygenase gene (cvPAH) are integrated into the strain. The engineered strain finally obtained can produce D-parahydroxyphenylglycine by fermentation with the addition of mandelic acid.

[0040] The insertion and knockout of the target gene in the above-mentioned metabolic engineering can be achieved through gene editing technology, or through plasmid transformation, or a combination of gene editing and plasmid transformation.

[0041] In the description of the technical solutions of the present invention, the term "and / or" used in terms such as "A and / or B", "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B and / or C" is intended to cover each of the following embodiments: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0042] The above four enzymes are not endogenous enzyme proteins of E. coli. In order to optimally express these exogenous enzymes or their mutants / conservative variant polypeptides in a recombinant microbial host such as the most commonly used E. coli host in genetic engineering, the expression genes can be codon optimized.

[0043] Codon optimization is a kind of technology that can be used for maximizing protein expression in organism by increasing the translation efficiency of gene of interest.Different organisms usually show the special preference for one of some codons of the same amino acid being encoded due to mutation tendency and natural selection.For example, in fast-growing microorganisms such as Escherichia coli, the optimization codon reflects the composition of its respective genome tRNA library.Therefore, in fast-growing microorganisms, the low-frequency codon of amino acid can be replaced with the codon for the same amino acid but with high frequency.Therefore, the expression of optimized DNA sequence is improved in fast-growing microorganisms.

[0044] After codon optimization, the gene encoding D-type mandelate dehydrogenase (shDMDH) SEQ ID NO: 1 can be SEQ ID NO: 2, the gene encoding L-type mandelate dehydrogenase (ppLMDH) SEQ ID NO: 3 can be SEQ ID NO: 4, the gene encoding R-type transaminase (ATA63) SEQ ID NO: 5 can be SEQ ID NO: 6, and the gene encoding phenylalanine monooxygenase (cvPAH) SEQ ID NO: 7 can be SEQ ID NO: 8.

[0045] As used herein, the term "conservative variant polypeptide / mutant" refers to a polypeptide that substantially retains the same biological function or activity as the polypeptide. The variant refers in particular to a small amount of amino acid mutations, such as (1) a polypeptide having the function of a wild-type enzyme formed by substitution, deletion or addition of one or more (e.g., 1-20, preferably 1-10; more preferably 1-5; more preferably 1-3) amino acid residues of the amino acid sequence of the enzyme SEQ ID NO: 1, 3, 5 or 7; (2) a polypeptide having more than 90%, more preferably more than 95%, more preferably more than 98%, more preferably more than 99% identity with the polypeptide having the sequence of the enzyme SEQ ID NO: 1, 3, 5 or 7, and having the function of the wild-type enzyme SEQ ID NO: 1, 3, 5 or 7; or (3) a polypeptide formed by adding a tag sequence to the N or C terminus of the polypeptide having the sequence of the enzyme SEQ ID NO: 1, 3, 5 or 7, or adding a signal peptide sequence to its N terminus. According to the teachings of this article, these fragments, derivatives and analogs belong to the scope known to those skilled in the art. The term "mutation" includes but is not limited to the replacement, deletion, insertion, chemical modification of amino acid residues, preferably a forward mutation, i.e., a mutation that improves function. The substitution can be a non-conservative substitution, a conservative substitution, or a combination of a non-conservative substitution and a conservative substitution. "Conservative" amino acid substitution or mutation refers to the interchangeability of residues with similar side chains, and therefore generally includes replacing the amino acid in the polypeptide with an amino acid in the same or similar amino acid definition category. However, as used herein, if a conservative mutation can be replaced by aliphatic to aliphatic, non-polar to non-polar, polar to polar, acidic to acidic, alkaline to alkaline, aromatic to aromatic, or a restricted residue to a restricted residue, then a conservative mutation does not include a hydrophilic to hydrophilic, hydrophobic to hydrophobic, hydroxyl-containing to hydroxyl-containing or small residue to small residue substitution. It is well known in the art that common cases of conservative substitutions include: mutual substitutions between aromatic amino acids F, W, and Y; mutual substitutions between hydrophobic amino acids L, I, and V; mutual substitutions between polar amino acids Q and N; mutual substitutions between basic amino acids K, R, and H; mutual substitutions between acidic amino acids D and E; and mutual substitutions between hydroxyl amino acids S and T. In addition, A, V, L, or I can be conservatively mutated to another aliphatic residue or another non-polar residue. Exemplary conservative substitutions can be performed, for example, according to the following table.

[0046] Initial residue Representative replacement Preferred substitutions Ala(A) Val; Leu; Ile Val Arg(R) Lys; Gln; Asn Lys Asn(N) Gln; His; Lys; Arg Gln Asp(D) Glu Glu Cys(C) Ser Ser Gln(Q) Asn Asn Glu(E) Asp Asp Gly(G) Pro; Ala Ala His(H) Asn; Gln; Lys; Arg Arg Ile(I) Leu; Val; Met; Ala; Phe Leu Leu(L) Ile; Val; Met; Ala; Phe Ile Lys(K) Arg; Gln; Asn Arg Met(M) Leu; Phe; Ile Leu Phe(F) Leu; Val; Ile; Ala; Tyr Leu Pro(P) Ala Ala Ser(S) Thr Thr Thr(T) Ser Ser Trp(W) Tyr; Phe Tyr Tyr(Y) Trp; Phe; Thr; Ser Phe Val(V) Ile; Leu; Met; Phe; Ala Leu

[0047] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only for illustrative purposes and are not intended to limit the present invention. In addition, it should be understood that after reading the concept of the present invention, various changes or adjustments made by those skilled in the art should fall within the scope of protection of the present invention, and these equivalent forms also belong to the scope of the present invention.

[0048] Example

[0049] The examples involve the addition amounts, contents and concentrations of various substances, wherein the percentages described therein, unless otherwise specified, are all by mass percentages.

[0050] In the examples herein, if no specific description is given for laboratory temperature or operating temperature, the temperature generally refers to room temperature (15-30° C.).

[0051] Materials and methods

[0052] The whole gene synthesis, primer synthesis and sequencing in the examples were all completed by Suzhou Genewise Biotechnology Co., Ltd.

[0053] The molecular biology experiments in the embodiments include plasmid construction, enzyme digestion, ligation, competent cell preparation, transformation, culture medium preparation, etc., and are mainly carried out with reference to Molecular Cloning Experiment Guide (3rd edition), edited by J. Sambrook and DW Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002). If necessary, the specific experimental conditions can be determined by simple experiments.

[0054] PCR amplification experiments were performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. If necessary, adjustments could be made through simple experiments.

[0055] LB medium: 10g / L tryptone, 5g / L yeast extract, 10g / L sodium chloride, pH 7.2. (LB solid medium plus 20g / L agar powder.)

[0056] Fermentation medium: tryptone 20g / L, yeast extract 10g / L, ammonium sulfate 10g / L, magnesium sulfate 0.5g / L, potassium dihydrogen phosphate 2g / L, dipotassium hydrogen phosphate 4g / L, glutamic acid 0.5g / L, thiamine hydrochloride 0.1g / L, glucose 30g / L, mandelic acid 5g / L.

[0057] Liquid chromatography (HPLC) detection conditions for D-p-hydroxyphenylglycine content in fermentation broth:

[0058] Agilent 1260 liquid chromatograph, C18 (250*4.6 mm, 5 μm) chromatographic column, mobile phase: mobile phase A (50 mM sodium acetate buffer (pH 4.2)): mobile phase B (methanol) = 90:10, column temperature 30°C, flow rate 1.0 ml / min, detection wavelength: 254 nm.

[0059] D-4-Hydroxyphenylglycine chiral detection conditions:

[0060] Agilent 1260 liquid chromatograph, CrownpakCR(-) chiral chromatographic column (150 mm*4.0 mm, 5 μm), mobile phase: perchloric acid solution (pH 2.0), detection wavelength of 220 nm; flow rate: 0.7 mL / min.

[0061] The gene editing systems used to insert target genes into Escherichia coli, such as CRISPR-Cas9 and MUCICAT systems, and some plasmids, such as pTargetF, are constructed by Shanghai Banglin Biotechnology Co., Ltd. or purchased and preserved commercially. Any unit or individual can obtain these plasmids for verification of the present invention, but they may not be used for other purposes, including development and utilization, scientific research and teaching, without the permission of Shanghai Banglin Biotechnology Co., Ltd.

[0062] It should be noted that, for the sake of convenience of description, in the embodiments, the strain number, plasmid number, enzyme number, and enzyme encoding gene number may share one number, which is easily understood by those skilled in the art, that is, the same number can refer to different biological forms in different environments.

[0063] Example 1: Obtaining genes

[0064] According to the D-type mandelate dehydrogenase shDMDH (GenBank No. KRM29754.1) from Schleiferilactobacillus harbinensis DSM 16991 published on NCBI, the amino acid sequence of which is SEQ ID NO: 1, codon optimization was performed based on this, and the coding gene sequence SEQ ID NO: 2 was synthesized in its entirety;

[0065] According to the L-type mandelate dehydrogenase ppLMDH from Pseudomonas putida published on NCBI (GenBank No. BAM38408.1), the amino acid sequence of which is SEQ ID NO: 3, codon optimization was performed based on this, and the coding gene sequence SEQ ID NO: 4 was synthesized in the whole gene;

[0066] The transaminase is the transaminase mutant ATA63 from Arthrobacter sp. disclosed in the company's patent document CN202111516721.4, whose amino acid sequence is SEQ ID NO: 5 and the gene sequence is SEQ ID NO: 6.

[0067] According to the monooxygenase cvPAH from Chromobacterium violaceum published on NCBI (NCBI sequence number: WP_347752077.1), whose amino acid sequence is SEQ ID NO: 7, codon optimization was performed based on this, and the coding gene sequence SEQ ID NO: 8 was synthesized by full gene synthesis.

[0068] Example 2: Construction of genetically engineered Escherichia coli

[0069] Using BL21 (DE3) as the starting strain, the MUCICAT system reported in the literature Orthogonal CRISPR-associated transposases for parallel and multiplexed chromosomal integration. Nucleic Acids Research, 2021, 49 (17), 10192-10202, https: / / doi.org / 10.1093 / nar / gkab752 was used to construct the D-p-hydroxyphenylglycine synthesis pathway, which specifically includes the following steps.

[0070] 1. Construction of PtrDonor-cargo-DPG1 vector

[0071] Amplification of T7P-shDMDH fragment: Using PET24a plasmid as template and RE-T7P-F / T7P-shDMDH-R as primers, PCR amplified T7P fragment with a fragment size of 148 bp, which was recovered by gel excision; using shDMDH synthetic gene as template and shDMDH-F / shDMDH-R as primers, PCR amplified shDMDH fragment with a fragment size of 960 bp, which was recovered by gel excision; using T7P fragment and shDMDH fragment as template, and then using RE-T7P-F / shDMDH-R as primers, amplified T7P-shDMDH fragment with a fragment size of 1089 bp, which was recovered by gel excision for later use.

[0072] Amplification of ppLMDH-T7t fragment: Using ppLMDH synthetic gene as template and DL-MDH-F / shDMDH-R as primers, PCR amplification of ppLMDH fragment, the fragment size is 1211bp, and the fragment is recovered by gel cutting; using PET24a plasmid as template and LMDH-T7t-F / ATA63-T7t-R as primers, PCR amplification of T7t fragment, the fragment size is 158bp, and the fragment is recovered by gel cutting; using T7t fragment and ppLMDH fragment as template, and then using DL-MDH-F / ATA63-T7t-R as primers to amplify ppLMDH-T7t fragment, the fragment size is 1349bp, and the fragment is recovered by gel cutting for later use.

[0073] Amplification of T7P2-ATA63 fragment: Using PET24a plasmid as template and LE-T7P-F / ATA63-T7P-R as primers, PCR amplified T7P2 fragment with a fragment size of 137 bp, which was recovered after gel excision; using EcAT63 strain as template and ATA63-F / ATA63-R as primers, PCR amplified ATA63 fragment with a fragment size of 993 bp, which was recovered after gel excision; using T7P2 fragment and ATA63 fragment as template, and then using LE-T7P-F / ATA63-R as primers, amplified T7P2-ATA63 fragment with a fragment size of 1108 bp, which was recovered after gel excision for later use.

[0074] PtrDonor vector fragment: Using plasmid pDonorGFP (Ptr) plasmid (Addgene No. 175578) as a template and trp-LE / trp-RE as primers, PCR amplification was performed to obtain the PtrDonor vector fragment with a fragment size of 3526 bp. The PCR product was added with 1 μl Dpn I and digested at 37°C for 1 hour, then cut from the gel and recovered for use.

[0075] use -Basic Seamless Cloning and Assembly Kit was used to recombinantly connect the PtrDonor vector fragment, T7P-shDMDH fragment, ppLMDH-T7t fragment, and T7P2-ATA63 fragment, transform DH5a, screen on 25μg / ml chloramphenicol resistance LB plate, and perform colony PCR amplification with ptr-seq-F / LE-T7P-F as primers. The positive clone was 3651bp in size, and the correct clone after sequencing was the PtrDonor-cargo-DPG1 vector, see Figure 2 .

[0076] 2. Construction of PtrDonor-cargo-DPG2 vector

[0077] Amplification of trc-cvPAH-ter fragment: Using cvPAH synthetic gene as template and trc-cvPAH-F / ter-cvPAH-R as primers, PCR amplification of cvPAH fragment was performed with a fragment size of 957 bp, which was recovered by gel excision for later use. Using commercial vector pTrc99a as template, rrnB-ter-F / LE-ter-R as primers were then used to PCR amplify rrnB-ter fragment with a fragment size of 435 bp, which was recovered by gel excision for later use. Finally, using cvPAH fragment and rrnB-ter fragment as template and trc-F / LE-ter-R as primers, PCR amplification of trc-cvPAH-ter fragment was performed with a fragment size of 1406 bp, which was recovered by gel excision for later use.

[0078] PtrDonor vector fragment: Using the plasmid pDonorGFP (Ptr) plasmid (Addgene No. 175578) as a template and trp-LE / trp-RE as primers, PCR amplification was performed to obtain the PtrDonor vector fragment with a fragment size of 3526 bp. The PCR product was added with 1l Dpn I and digested at 37°C for 1h, then cut from the gel and recovered for use.

[0079] use -Basic Seamless Cloning and Assembly Kit was used to recombinantly connect the PtrDonor vector fragment and the trc-cvPAH-ter fragment, transform DH5a, screen on 25g / ml chloramphenicol-resistant LB plates, and perform colony PCR amplification using ptr-seq-F / LE-ter-R as primers. The size of the positive clone was 1553bp, and the correct clone after sequencing was the PtrDonor-cargo-DPG2 vector, see Figure 3 .

[0080] The sequences of the primers used to construct the vector are shown in the following table:

[0081]

[0082] In the table, the suffix "-F" in the primer name represents forward; "-R" represents reverse.

[0083] 3. Construction of PtrQCasTns-lacI vector

[0084] According to the Escherichia coli BL21 (DE3) genome sequence AM946981, the N32 region of the lacI site, i.e., lacI (agttgttgtgccacgcggttgggaatgtaatt), was designed. Nco-lacI32-P1 and bamh-lacI32-P2 were used as templates and primers for PCR amplification to obtain a lacI32 fragment with a fragment size of 104 bp. The product was directly recovered for standby use. The recovered lacI32 fragment was digested with Nco I / BamH I and loaded into pQCasTns(Ptr)-array8 (Addgene No.: 175580), and finally the PtrQCasTns-lacI vector was obtained. See Figure 4 .

[0085] The sequences of the primers used to construct the vector are shown in the following table:

[0086]

[0087] 4. The first round of MUCICAT system transformation

[0088] Prepare the electroporation competent cells of Escherichia coli strain BL21 (DE3), transform 100 ng of PtrDonor-cargo-DPG1 plasmid, apply 25 μg / ml chloramphenicol resistance LB solid plate, and culture at 37°C overnight to obtain

[0089] PtrDonor-cargo-DPG1 / BL21(DE3) strain. Prepare the electroporation competent state of PtrDonor-cargo-DPG1 / BL21(DE3) strain, then transform 100ng PtrQCasTns-lacI plasmid, apply 50μg / ml kanamycin resistance LB solid plate, culture at 37°C overnight to obtain PtrDonor-cargo-DPG1 / PtrQCasTns-lacI / BL21(DE3) strain, apply to triple-antibody LB plate containing 50μg / ml kanamycin, 25μg / ml chloramphenicol and 100ng / ml dehydrated tetracycline, culture at 37°C overnight, and then pick the clones on the triple-antibody plate and culture on LB plate containing 50μg / ml kanamycin, 25μg / ml chloramphenicol and 1000ng / ml The plates were streaked on dehydrated tetracycline triple-resistance LB plates and cultured overnight at 37°C. The grown single clones were subjected to colony PCR using lacI-up / lacI-dn primers. The insert size of the positive PCR was about 4600 bp, and that of the negative was about 505 bp. The positive clone strain was recorded as PtrDonor-cargo-DPG1 / PtrQCasTns-lacI / BL21(DE3)-DPG1, and its genotype was PtrDonor-cargo-DPG1 / PtrQCasTns-lacI / BL21(DE3), lacI::DPG1.

[0090] The primer sequences are shown in the following table:

[0091] Primer name Primer sequence (5'-3') lacI-up CAGTCGCGTACCGTCTTCATG lacI-dn GAAACCAGTAACGTTATACGATG

[0092] 5. Auxiliary plasmid elimination

[0093] The pCutAmp system reported in the literature Multicopy chromosomal integration using CRISPR-associated transposases.ACS Synth Biol.2020Jun 17.doi:10.1021 / acssynbio.0c00073. was used to eliminate the auxiliary plasmids of the above positive cloned strains. The target strain was electroporated and transformed with pCutamp plasmid (Addgene No. 140632), then 1 ml of LB liquid was added to recover at 37°C for one hour, and then the cells were transferred to 4 ml of LB liquid medium containing 50 μg / ml apramycin and 10 mM L-rhamnose by centrifugation, and cultured at 37°C, 250 rpm for 3 hours, and then 100 μl of the culture solution was spread on LB solid medium containing 50 μg / ml apramycin and 10 mM L-rhamnose, and cultured at 37°C overnight. Then, 50-100 clones were picked and spotted on high-sugar and non-antibiotic LB plates (containing 10 g / L sucrose + 5 g / L glucose), LB plates containing 50 μg / ml kanamycin resistance, and LB plates containing 25 μg / ml chloramphenicol resistance. The clones that only grew on the high-sugar and non-antibiotic LB plates but did not grow on other resistant plates were selected, and then inoculated into 5 ml of liquid LB medium containing 5 g / L glucose, and cultured at 37°C overnight. The overnight bacterial liquid was streaked on a high-sugar and non-antibiotic LB plate (containing 10 g / L sucrose + 5 g / L glucose). After culturing at 37°C overnight, single clones were spotted on non-antibiotic LB plates and LB plates containing 50 μg / ml apramycin resistance, and the strain that only grew on the non-antibiotic LB plate was picked for shaking culture preservation, recorded as BL21(DE3)-DPG1, whose genotype was BL21(DE3), lacI::DPG1.

[0094] 6. Second round of MUCICAT system transformation

[0095] The second round of MUCICAT system transformation was carried out using BL21(DE3)-DPG1 as the starting strain, and the electroporation competent state of E. coli strain BL21(DE3)-DPG1 was prepared, and 100 ng of PtrDonor-cargo-DPG2 plasmid was transformed. The plasmid was coated with 25 μg / ml chloramphenicol-resistant LB solid plates and cultured at 37°C overnight to obtain PtrDonor-cargo-DPG2 / BL21(DE3)-DPG1 strain. The electroporation competent state of PtrDonor-cargo-DPG2 / BL21(DE3)-DPG1 strain was prepared, and then 100 ng of PtrDonor-cargo-DPG2 plasmid was transformed. The pQCasTns(Ptr)-array8 (Addgene No.: 175580) plasmid was coated on a 50 μg / ml kanamycin-resistant LB solid plate and cultured overnight at 37°C to obtain the PtrDonor-cargo-DPG2 / pQCasTns(Ptr)-array8 / BL21(DE3)-DPG1 strain, which was then coated on a triple-antibody LB plate containing 50 μg / ml kanamycin, 25 μg / ml chloramphenicol and 100 ng / ml dehydrated tetracycline, and cultured overnight at 37°C. The clones on the triple-antibody plate were picked and streaked on a triple-antibody LB plate containing 50 μg / ml kanamycin, 25 μg / ml chloramphenicol and 1000 ng / ml dehydrated tetracycline, and cultured overnight at 37°C. The grown single clones were subjected to colony PCR using primers, and the insert size of the positive PCR was about 2700-3000 bp, and the negative was about 400-600 bp.

[0096] The primer sequences are shown in the following table:

[0097]

[0098]

[0099] 7. Plate Fermentation and Screening

[0100] Six clones with different insertion copies in the PtrDonor-cargo-DPG2 / pQCasTns(Ptr)-array8 / BL21(DE3)-DPG1 induced bacteria were selected for 96-well plate fermentation.

[0101] The single clone was inoculated into 600 μl of antibiotic-free LB liquid medium, cultured at 37°C, 280 rpm overnight as seed liquid; inoculated into 700 μl of fermentation medium at a 10% inoculation rate, and then cultured at 30°C, 280 rpm for 48 hours; samples were taken for HPLC detection of the product. The liquid phase detection results showed that a strain with 5 copies of the insertion had the highest yield. The strain was recorded as PtrDonor-cargo-DPG2 / pQCasTns(Ptr)-array8 / BL21(DE3)-DPG12, with a genotype of

[0102] PtrDonor-cargo-DPG2 / pQCasTns(Ptr)-array8 / BL21(DE3), lacI::DPG1, array8::5×DPG2 strains.

[0103] 8. Auxiliary plasmid elimination

[0104] The same operation as step 5 of this example was performed to obtain an antibiotic-free strain denoted as BL21(DE3)-DPG12, whose genotype was BL21(DE3), lacI::DPG1, array8::5×DPG2.

[0105] Example 3: Shake flask fermentation with engineered bacteria

[0106] A single clone of BL21(DE3)-DPG12 was inoculated into 4 ml of antibiotic-free LB liquid medium and cultured overnight at 37°C and 280 rpm as seed liquid; the inoculation volume was inoculated into a shake flask containing 50 ml of fermentation medium at 2% v / v, and cultured at 37°C and 250 rpm for 12 h, then adjusted to 30°C and cultured at 250 rpm for 48 h; samples were taken for HPLC detection of the product. Figure 5 The liquid phase detection results showed that after 48 hours of shake flask fermentation, with the addition of 5g / L mandelic acid, 4.8g of D-p-hydroxyphenylglycine could be produced, and the molar conversion rate of mandelic acid exceeded 87%. Chiral identification showed that the ee value of the product was greater than 99%, which has very good prospects for industrial development and application.

Claims

1. A method for constructing a D-p-hydroxyphenylglycine producing bacterium, characterized in that: The steps include: (1) Using Escherichia coli as the base bacteria, the coding genes of the following polypeptides were introduced into the genome of Escherichia coli respectively: A D-type mandelate dehydrogenase (GenBank No. KRM29754.1) with an amino acid sequence of SEQ ID NO: 1 or a conservative variant polypeptide thereof, wherein the conservative variant polypeptide has more than 95% homology with the amino acid sequence of SEQ ID NO: 1 and has the function of D-type mandelate dehydrogenase or higher enzyme activity; An L-type mandelate dehydrogenase (GenBank No. BAM38408.1) having an amino acid sequence of SEQ ID NO: 3 or a conservative variant polypeptide thereof, wherein the conservative variant polypeptide has more than 95% homology with the amino acid sequence of SEQ ID NO: 3 and has the same function or higher enzyme activity; A transaminase having an amino acid sequence of SEQ ID NO: 5 or a conservative variant polypeptide thereof, wherein the conservative variant polypeptide has more than 95% homology with the amino acid sequence of SEQ ID NO: 5 and has the same function or higher enzyme activity; A monooxygenase with an amino acid sequence of SEQ ID NO: 7 (GenBank No. WP_347752077.1) or a conservative variant polypeptide thereof, wherein the conservative variant polypeptide has more than 95% homology with the amino acid sequence of SEQ ID NO: 7 and has the same function or higher enzyme activity; (2) Screening positive clones to obtain engineered bacteria that can convert mandelic acid into D-p-hydroxyphenylglycine by fermentation.

2. The method according to claim 1, characterized in that The Escherichia coli is Escherichia coli BL21 (DE3).

3. The method according to claim 1, characterized in that The polypeptide encoding gene is introduced into the Escherichia coli genome by the following method: A. cloning the coding gene of the polypeptide into a plasmid vector suitable for expression in Escherichia coli to form a recombinant plasmid, i.e., a target gene overexpression vector, and transforming the competent Escherichia coli to obtain a recombinant strain; and / or B. The coding gene of the polypeptide is cloned into the Escherichia coli genome through gene editing technology to obtain a recombinant strain that overexpresses the target gene.

4. The method according to claim 1, characterized in that The nucleotide sequence of the gene encoding the D-type mandelate dehydrogenase whose amino acid sequence is SEQ ID NO: 1 is SEQ ID NO: 2, or the nucleotide sequence has more than 90% homology with SEQ ID NO: 2; The nucleotide sequence of the gene encoding the L-type mandelate dehydrogenase whose amino acid sequence is SEQ ID NO: 3 is SEQ ID NO: 4, or the nucleotide sequence has more than 90% homology with SEQ ID NO: 4; The nucleotide sequence of the gene encoding the transaminase (mutant) having the amino acid sequence of SEQ ID NO: 5 is SEQ ID NO: 6, or the nucleotide sequence has more than 90% homology with SEQ ID NO: 6; The nucleotide sequence of the gene encoding the monooxygenase whose amino acid sequence is SEQ ID NO: 7 is SEQ ID NO: 8, or the nucleotide sequence has more than 90% homology with SEQ ID NO:

8.

5. The method according to claim 3, characterized in that In step A, the gene encoding the D-type mandelate dehydrogenase, the gene encoding the L-type mandelate dehydrogenase, the gene encoding the aminotransferase (mutant), and the gene encoding the monooxygenase are cloned into a plasmid vector, and the formed target gene expression vectors are respectively transferred into Escherichia coli; or Two or more coding genes of the four enzymes are cloned into a plasmid vector, and the formed target gene expression vector is transferred into Escherichia coli.

6. A recombinant Escherichia coli, which is a D-p-hydroxyphenylglycine producing bacterium, characterized in that: Constructed by the method according to any one of claims 1 to 5.

7. The recombinant Escherichia coli according to claim 6, characterized in that The host bacteria was Escherichia coli BL21 (DE3).

8. Use of the recombinant Escherichia coli as claimed in claim 6 or 7 in the production of D-p-hydroxyphenylglycine by fermentation.

9. The use according to claim 8, characterized in that Mandelic acid was added to the fermentation medium as a substrate raw material.

10. The use according to claim 9, characterized in that The mandelic acid is rac-mandelic acid, that is, racemic mandelic acid.

Images