Molecular marker Chr01-43706671 primer combination for identifying peach variety with low cold demand and application of molecular marker Chr01-43706671 primer combination

Abstract

The invention discloses a molecular marker Chr01-43706671 for identifying a peach variety with low cold demand. The sequence of the molecular marker Chr01-43706671 is as shown in SEQ ID NO. 4. The molecular marker Chr01-43706671 primer combination is used for identifying the peach variety with low cold demand, and comprises a forward primer as shown in SEQ ID NO.1-2 and a common reverse primer as shown in SEQ ID NO.3. The invention also discloses a molecular marker Chr01-43706671 primer combination for identifying the peach variety with low cold demand. The invention also discloses an application thereof. The molecular marker and the primer provided by the invention can be used for identifying the cold demand property of the peach, can identify the peach with low cold demand at high probability, improves the breeding process of the peach variety with low cold demand, obviously improves the breeding efficiency, and provides a reliable method for breeding the peach variety with low cold demand. And the sustainable development requirements of the peach industry which is warmed in climate and planted to the south are met.

Description

Technical Field

[0001] The invention relates to a group of molecular marker Chr01-43706671 primer combinations for identifying low-chilling-requirement peach varieties and applications thereof, belonging to the field of molecular biology. Background Art

[0002] Peach (Prunus persica (L.) Batsch) is the third largest deciduous economic fruit tree in the world, mainly distributed in the temperate zone between 30° and 45° north and south latitudes. Against the backdrop of rising temperatures, the extension of peach planting to the south, and the expansion of facility cultivation, in order to ensure that peaches can successfully break dormancy and grow and produce normally, it is urgent to strengthen and accelerate the breeding of low-chilling peaches.

[0003] Currently, there are very limited records on SNP markers for low-chilling peaches. The stability and effectiveness of existing markers in larger populations, populations with more complex genetic backgrounds, or populations in different environments are not high. Stable and effective molecular auxiliary markers for peach cold requirement are still lacking, which affects the rapid and effective identification of low-chilling peaches and to a certain extent restricts the sustainable development of the peach industry. Summary of the invention

[0004] The purpose of the present invention is to provide a set of Chr01-43706671 molecular markers and primer combinations for identifying low-chilling peach varieties, wherein low-chilling peach varieties refer to peach varieties with a chilling requirement of less than 400 hours, and varieties with a chilling requirement of less than 300 hours are defined as extremely low-chilling peach varieties.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] The Chr01-43706671 molecular marker used to identify peach varieties with low chilling requirements, its sequence is shown in SEQ ID NO.4.

[0007] Application of the above-mentioned Chr01-43706671 molecular marker in identifying peach varieties with low chilling requirements.

[0008] And a group of molecular marker Chr01-43706671 primer combinations for identifying peach varieties with low chilling requirements, including forward primers shown in SEQ ID NO.1-2 and a common reverse primer shown in SEQ ID NO.3.

[0009] Preferably, different fluorescent signal labels are added to the 5' ends of the two forward primers.

[0010] Preferably, the fluorescent signal labels are FAM and VIC.

[0011] The invention also discloses the application of the molecular marker Chr01-43706671 primer combination in identifying peach varieties with low chilling requirement.

[0012] Preferably, the steps include:

[0013] (1) Primer synthesis: synthesizing the above-mentioned molecular marker Chr01-43706671 primer combination;

[0014] (2) DNA extraction: extracting the peach genomic DNA to be identified;

[0015] (3) KASP reaction: Using the genomic DNA extracted in step (2) as a template, a KASP reaction was performed using a molecular marker Chr01-43706671 primer combination;

[0016] (4) KASP product detection and analysis: Detect the genotype of the amplified product and select varieties with genotype G:G for subsequent breeding;

[0017] There is no order requirement for steps (1) and (2).

[0018] The present invention also discloses the application of a molecular marker primer combination in identifying peach varieties with low cold requirement, wherein the molecular marker primer combination comprises the above-mentioned molecular marker Chr01-43706671 primer combination and the molecular marker Chr01:46470090 primer combination, wherein the molecular marker Chr01:46470090 primer combination comprises the forward primer shown in SEQ ID NO.7-8 and the reverse primer shown in SEQ ID NO.9.

[0019] Preferably, different fluorescent signal labels are added to the 5' ends of the two forward primers of the molecular marker Chr01:46470090 primer combination.

[0020] The present invention also discloses a kit, comprising the above-mentioned molecular marker Chr01-43706671 primer combination, or comprising the above-mentioned molecular marker Chr01-43706671 primer combination and the molecular marker Chr01:46470090 primer combination.

[0021] The KASP molecular marker and KASP primer of low cold demand peach provided by the present invention have the following advantages: since the peach juvenile period is as long as 3-4 years, the cold demand evaluation must be evaluated for many years after adulthood and the traditional evaluation method is cumbersome, so it is very important to determine the cold demand in the seedling stage. The present invention screens out the Chr01-43706671 molecular marker associated with the cold demand of peach, and uses it to design corresponding identification primers, which can be used to identify the cold demand trait of peach, avoid high cold demand peach, can speed up the breeding process of low cold demand peach, significantly improve breeding efficiency, and especially have a very high success rate of identifying extremely low cold demand peach varieties. Compared with traditional field natural observation, the present invention can quickly identify low cold demand peach. And it is easy to operate, lays the foundation for the directional breeding of low cold demand peach, especially extremely low cold demand peach, speeds up the breeding process, significantly improves the breeding efficiency, and promotes the development of the peach industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Manhattan plot for GWAS analysis of the SNP sites in the present invention.

[0023] Figure 2 It is the comparison result of the gene sequence of the site where the molecular marker in the present invention is located.

[0024] Figure 3 The KASP typing test results of 287 peach samples were obtained by using the KASP primers of the present invention.

[0025] Figure 4 This is the distribution diagram of cooling requirement of different genotypes.

[0026] Figure 5 The first-generation sequencing genotype diagrams of two positive controls are shown in Figure 2. DETAILED DESCRIPTION

[0027] The specific implementation modes of the present invention are further described below in conjunction with the accompanying drawings, but the description of the embodiments does not impose any limitation on the protection scope of the present invention.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by technicians in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0029] Unless otherwise specified, the materials and instruments used in the following examples can be obtained from conventional commercial channels.

[0030] Example 1 Development of KASP Molecular Marker Primers

[0031] First, we identified 213 natural peach populations with rich chilling requirements and conducted phenotypic evaluation of the chilling requirements of the 213 peaches. Then, we conducted GWAS analysis based on resequencing and combined the phenotypes to mine significant SNPs. We successfully located the Chr01-43706671 SNP locus, which was significantly associated with chilling requirements. The Manhattan plot of its GWAS location is shown in the figure below. Figure 1 As shown, the arrow indicates the SNP site, which is located at the 43706671bp position on chromosome 1 of the peach reference genome. The Chr01-43706671 SNP site information is G / T. The sequence of the Chr01-43706671 molecular marker is shown in SEQ ID NO.4, and the K in SEQ ID NO.4 represents G / T. The gene sequence and primer design ideas of the site where the Chr01-43706671 molecular marker is located are shown in Figure 2 As shown. According to the KASP primer design principle, the primers were designed using Primer software. There are two forward primers for Chr01-43706671, named Chr01-43706671-F1 and Chr01-43706671-F2, and the reverse primer is Chr01-43706671-R. The nucleotide sequences of the three primers are shown below:

[0032] The KASP primer sequences are as follows (5'→3'):

[0033] Chr01-43706671-F1 (SEQ ID NO.1): CCATTCTCTGCTTTTTGCTTTATAT;

[0034] Chr01-43706671-F2 (SEQ ID NO.2): CCATTCTCTGCTTTTTGCTTTATAG;

[0035] Chr01-43706671-R (SEQ ID NO. 3): TTTTCTGTTTAAAAACTCCATTCATC.

[0036] To facilitate the distinction of different genotypes, a FAM (GAAGGTGACCAAGTTCATGCT, SEQ ID NO. 5) modification was added to the 5' end of Chr01-43706671-F1, and a VIC (GAAGGTCGGAGTCAACGGATT, SEQ ID NO. 6) modification was added to the 5' end of Chr01-43706671-F2.

[0037] Example 2 Peach Chr01-43706671 molecular marker-related genotyping measurement and analysis

[0038] 287 peaches with rich genetic backgrounds (including cultivars, local varieties and wild resources from China, the United States, Thailand and other countries, and belonging to common peach, Gansu peach, mountain peach and Xinjiang peach germplasm types) were used as test materials to determine the phenotype of the cold requirement trait. There were 39 low cold requirement peaches with a cold requirement of less than 400h, including 22 extremely low cold requirement peaches with a cold requirement of less than 300h, and 248 non-low cold requirement peaches with a cold requirement of ≥400h. DNA of 287 peach materials was extracted using the CTAB method, and the entire batch of DNA samples was diluted to a concentration of 1-9ng / μL in proportion. KASP typing was performed using the KASP primers of the Chr01-43706671 molecular marker developed in Experimental Example 1.

[0039] The above three KASP primers were used for PCR amplification.

[0040] PCR reaction system:

[0041]

[0042] The primer combination was prepared by diluting the primers to 10 μM with TE (pH 8.0) and then mixing them in a ratio of Chr01-43706671-F1-FAM: Chr01-43706671-F2-VIC: Chr01-43706671-R = 1:1:3. In the negative control, 1.25 μl of buffer TE was used to replace the sample DNA; the positive control was selected from peach materials that were subjected to site SNP typing using first-generation sequencing (included in these 287 peach samples, including G:G genotype peach 'Flordaglo' and T:T genotype peach 'Feicheng Baili' (SNP typing diagram see Figure 5 ), and PCR analysis was performed according to the instructions of CFX ConnectTM Real-Time System (Bio-Rad, USA).

[0043] The PCR amplification program was as follows: pre-denaturation at 95°C for 10 min, 1 cycle; denaturation at 95°C for 20 s; annealing and extension at 61-55°C for 60 s, 10 cycles in total; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, 27 cycles in total; reading at 25°C for 30 s, 1 cycle.

[0044] After the PCR reaction is completed, TMSoftware (Bio-Rad, USA) reads the intensity of the fluorescence signal and determines the genotype based on the relative proportion of the FAM and VIC fluorescence signals. Using KASP primers Chr01-43706671, a total of three genotypes were detected, namely G:G, G:T and T:T, as well as the undetermined type. Specifically, if the base G is detected at the site, it is the allele type connected to the FAM fluorescent label sequence. At this time, the FAM fluorescence signal accounts for a high proportion, and the configuration of the peach to be tested is determined to be the homozygous genotype G:G; if the base T is detected, it is the allele type connected to the VIC fluorescent label sequence. The proportion of the VIC fluorescence signal is high, and the configuration of the peach to be tested is determined to be the homozygous genotype T:T; if the bases G and T are detected at the same time, it is an intermediate type that simultaneously connects the FAM fluorescent label sequence and the VIC fluorescent label sequence, and the configuration of the peach to be tested is determined to be the heterozygous genotype G:T; if no signal is detected, it is undetermined.

[0045] The relevant classification results can be found in Figure 3 and Table 1. Figure 3 It can be seen that the genotype is determined by detecting the two fluorescence intensities in the KASP product. Figure 3 Each point in the graph represents a sample of material to be tested. Figure 3 The genotypes represented by the various points in the figure are marked. The blue points represent the homozygous genotype G:G, the red points represent the homozygous genotype T:T, the green points represent the heterozygous genotype G:T, the black square points represent the negative control, and the black cross represents undetermined. Among the 287 samples, 36 strains were of the G:G genotype, 249 strains were of the T:T genotype, 1 strain was of the G:T genotype, and 1 strain was of the undetermined type.

[0046] Table 1 Typing results of 287 peach varieties

[0047]

[0048]

[0049]

[0050]

[0051] The distribution of cooling requirements of different genotypes was statistically analyzed. The results are as follows Figure 4 As shown, from Figure 4It can be seen that the peach with genotype G:G requires 381±199h of cooling; the peach with genotype T:T requires 678±153h of cooling; the peach with genotype G:T requires 556h of cooling, and the undetermined peach requires 591h of cooling. From Table 1, there are 36 peaches with genotype G:G, including 27 peaches with low cooling requirement (cooling requirement <400h) (including 19 peaches with extremely low cooling requirement (cooling requirement <300h)), and 9 peaches with non-low cooling requirement (cooling requirement ≥400h). There are 251 peaches with genotype T:T, including 12 peaches with low cooling requirement (cooling requirement <400h) (including 3 peaches with extremely low cooling requirement (cooling requirement <300h)), and 239 peaches with non-low cooling requirement (cooling requirement ≥400h). There were 1 portion of peaches with genotype G:T and 1 portion of undetermined peaches, both of which were non-low-chilling-requirement peaches (chilling requirement ≥ 400h).

[0052] Table 2 was obtained by analyzing and statistically analyzing the typing data in Table 1. The data in Table 2 clearly demonstrated the identification effect of genotyping based on KASP molecular marker Chr01-43706671 on low cold-requiring peach trees.

[0053] Table 2: The identification effect of Chr01-43706671 molecular marker on low chilling requirement peach

[0054]

[0055] Note: The proportion refers to the proportion of various types of peaches with cold requirements (including low cold requirement peaches (cooling requirement < 400h) and non-low cold requirement peaches (cooling requirement ≥ 400h), among which low cold requirement peaches with cold requirement < 300h are extremely low cold requirement peaches) identified by marking a certain genotype in the total number of peaches identified by marking the genotype, which is equal to the number of cold requirement type peaches identified by marking a certain genotype / the total number of peaches identified by marking the genotype*100%; the identification success rate refers to the success probability of identifying various types of peaches with cold requirements by marking a certain genotype, which is equal to the number of various types of peaches identified by marking a certain genotype / the actual total number of peaches of that cold requirement type*100%.

[0056] As shown in Table 2, among the G:G genotype samples marked by Chr01-43706671, the proportion of low-chilling peaches (chilling requirement <400h) was 75%, and the identification success rate was 69.2%, of which the proportion of extremely low-chilling peaches (chilling requirement <300h) was 52.8%, and the identification success rate of this type of peach was 86.4%; non-low-chilling peaches (chilling requirement ≥400h) accounted for 25%, and the identification success rate was 3.6%. The T:T genotype samples, G:T genotype samples and undetermined samples are most likely to be locked non-low-chilling peaches (chilling requirement ≥400h). Therefore, in summary, the identification effect of the G:G genotype marked by Chr01-43706671 is mainly concentrated on low-chilling peach trees, and this marker is very suitable for auxiliary breeding of low-chilling peaches.

[0057] In addition, the marker Chr01-43706671 is the same as the marker Chr01:46470090 in the patent application (application number: CN2024114286008) of the present inventor (primer sequences are: Chr01:46470090-forward primer 1 AAAATAAATCGTATCGCCGGGCAGT, SEQ ID NO.7; Chr01:46470090-forward primer 2 AAAATAAATCGTATCGCCGGGCAGC, SEQ ID NO.8;

[0058] Chr01:46470090-common reverse primer AAAACACAGAGTATAGCCGGTTGG, SEQ ID NO.9) can be used in combination to further improve the efficiency of identification and selection of peaches with low chilling requirements. When used, in order to facilitate data reading, a FAM (GAAGGTGACCAAGTTCATGCT, SEQ ID NO.5) modification is added to the 5' end of Chr01:46470090-forward primer 1, and a VIC (GAAGGTCGGAGTCAACGGATT, SEQ ID NO.6) modification is added to the 5' end of Chr01:46470090-forward primer 2. Chr01-43706671 and Chr01:46470090 were used simultaneously to screen the peach sample group for low cooling requirement, and finally the sample group was locked in as the union of the G:G genotype marked by Chr01-43706671 and the C:C and T:C genotypes marked by Chr01:46470090. In the locked sample group, the identification success rate of low cooling requirement peaches (cooling requirement <400h) can be as high as 80%, and the proportion of this type of peach can reach 66%. Further, the identification success rate of extremely low cooling requirement peaches with cooling requirement <300h is as high as 100%, and the proportion of this type of peach is 47%, which is close to half; while the proportion of non-low cooling requirement peaches (cooling requirement ≥400h) is only 34%.

[0059] Although the present invention is disclosed as above, the present invention is not limited thereto. Any person skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the scope defined by the claims.

Claims

1. The Chr01-43706671 molecular marker for identifying low-chilling peach varieties is characterized by Its sequence is shown in SEQ ID NO.

4.

2. Application of the Chr01-43706671 molecular marker described in claim 1 in identifying peach varieties with low cold requirement.

3. A set of molecular marker Chr01-43706671 primer combinations for identifying low cold-requiring peach varieties, comprising forward primers shown in SEQ ID NO.1-2 and a common reverse primer shown in SEQ ID NO.

3.

4. The molecular marker Chr01-43706671 primer combination according to claim 2, characterized in that: Different fluorescent signal labels are added to the 5' ends of the two forward primers.

5. The molecular marker Chr01-43706671 primer combination according to claim 4, wherein the fluorescent signal labels are FAM and VIC.

6. Use of the molecular marker Chr01-43706671 primer combination described in any one of claims 3 to 5 in identifying peach varieties with low chilling requirements.

7. The use according to claim 6, characterized in that: The steps include: (1) Primer synthesis: synthesizing the molecular marker Chr01-43706671 primer combination described in any one of claims 3 to 5; (2) DNA extraction: extracting the peach genomic DNA to be identified; (3) KASP reaction: Using the genomic DNA extracted in step (2) as a template, a KASP reaction was performed using a molecular marker Chr01-43706671 primer combination; (4) KASP product detection and analysis: Detect the genotype of the amplified product and select varieties with genotype G:G for subsequent breeding; There is no order requirement for steps (1) and (2).

8. Application of a molecular marker primer combination in identifying peach varieties with low cold requirement, wherein the molecular marker primer combination comprises the molecular marker Chr01-43706671 primer combination described in any one of claims 3-5, and the molecular marker Chr01:46470090 primer combination, wherein the molecular marker Chr01:46470090 primer combination comprises the forward primer shown in SEQ ID NO.7-8 and the reverse primer shown in SEQ ID NO.

9.

9. The use according to claim 8, characterized in that Different fluorescent signal labels were added to the 5' ends of the two forward primers of the molecular marker Chr01:46470090 primer combination.

10. A kit, characterized in that: It comprises the molecular marker Chr01-43706671 primer combination described in any one of claims 3-5, or comprises the molecular marker Chr01-43706671 primer combination described in any one of claims 3-5, and the molecular marker Chr01:46470090 primer combination.

Images