Nanoimprint lithography resin composition

Abstract

The present invention provides an example nanoimprint lithography (NIL) resin composition comprising a total of three monomers, where two of the three monomers are selected from the group consisting of: two different epoxy substituted silsesquioxane monomers; two different kinds of epoxy substituted cyclosiloxane monomers; and two different non-silicone epoxy monomers. The third one of the three monomers is a fluorinated monomer present in an amount ranging from about 0.5 mass% to about 4 mass% based on the total solids content of the NIL resin composition. The NIL resin also includes a photoinitiator and a solvent.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Provisional Application Serial No. 63 / 357,501, filed on June 30, 2022, the contents of which are incorporated herein by reference in their entirety.

[0003] References to sequence listings

[0004] The sequence listing submitted herewith is hereby incorporated by reference in its entirety. The file name is ILI248BPCT_IP-2374-PCT_Sequence_Listing.xml, the file size is 13,697 bytes, and the file creation date is June 17, 2023. Background Art

[0005] Nanoimprint lithography enables the economical and efficient production of nanostructures. Nanoimprint lithography employs direct mechanical deformation of a material through a stamp with nanostructures. The material is cured while the stamp is in place to lock in the shape of the nanostructures in the material. Nanoimprint lithography has been used to make patterned substrates, and in many cases the nanoimprinted material becomes a permanent feature or component of the patterned substrate. Summary of the invention

[0006] Nanoimprint lithography resin disclosed herein includes fluorinated monomer. The fluorinated monomer has limited miscibility with other monomers in the resin composition (e.g., silsesquioxane monomers, cyclosiloxane monomers, or non-silicone epoxy monomers), and therefore when the resin is in a solid state (e.g., when the solvent has been removed after coating), the fluorinated monomer tends to migrate to the surface of the resin. The presence of the fluorinated monomer at the surface of the coated resin reduces its surface energy. Lower surface energy contributes to i) the ability of the resin to replicate the pattern of the imprinting device (e.g., a working stamp, template, or mold) with high fidelity; and ii) the ability of the resin to easily release the imprinting device, thereby avoiding scaling of the imprinting device. Maintaining a clean and unscaled imprinting device should then result in a longer life of the imprinting device.

[0007] The fluorinated monomers are also unexpectedly compatible with polymer hydrogel attachment, primer grafting, clustering, and sequencing. Specifically, the fluorinated monomers are able to bind strongly to polymer hydrogels and withstand multiple sequencing cycles. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] By referring to the following detailed description and accompanying drawings, the features of the examples of the present disclosure will become apparent, wherein like reference numerals correspond to similar but possibly not identical parts. For the sake of brevity, reference numerals or features having previously described functions may or may not be described in conjunction with other drawings in which they appear.

[0009] Figures 1A to 1E is a schematic perspective view of an example of a common depiction method, wherein Figure 1A Describe the base, Figure 1B depicting an example of a NIL resin composition deposited on the substrate and a working stamp for imprinting the NIL resin composition, Figure 1C depicting the printed and cured resin composition, Figure 1D depicting a polymer hydrogel introduced into the recessed portions of the embossed and cured resin composition, and Figure 1E depicting primers grafted to polymer hydrogels;

[0010] Figure 2 It is along Figure 1E A schematic cross-sectional view of the surface of the flow cell taken along line 2-2;

[0011] Figure 3 is a graph depicting the average water contact angle (average WCA) (°, Y axis) of prints generated using Example resin and Comparative Example resin;

[0012] Figure 4 is a graph depicting cycle intensity (referred to as Intensity) (arbitrary units, Y-axis) versus cycle number (X-axis) for one cycle of sequencing-by-synthesis using an example flow cell disclosed herein;

[0013] Figure 5A and Figure 5B The following is an optical microscopic image: Figure 5A ) a tile of the flow cell during a sequencing cycle using blue illumination, and ( Figure 5B ) Figure 5A Zoomed editing of highlighted areas; and

[0014] Fig. 6A and Figure 6B The following is an optical microscopic image: Fig. 6A ) a slice of the flow cell during a sequencing cycle using violet illumination, and ( Figure 6B ) Fig. 6A Zoomed editing of highlighted areas; DETAILED DESCRIPTION

[0015] Using nanoimprint lithography, a resin composition (including polymerizable multifunctional monomers) is deposited on a substrate. The deposited resin composition is patterned with an imprinting device, and the imprinting device is pressed on the resin surface. The resin composition is deformed to fill the imprinting device pattern. When the imprinting device is still in contact with the resin composition, the polymerization of the resin composition is triggered by exposure to light or heat, and the resin is cured. After the resin composition is fully cross-linked so that it can no longer flow, the imprinting device is peeled off from the surface, leaving the imprinted resin surface. When nanoimprinting is successful, the feature of the imprinting device is transferred to the cured resin. In some examples, these feature parts (e.g., recessed portions or grooves) can then be functionalized with surface chemistry, which enables fluorescence-based sequencing, analyte detection, etc.

[0016] In the examples disclosed herein, the resin composition includes a fluorinated monomer that has limited miscibility with other monomers in the resin composition and can therefore be used as a surface additive. In particular, when the resin is in a solid state, the fluorinated monomer tends to migrate to the surface of the resin, which reduces the surface energy of the resin. The lower surface energy contributes to the ability of the resin to i) replicate the imprint device pattern with high fidelity and ii) easily release the imprint device, thereby keeping the imprint device clean.

[0017] definition

[0018] It should be understood that, unless otherwise indicated, the terms used herein will be understood to have their ordinary meanings in the relevant art. Several other terms are used herein. The meanings of these other terms are as follows.

[0019] The singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0020] The terms comprise, include, contain and forms of these terms are synonymous with each other and are intended to be equally broad.

[0021] The terms top, bottom, lower, upper, on, adjacent, etc. are used herein to describe the flow cell and / or the various components of the flow cell. It should be understood that these directional terms are not intended to imply a specific orientation, but are used to specify the relative orientation between components. The use of directional terms should not be interpreted as limiting the examples disclosed herein to any specific orientation.

[0022] The terms first, second, etc. are not intended to imply a particular orientation or order, but are used to distinguish one element from another.

[0023] It should be understood that the ranges provided herein include the specified range and any value or sub-range within the specified range, as if such value or sub-range was explicitly listed. For example, a range of about 400 nm to about 1 μm (1000 nm) should be interpreted as including not only the explicitly listed limits of about 400 nm to about 1 μm, but also individual values, such as about 708 nm, about 945.5 nm, etc., and sub-ranges, such as about 425 nm to about 825 nm, about 550 nm to about 940 nm, etc. In addition, when "about" and / or "substantially" are used to describe values, they are intended to cover minor variations (up to + / - 10%) from the value.

[0024] "Acrylamide" is a functional group with the following structure: wherein each H may alternatively be alkyl, alkylamino, alkylamido, alkylthio, aryl, diol, and optionally substituted variants thereof. Examples of monomers containing acrylamide functional groups include azidoacetamidopentyl acrylamide: And N-isopropylacrylamide: Other acrylamide monomers may be used, some examples of which are described herein.

[0025] As used herein, the term "acrylate" refers to a "CH2=CHCOO-" functional group (i.e., ). Acrylate includes substituted variations thereof (eg, methacrylate is an example of an acrylate).

[0026] As used herein, an "aldehyde" is an organic compound containing a functional group having the structure -CHO, which includes a carbonyl center (i.e., a carbon double-bonded to an oxygen), wherein the carbon atom is also bonded to a hydrogen and an R group, such as an alkyl or other side chain. The general structure of an aldehyde is:

[0027] As used herein, "alkyl" refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., does not contain double bonds and triple bonds). The alkyl group may have 1 to 20 carbon atoms. Typical alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, etc. As an example, the name "C1-C4 alkyl" indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of the following items: methyl, ethyl, propyl, isopropyl, n-butyl, isobutyl, sec-butyl, and tert-butyl. The alkyl group may be substituted or unsubstituted. An example of a substituted alkyl group is a haloalkyl group or an alkyl group substituted with a halogen.

[0028] As used herein, "alkylamino" refers to an alkyl group in which one or more of the hydrogen atoms are replaced by an amino group, wherein the amino group refers to -NR a R b Group, where R aand R b Each is independently selected from C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 carbocycle, C6-C10 aryl, 5-10 membered heteroaryl and 5-10 membered heterocycle.

[0029] As used herein, "alkylamido" refers to an alkyl group in which one or more hydrogen atoms are replaced by a C-amido group or an N-amido group. A "C-amido" group refers to "-C(=O)N(R a R b )" group, wherein R a and R b may be independently selected from alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heterocyclyl, aralkyl or (heteroalicyclic)alkyl. An "N-amido" group refers to "RC(=O)N(R a )-" group, where R and R a The alkyl acyl group may be independently selected from alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, aryl, heteroaryl, heterocyclyl, aralkyl or (heteroalicyclic) alkyl. Any alkyl acylamino group may be substituted or unsubstituted.

[0030] As used herein, "alkylthio" refers to RS-, where R is an alkyl group. The alkylthio group may be substituted or unsubstituted.

[0031] As used herein, "olefin" or "alkenyl" refers to a straight or branched hydrocarbon chain containing one or more double bonds. An alkenyl group can have 2 to 20 carbon atoms. Example alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.

[0032] As used herein, "alkyne" or "alkynyl" refers to a straight or branched hydrocarbon chain containing one or more triple bonds. An alkynyl group can have 2 to 20 carbon atoms.

[0033] An "amine" or "amino" functional group refers to a -NR a R b Group, where R a and R b Each independently selected from hydrogen (e.g. ), C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 carbocyclyl, C6-C10 aryl, 5-10 membered heteroaryl and 5-10 membered heterocyclyl, as defined herein.

[0034] As used herein, "aralkyl" and "aryl(alkyl)" refer to an aryl group attached as a substituent via a lower alkylene group. The lower alkylene and aryl groups of the aralkyl may be substituted or unsubstituted. Examples include, but are not limited to, benzyl, 2-phenylalkyl, 3-phenylalkyl, and naphthylalkyl.

[0035] The term "aryl" refers to an aromatic ring or ring system containing only carbon in the ring backbone (i.e., two or more fused rings sharing two adjacent carbon atoms). When the aryl is a ring system, each ring in the ring system is aromatic. The aryl group may have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl. Any aryl group may be a heteroaryl group having at least one heteroatom (i.e., an element other than carbon (e.g., nitrogen, oxygen, sulfur, etc.)) in the ring backbone.

[0036] As used herein, the term "attachment" refers to the state in which two things are joined, fastened, adhered, connected or bound to each other, directly or indirectly. For example, a nucleic acid strand can be attached to a polymer hydrogel by covalent or non-covalent bonds. Covalent bonds are characterized by sharing electron pairs between atoms. Non-covalent bonds are physical bonds that do not involve sharing electron pairs and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions, and hydrophobic interactions.

[0037] An "azide" or "azido" functional group refers to -N3.

[0038] As used herein, "carbocyclyl" means a non-aromatic cyclic ring or ring system containing only carbon atoms in the main chain of the ring system. When the carbocyclyl is a ring system, two or more rings can be joined together in a fused, bridged or spiro-connected manner. The carbocyclyl can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. Therefore, the carbocyclyl includes cycloalkyl, cycloalkenyl and cycloalkynyl. The carbocyclic group can have 3 to 20 carbon atoms. Examples of carbocyclyl rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl and spiro[4.4]nonanyl. Any carbocyclic ring can be a heterocycle having at least one heteroatom in the main chain of the ring.

[0039] As used herein, "cycloalkyl" refers to a fully saturated (no double or triple bonds) monocyclic or polycyclic hydrocarbon ring system. When composed of two or more rings, these rings can be joined together in a fused manner. The cycloalkyl group can contain 3 to 10 atoms in the ring. In some examples, the cycloalkyl group can contain 3 to 8 atoms in the ring. The cycloalkyl group can be unsubstituted or substituted. Example cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl.

[0040] As used herein, "cycloalkenyl" or "cycloalkene" refers to a carbon ring or ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene.

[0041] As used herein, "cycloalkynyl" or "cycloalkyne" refers to a carbon ring or ring system having at least one triple bond, wherein no ring in the ring system is aromatic. An example is cyclooctyne. Another example is bicyclononyne. Yet another example is dibenzocyclooctyne (DBCO).

[0042] As used herein, the term "deposition" refers to any suitable application technique, which may be manual or automated, and in some cases, results in modification of surface properties. Deposition may be performed using vapor deposition techniques, coating techniques, grafting techniques, and the like. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, thick coating or dip coating, doctor blade coating, whipping dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, and the like.

[0043] As used herein, the term "recess" refers to a discrete concave feature in a patterned resin having a surface opening at least partially surrounded by a gap region of the cured resin. The recess can have any of a variety of shapes at the opening in its surface, including, for example, a circle, an ellipse, a square, a polygon, a star (with any number of vertices), etc. The cross-section of the recess taken orthogonally to the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc. The recess can also have a more complex configuration, such as a ridge, a step feature, etc. The recess is an example of a feature that can be formed using nanoimprint lithography. Another example of such a feature is a groove / groove.

[0044] When used in reference to a collection of items, the term "each" is intended to identify a single item in the collection, but does not necessarily refer to every item in the collection. Exceptions may occur if explicitly disclosed or the context clearly dictates otherwise.

[0045] As used herein, the term "epoxy" refers to

[0046] As used herein, the term "flow cell" is intended to mean a container having a flow channel in which a reaction can be performed, an inlet for delivering reagents to the flow channel, and an outlet for removing reagents from the flow channel. In some examples, the flow cell enables detection of reactions occurring in the flow cell. For example, the flow cell may include one or more transparent surfaces that allow optical detection of arrays, optically labeled molecules, etc. within the flow channel.

[0047] As used herein, a "flow channel" or "channel" may be a region defined between two bonded components that can selectively receive a liquid sample. In examples disclosed herein, a flow channel may be defined between a patterned substrate and a cover, and thus may be in fluid communication with one or more recesses defined in the patterned substrate or resin. A flow channel may also be defined between two patterned substrate surfaces bonded together.

[0048] As used herein, "heteroalicyclic" or "heteroalicyclic" refers to a three-, four-, five-, six-, seven-, eight-, nine-, ten-, up to 18-membered monocyclic, bicyclic and tricyclic ring system, wherein carbon atoms together with 1 to 5 heteroatoms constitute the ring system. The heteroalicyclic ring system may optionally contain one or more unsaturated bonds, and the position of these unsaturated bonds is such that a completely delocalized π-electron system does not appear in all rings. The heteroatoms are independently selected from oxygen, sulfur and nitrogen. The heteroalicyclic ring system may also contain one or more carbonyl or thiocarbonyl functional groups so that the definition includes oxo systems and thio systems, such as lactams, lactones, cyclic imides, cyclic thioimides and cyclic carbamates. These rings can be joined together in a fused manner. In addition, any nitrogen in the heteroalicyclic can be quaternized. The heteroalicyclic or heteroalicyclic group can be unsubstituted or substituted. Examples of such "heteroalicyclic" or "heteroalicyclic" groups include 1,3-dioxine, 1,3-dioxane, 1,4-dioxane, 1,2-dioxolane, 1,3-dioxolane, 1,4-dioxolane, 1,3-oxathiolane, 1,4-oxathiin, 1,3-oxathiolane, 1,3-dithiolane, 1,3-dithiolane, 1,4-oxathiin, tetrahydro-1,4-thiazine, 2H-1,2-oxazine, maleimide, succinimide, barbituric acid, thiobarbituric acid, dioxopiperazine, hydantoin, dihydrouracil, trioxane, hexahydro-1,3,5-triazine, imidazoline, imidazolidine, isoxazoline, isoxazolidine, oxazoline, oxazolidine, oxazolidinone, thiazoline, thiazolidine, morpholine, ethylene oxide, piperidine N-oxide, piperidine, piperazine, pyrrolidine, pyrrolidone, pyrrolidione, 4-piperidone, pyrazoline, pyrazolidine, 2-oxopyrrolidine, tetrahydropyran, 4H-pyran, tetrahydrothiopyran, thiomorpholine, thiomorpholine sulfoxide, thiomorpholine sulfone, and benzo-fused analogs thereof (e.g., benzimidazolinone, tetrahydroquinoline, 3,4-methylenedioxyphenyl).

[0049] "(Heteroalicyclic)alkyl" refers to a heterocyclic or heteroalicyclic group attached as a substituent via a lower alkylene group. The lower alkylene and heterocyclic or heterocyclic rings of the (heteroalicyclic)alkyl may be substituted or unsubstituted. Examples include, but are not limited to, (tetrahydro-2H-pyran-4-yl)methyl, (piperidin-4-yl)ethyl, (piperidin-4-yl)propyl, (tetrahydro-2H-thiopyran-4-yl)methyl, and (1,3-thiazin-4-yl)methyl.

[0050] As used herein, "heteroaryl" refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent atoms) containing one or more heteroatoms (i.e., elements other than carbon, including but not limited to nitrogen (N), oxygen (O), and sulfur (S)) in the ring backbone. When heteroaryl is a ring system, each ring in the ring system is aromatic. A heteroaryl group may have 5-18 ring members.

[0051] As used herein, "heterocycle" means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. The heterocycles can be joined together in a fused, bridged or spiro manner. The heterocycle can have any degree of saturation, provided that at least one ring in the ring system is not aromatic. In the ring system, heteroatoms can be present in non-aromatic rings or aromatic rings. The heterocyclic group can have 3 to 20 ring members (i.e., the number of atoms constituting the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom is O, N or S.

[0052] As used herein, the term "hydrazine" or "hydrazine" refers to a -NHNH2 group.

[0053] As used herein, the term "hydrazone" or "hydrazine" refers to Group, where R a and R b Each is independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocyclyl, C6-10 aryl, 5-10 membered heteroaryl and 5-10 membered heterocyclyl, as defined herein.

[0054] As used herein, "hydroxy" refers to an -OH group.

[0055] As used herein, an "initiator" is a molecule that undergoes a reaction upon absorption of radiation or heat or upon exposure to free radicals to produce a reactive species. An initiator is capable of initiating or catalyzing a chemical reaction that results in a change in the solubility and / or physical properties of a formulation. A "cationic initiator" or "photoacid generator" (PAG) is a molecule that becomes acidic upon exposure to radiation or free radicals. PAGs typically undergo irreversible proton photodissociation. A "free radical initiator" is a molecule that generates free radical species upon exposure to radiation or heat and promotes free radical reactions.

[0056] As used herein, the term "gap region" refers to a region of a separated recess or other feature on a surface (e.g., of a cured patterned resin). For example, a gap region may separate one feature of an array from another feature of an array. Two features separated from each other may be discrete, i.e., lack physical contact with each other. In another example, a gap region may separate a first portion of a feature from a second portion of a feature. In many examples, the gap region is continuous, and the feature is discrete, for example, as in the case of a plurality of recesses defined in an otherwise continuous surface. In other examples, the gap region and the feature are discrete, for example, as in the case of a plurality of grooves separated by corresponding gap regions. The separation provided by the gap region may be partial separation or complete separation. The gap region may have a surface material different from the surface material of the feature. For example, the feature of the array may have a polymer hydrogel and a primer in an amount or concentration exceeding the amount or concentration present at the gap region. In some examples, the polymer hydrogel and the primer may not be present at the gap region.

[0057] As used herein, the phrase "limited miscibility" means that the fluorinated monomer and the other monomer are not well mixed in at least some proportions. Limited miscibility can be assessed qualitatively. For example, R-ray photoelectron spectroscopy (XPS), energy dispersive spectroscopy (EDS), or time-of-flight secondary ion mass spectrometry (TOF-SIMS) can be used to assess the accumulation of the fluorinated compound at different depths of the coating. The more pronounced the accumulation, the more limited the miscibility.

[0058] As used herein, "nitrile oxide" means "R a C≡N + O - " group, where R a is defined herein. Examples of the preparation of nitrile oxides include in situ generation from aldoximes by treatment with chloroamide-T or by the action of a base on an imidic chloride [RC(Cl)=NOH] or by reaction between hydroxylamine and an aldehyde.

[0059] As used herein, "nitrone" means A group, wherein R1, R2 and R3 may be R as defined herein a and R b Any one of the groups.

[0060] As used herein, "nucleotide" includes a nitrogenous heterocyclic base, a sugar, and one or more phosphate groups. Nucleotide is the monomer unit of a nucleic acid sequence. In RNA (ribonucleic acid), the sugar is ribose, and in DNA (deoxyribonucleic acid), the sugar is deoxyribose, i.e., a sugar lacking a hydroxyl group present at the 2' position in the ribose. The nitrogenous heterocyclic base (i.e., a nucleobase) may be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G) and their modified derivatives or analogs. Pyrimidine bases include cytosine (C), thymine (T) and uracil (U) and their modified derivatives or analogs. The C-1 atom of deoxyribose is bonded to the N-1 of pyrimidine or the N-9 of purine. Nucleic acid analogs may have any of a modified phosphate backbone, sugar, or nucleobase. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acids (PNA).

[0061] As used herein, "primer" is defined as a single-stranded nucleic acid sequence (e.g., single-stranded DNA). Some primers that may be referred to as amplification primers are used as the starting point for template amplification and cluster generation. The 5' ends of these primers may be modified to allow coupling reactions with the functional groups of the polymer hydrogel. Other primers that may be referred to as sequencing primers are used as the starting point for DNA synthesis. The primer length may be any number of base lengths and may include a variety of non-natural nucleotides. In one example, a sequencing primer is a short chain ranging from 10 to 60 bases, or 20 to 40 bases.

[0062] The term "resin composition" refers to any monomer mixture as described herein. The resin composition may further comprise one or more initiators as defined herein and a solvent.

[0063] As used herein, "spacer layer" refers to a material that bonds two components together. In some examples, the spacer layer can be a radiation absorbing material that facilitates bonding, or can be in contact with a radiation absorbing material that facilitates bonding. The spacer layer can be present in a bonding area, for example, an area on a substrate that will be bonded to another material, which can be a spacer layer, a cover, another substrate, etc., or a combination thereof (e.g., a spacer layer and a cover), as examples. The bond formed at the bonding area can be a chemical bond (as described above) or a mechanical bond (e.g., using fasteners, etc.).

[0064] A "thiol" functional group refers to -SH.

[0065] As used herein, the terms "tetrazine" and "tetrazinyl" refer to a six-membered heteroaryl group containing four nitrogen atoms. The tetrazine may be optionally substituted.

[0066] As used herein, "tetrazole" refers to a five-membered heterocyclic group containing four nitrogen atoms. Tetrazole may be optionally substituted.

[0067] The term "UV-curable" means that polymerization or polymerization and cross-linking of the resin composition is initiated by exposure to ultraviolet light (ie, radiation having a wavelength ranging from about 280 nm to about 400 nm).

[0068] Resin composition

[0069] The nanoimprint lithography (NIL) resin composition disclosed herein comprises a total of three monomers, wherein: two of the three monomers are selected from the group consisting of: two different epoxy-substituted silsesquioxane monomers; two different epoxy-substituted cyclosiloxane monomers; and two different non-silicone epoxy monomers; and the third of the three monomers is a fluorinated monomer, which is present in an amount ranging from about 0.5 mass % to about 4 mass % based on the total solid content of the NIL resin composition; a photoinitiator; and a solvent.

[0070] Each NIL resin composition in the NIL resin composition disclosed herein comprises a total of three monomers. The so-called "a total of three monomers" means that the monomers in the resin composition are composed of two different epoxy-substituted silsesquioxane monomers or two different epoxy-substituted cyclosiloxane monomers or two different non-silicone epoxy monomers and fluorinated monomers. Fluorinated monomers are a class of fluorinated organic monomers, and it should be understood that any single fluorinated monomer or any combination of fluorinated monomers can constitute the third monomer in the three monomers. The NIL resin does not contain monomers other than the two different epoxy-substituted silsesquioxane monomers or the two different epoxy-substituted cyclosiloxane monomers or two different non-silicone epoxy monomers and fluorinated monomers.

[0071] In one example of a NIL resin composition, two different epoxy-substituted polyhedral oligomeric silsesquioxane monomers are used. As used herein, the term "polyhedral oligomeric silsesquioxane" refers to a hybrid intermediate (e.g., RSiO) between silicon dioxide (SiO2) and organosilicon (R2SiO2). 1.5 ) chemical composition. Some polyhedral oligomeric silsesquioxanes can be Commercially available from Hybrid Plastics. Examples of polyhedral oligomeric silsesquioxanes may be as described in Kehagias et al., Microelectronic Engineering, Vol. 86 (2009), pp. 776-778, which is incorporated by reference in its entirety. In the examples disclosed herein, the composition is of the formula [RSiO 3 / 2 ] nThe organosilicon compound of the present invention is characterized in that the R groups can be the same or different, as long as one of the R groups is an epoxy group. Other example R groups include azide / azide, thiol, poly (ethylene glycol), norbornene, tetrazine, acrylate and / or methacrylate, or other alkyl, aryl, alkoxy and / or haloalkyl groups.

[0072] In an example, the two monomers of the three monomers are the two different epoxy-substituted silsesquioxane monomers; and the two different epoxy-substituted silsesquioxane monomers consist of: epoxycyclohexylethyl polysilsesquioxane:

[0073]

[0074] and glycidyl polysilsesquioxane

[0075]

[0076] The two different epoxy-substituted silsesquioxane monomers may be present in a mass ratio ranging from about 3:7 to about 7:3. In a specific example, the mass ratio of epoxycyclohexylethyl polysilsesquioxane to glycidyl polysilsesquioxane is 1.5:1.

[0077] In another example of a NIL resin composition, two different epoxy-substituted cyclosiloxane monomers are used. As used herein, the term "epoxy-substituted cyclosiloxane" refers to a monomer having three or more silicon and oxygen repeating units in a closed ring or ring, wherein the ring is functionalized with an epoxy-containing functional group. Within the ring, the Si:O ratio is 1:1.

[0078] In a specific example, two of the three monomers are two different epoxy-substituted cyclosiloxane monomers; and the two different epoxy-substituted cyclosiloxane monomers consist of: Epoxycyclohexyltetramethylcyclotetrasiloxane:

[0079]

[0080] And glycidyl cyclotetrasiloxane: Where R is: The two different epoxy-substituted cyclosiloxane monomers may be present in a mass ratio ranging from about 3:7 to about 7:3. In a specific example, the mass ratio of epoxycyclohexyltetramethylcyclotetrasiloxane to glycidylcyclotetrasiloxane is 1.5:1.

[0081] In yet another example of a NIL resin composition, two different non-silicone epoxy monomers are used. The non-silicone epoxy monomer is an epoxy monomer that does not contain an O-Si-O bond.

[0082] In a specific example, two of the three monomers are two different non-silicone epoxy monomers; and the two different non-silicone epoxy monomers are independently selected from the group consisting of:

[0083] i) Trimethylolpropane triglycidyl ether:

[0084] ii) 3,4-Epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate:

[0085]

[0086] iii) Bis((3,4-epoxycyclohexyl)methyl)adipate:

[0087]

[0088] iv) 4-vinyl-1-cyclohexene 1,2-epoxide:

[0089] v) Vinylcyclohexene dioxide:

[0090] vi) 4,5-Epoxytetrahydrophthalic acid diglycidyl ester:

[0091]

[0092] vii) 1,2-Epoxyhexadecane:

[0093] viii) Poly(ethylene glycol) diglycidyl ether: (where n ranges from 1 to 100);

[0094] ix) Pentaerythritol glycidyl ether:

[0095] x) 1,2-cyclohexanedicarboxylic acid diglycidyl ester:

[0096] xi) Diglycidyl Tetrahydrophthalate:

[0097] xii) 1,2-Epoxy-3-phenoxypropane: as well as

[0098] xiii) Glycidyl methacrylate: In one example, the two different non-silicone epoxy monomers are trimethylolpropane triglycidyl ether and 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate. The two different non-silicone epoxy monomers may be present in a mass ratio ranging from about 4:1 to about 1:4. In a specific example, the mass ratio of the first non-silicone epoxy monomer to the second non-silicone epoxy monomer is 1:1.

[0099] In any NIL resin composition in the NIL resin composition, the total amount of two different epoxy-substituted silsesquioxane monomers or two different epoxy-substituted cyclosiloxane monomers or two different non-silicone epoxy monomers is based on the total solids in the resin composition, ranging from about 61 mass % to less than 100 mass %. The total amount of the two different monomers depends on other solids present in the NIL resin composition, such as fluorinated monomers and initiators. In one example, the two different monomers together account for about 67 mass % to about 90 mass % of the total solids in the resin composition.

[0100] The third monomer in the three monomers is a fluorinated monomer. Any fluorinated organic monomer with limited miscibility with the monomer containing epoxy group can be used. As mentioned above, when the resin combination is in the solid state, limited miscibility contributes to the migration of the fluorinated monomer to the surface of the resin combination, which reduces the surface energy of the cured resin combination. In addition, some fluorinated monomers in the fluorinated monomer have reactive groups (e.g., epoxy groups) that polymerize when exposed to ultraviolet (UV) light. Therefore, in addition to being able to migrate to the surface of the resin combination, the reactive groups of the fluorinated monomer can also react with each other on the surface of the resin combination or near the surface or react with the reactive groups of other monomers. The ability of the fluorinated monomer to participate in polymerization and crosslinking improves the robustness of the cured resin combination.

[0101] The fluorinated monomer is selected from the group consisting of: 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl)bis(ethylene oxide): Glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether: Glycidyl 2,2,3,3-tetrafluoropropyl ether: (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl)ethylene oxide (2,2,3,3,4,4,5,5,6,6,7,7,7-tridecafluoroheptyl)ethylene oxide: 2,2,3,3,4,4,5,5,6,7,7,7-dodecafluoro-6-(trifluoromethyl)heptyl]oxirane: 2,2,3,3,4,4,5,5,6,6,7,7,8,9,9,9-hexafluoro-8-(trifluoromethyl)nonyl]ethylene oxide: (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-Henonefluoroundecyl)ethylene oxide: and their combinations.

[0102] Regardless of whether one fluorinated monomer or a combination of fluorinated monomers is selected as the third monomer, the total amount of the fluorinated monomers is in the range of about 0.5 mass % to about 4 mass % based on the total solid content of the NIL resin composition. In one example, the total amount of the fluorinated monomers is about 1.6 mass % based on the total solid content of the NIL resin composition.

[0103] The NIL resin composition further comprises a photoinitiator. The photoinitiator is selected from the group consisting of free radical photoinitiators, cationic photoinitiators, and combinations thereof. Examples of the free radical initiator are selected from the group consisting of 1,1,2,2-tetraphenyl-1,2-ethylene glycol: Ethyl pyruvate: 4-Cyano-4-(phenylthiocarbonylthio)pentanoic acid: Ethyl-3-methyl-2-oxobutyrate: And combinations thereof. The cationic initiator is exemplified by the group consisting of: bis-(4-methylphenyl)iodonium hexafluorophosphate: Bis[4-(tert-butyl)phenyl]iodonium tetrakis(nonafluorotert-butoxy)aluminate: Tris(4-((4-acetylphenyl)thio)phenyl)sulfonium

[0104]

[0105] Tetrakis(perfluorophenyl)borate (PAG 290):

[0106] Where R is and their combinations.

[0107] In the example of a NIL resin composition, the photoinitiator (or each photoinitiator if a combination is used) is present in an amount ranging from about 1 mass % to about 26 mass % based on the total solids content of the resin composition.

[0108] When using a combination of a free radical initiator and a cationic initiator, the free radical generated by the free radical initiator reacts with the cationic initiator / photoacid generator, which decomposes to generate a superacid, which in turn initiates polymerization and crosslinking of monomers containing epoxy groups. An example combination of a free radical initiator and a cationic initiator includes ethyl pyruvate and bis-(4-methylphenyl) iodonium hexafluorophosphate. In this specific example, the amount of ethyl pyruvate ranges from about 1 mass % to about 5 mass %, and the amount of bis-(4-methylphenyl) iodonium hexafluorophosphate ranges from about 3 mass % to about 7 mass %.

[0109] In some examples, a combination of different cationic initiators is used. In these examples, it is believed that one or both of the cationic initiators behave as both a superacid generator and a free radical initiator. An example combination of cationic initiators includes bis-(4-methylphenyl)iodonium hexafluorophosphate and PAG 290. In this specific example, the amount of bis-(4-methylphenyl)iodonium hexafluorophosphate ranges from about 3 mass % to about 7 mass %, and the amount of PAG 290 ranges from about 1 mass % to about 2 mass %.

[0110] Any example of the NIL resin composition disclosed herein may also include a solvent. A solvent may be added to the NIL resin composition to achieve the desired viscosity of the deposition technique for applying the resin composition. Examples of suitable solvents include propylene glycol monomethyl ether acetate (PGMEA), toluene, dimethyl sulfoxide (DMSO), tetrahydrofuran (THF), etc. In some examples, the solvent is PGMEA.

[0111] Once the solvent is added, the total solids concentration of the NIL resin composition can range from about 15% to about 60% by mass (based on the total mass of the resin composition), and the amount of solvent can range from about 40% to about 85% by mass (based on the mass of the resin composition). The upper limit of the total solids can be higher, depending on the respective solubility of the solid components in the selected solvent. In some examples, the solids content is about 30% or less.

[0112] The NIL resin composition is UV curable. In one example, a 365 nm UV light source can be used to cure the NIL resin composition.

[0113] In order to generate NIL resin, various components can be mixed together in any desired order. An example of a method for preparing any example of the NIL resin composition disclosed herein includes mixing monomers (i.e., two different epoxy silsesquioxane monomers, or two different epoxy cyclosiloxane monomers, or two different non-silicone epoxy monomers and fluorinated monomers); adding an initiator to the monomer mixture; and dissolving the mixture with a solvent. Another example of a method for preparing any example of the NIL resin composition disclosed herein includes mixing monomers (i.e., two different epoxy silsesquioxane monomers, or two different epoxy cyclosiloxane monomers, or two different non-silicone epoxy monomers, fluorinated monomers) and an initiator to generate a mixture; and dissolving the mixture with a solvent. Still another example of a method for preparing any example of the NIL resin composition disclosed herein includes mixing a fluorinated monomer and an initiator to generate a mixture; adding other monomers (i.e., two different epoxy silsesquioxane monomers, or two different epoxy cyclosiloxane monomers, or two different non-silicone epoxy monomers) to the mixture; and dissolving the mixture with a solvent.

[0114] Flow Cells and Methods

[0115] Any example of the NIL resin composition disclosed herein can be used to form a flow cell. The NIL resin composition can be patterned using nanoimprint lithography to generate features of the flow cell. Figures 1A to 1C An example of a patterning method is schematically shown in FIG. Figure 2 The method includes a substrate and a cured patterned resin on the substrate, the cured patterned resin including recessed portions separated by gap regions, and the cured patterned resin includes a cured form of the NIL resin composition disclosed herein. In other words, the cured patterned resin is formed from an example of the NIL resin composition disclosed herein. Some examples of the method also include functionalizing the recessed portions for specific applications such as sequencing. Figure 1D and Figure 1E An example of functionalization of a recessed portion is shown in .

[0116] Figure 1A A substrate 12 is depicted, and Figure 1B An example of a NIL resin composition 10 deposited on a substrate 12 is depicted.

[0117] Examples of suitable substrates 12 include epoxysiloxanes, glass, modified or functionalized glass (e.g., silanized glass), plastics (including acrylic, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, polytetrafluoroethylene (such as available from Chemours), ), cycloolefins / cycloolefin polymers (COP) (such as those available from Zeon ), polyimide, etc.), nylon (polyamide), ceramic / ceramic oxides, silicon dioxide, fused silicon dioxide or silicon dioxide-based materials, aluminum silicate, silicon and modified silicon (e.g., boron-doped p+ silicon, silanized silicon), silicon nitride (Si3N4), silicon oxide (SiO2), tantalum pentoxide (Ta2O5) or other tantalum oxides (TaO x ), hafnium oxide (HfO2), carbon, metal, inorganic glass, etc. The substrate 12 may also be glass or silicon with a coating of tantalum oxide or another ceramic oxide at the surface.

[0118] Some examples of substrate 12 may have a surface-bound silane attached to the substrate that may react with the resin composition components to attach the cured resin composition 20 to the substrate 12. An example of an epoxy adhesion promoter is a norbornene silane, such as [(5-bicyclo[2.2.1]hept-2-enyl)ethyl]trimethoxysilane.

[0119] In an example, substrate 12 may be a circular sheet, panel, wafer, die, etc., having a diameter ranging from about 2 mm to about 300 mm (e.g., about 200 mm to about 300 mm), or may be a rectangular sheet, panel, wafer, die, etc. having a maximum dimension of up to about 10 feet (about 3 meters). As an example, the width of the die may range from about 0.1 mm to about 10 mm. Although example dimensions have been provided, it should be understood that substrate 12 may have any suitable dimensions.

[0120] The NIL resin composition 10 can be any of the examples described herein. The NIL resin composition 10 can be deposited on the substrate 12 using any suitable application technique that can be manual or automated. As an example, the deposition of the NIL resin composition 10 can be performed using vapor deposition techniques, coating techniques, grafting techniques, etc. Some specific examples include chemical vapor deposition (CVD), spraying (e.g., ultrasonic spraying), spin coating, thick coating or dip coating, doctor blade coating, whipping distribution, aerosol printing, screen printing, micro-contact printing, inkjet printing, etc. In one example, spin coating is used.

[0121] The deposited NIL resin composition 10 is then patterned using any suitable patterning technique. Figure 1BIn the example shown, nanoimprint lithography is used to pattern the NIL resin composition 10. After depositing the NIL resin composition 10, the NIL resin composition may be soft-baked to remove excess solvent and / or improve the adhesion of the resin composition / substrate. When performed, the soft bake may be performed after depositing the NIL resin composition 10 and before positioning the working stamp 14 in the NIL resin composition, and at a relatively low temperature in the range of about 50°C to about 150°C for greater than 0 seconds to about 3 minutes. In one example, the soft bake time is in the range of about 30 seconds to about 2.5 minutes.

[0122] like Figure 1B As shown, a nanoimprint lithography imprinting device 14 (e.g., a mold or working stamp) is pressed or rolled against a layer of a NIL resin composition 10 to produce an imprint on the NIL resin composition 10. The imprinting device 14 includes a template of a desired pattern to be transferred to the NIL resin composition 10. Thus, the resin composition 10 is recessed or perforated by a protrusion 16 of the working stamp 14. The protrusion 16 is a negative replica of a recess or other feature to be formed in the NIL resin composition 10. The NIL resin composition 10 can then be cured with the working stamp 14 in place.

[0123] For the NIL resin composition 10 disclosed herein, curing can be achieved by exposing the deposited NIL resin composition 10 of the nanoimprint to incident light of a suitable energy dose (e.g., in the range of about 0.5 J to about 10 J) for 60 seconds or less. The incident light can be actinic radiation, such as ultraviolet (UV) radiation. In one example, most of the emitted UV radiation can have a wavelength of about 365 nm. More specifically, a 365 nm ultraviolet (UV) light source can be used for curing; and the deposited NIL resin composition 10 is exposed to UV light for a time in the range of about 3 seconds to about 30 seconds. In this example, the 365 nm UV light source can be a 330 mW / cm 2 Power output (measured at sample level) of a light emitting diode (LED).

[0124] In the examples disclosed herein, light energy exposure initiates polymerization and crosslinking of the monomers in the resin composition 10. In the case of an effective degree of curing of the NIL resin composition 10 described herein, the incident light exposure time may be 60 seconds or less. In some cases, the incident light exposure time may be 30 seconds or less. In other cases, the incident light exposure time may be about 20 seconds. The curing process may include a single UV exposure stage or a single heating event.

[0125] After curing, the imprint device 14 may be removed. After releasing the imprint device 14, topographical features, such as recessed portions 18, are defined in the cured resin composition 10'. Figure 1C As shown, the resin composition 10 having the recessed portion 18 defined therein is referred to as a cured patterned resin 10 ′.

[0126] Due at least in part to the effective photopolymerization of the resin composition 10 disclosed herein, the method disclosed herein may not involve a post-curing hard baking step in order to obtain a well-cured film. In some cases, it may be desirable to perform a post-curing hard bake. It should be understood that the working stamp 14 is peeled off / separated before hard baking (if performed), for example, so that the working stamp 14 will not adhere to the cured patterned resin composition 10'. The duration of the hard bake can last from about 5 seconds to about 10 minutes in a temperature range of about 100°C to about 300°C. For example, a hard bake can be performed to remove residual solvents from the cured patterned resin composition 10' to further polymerize some resin composition materials (and thus increase the degree of cure), improve adhesion and / or mechanical properties, and / or further reduce autofluorescence. Any heating device described herein can be used for hard baking.

[0127] The chemical composition of the cured patterning resin 10 ′ depends on the NIL resin composition 10 used.

[0128] like Figure 1C As shown, the cured patterned resin 10' includes recessed portions 18 defined therein and gap regions 20 separating adjacent recessed portions 18. In the examples disclosed herein, the recessed portions 18 are formed using a polymer hydrogel 22 ( Figure 1D and Figure 1E ) and primers 24, 26 ( Figure 1E and Figure 2 ) is functionalized, and portions of the gap regions 20 are available for bonding, but will not have the polymer hydrogel 22 or primers 24, 26 thereon.

[0129] Many different layouts of the recesses 18 are contemplated, including regular, repeating, and irregular patterns. In an example, the recesses 18 are arranged in a hexagonal grid to achieve close packing and improved density. Other layouts may include, for example, rectangular layouts (e.g., line grooves or trenches), triangular layouts, etc. In some examples, the layout or pattern may be an xy format of recesses 18 in rows and columns. In some other examples, the layout or pattern may be a repeated arrangement of recesses 18 and / or gap areas 20. In still other examples, the layout or pattern may be a random arrangement of recesses 18 and / or gap areas 20. The pattern may include stripes, swirls, lines, triangles, rectangles, circles, arcs, plaids, lattices, diagonal lines, arrows, squares, and / or cross-hatching. In one example, as Figure 1CAs shown, the recesses 18 are holes arranged in rows and columns.

[0130] The layout or pattern of the recesses 18 can be characterized with respect to the density of the recesses 18 (ie, the number of recesses 18) in a defined area. For example, the recesses 18 can be approximately 2 million / mm 2 The density can be adjusted to different densities, including, for example, at least about 100 / mm 2 , about 1,000 pieces / mm 2 , about 100,000 / mm 2 , about 1 million pieces / mm 2 , about 2 million pieces / mm 2 , about 5 million pieces / mm 2 , about 10 million / mm 2 , about 50 million / mm 2 or greater or lesser density. It should also be understood that the density of the recesses 18 in the cured patterned resin 10' may be between a value selected from the lower limit value and a value selected from the upper limit value of the above range. As an example, a high-density array may be characterized as having recesses 18 separated by less than about 100 nm, a medium-density array may be characterized as having recesses 18 separated by about 400 nm to about 1 μm, and a low-density array may be characterized as having recesses 18 separated by more than about 1 μm. Although example densities have been provided, it should be understood that a substrate having any suitable density may be used.

[0131] The layout or pattern of the recessed portion 18 may also be characterized according to or alternatively according to the average pitch from the center of the recessed portion 18 to the center of the adjacent recessed portion 18, i.e., the spacing (center-to-center spacing) or the average pitch from the right edge of one recessed portion 18 to the left edge of the adjacent recessed portion 18, i.e., the spacing (edge-to-edge spacing). The pattern may be regular so that the coefficient of variation around the average pitch is small, or the pattern may be irregular, in which case the coefficient of variation may be relatively large. In either case, the average pitch may be, for example, at least about 10 nm, about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 5 μm, about 10 μm, about 100 μm, or greater or less. The average pitch of a particular pattern of the recessed portion 18 may be between a value selected from the lower limit value and a value selected from the upper limit value of the above range. In the example, the recessed portion 18 has a pitch of about 1.5 μm (center-to-center spacing). Although example average pitch values ​​have been provided, it should be understood that other average pitch values ​​may be used.

[0132] The size of each recess 18 may be characterized by its volume, open area, depth, and / or diameter or length and width.

[0133] Each recess 18 can have any volume capable of confining a fluid. The minimum or maximum volume can be selected, for example, to accommodate the desired throughput (e.g., multiplexing), resolution, nucleotide or analyte reactivity for downstream use of the flow cell. For example, the volume can be at least about 1×10 -3 μm 3 , about 1×10 -2 μm 3 , about 0.1μm 3 , about 1μm 3 , about 10μm 3 , about 100μm 3 It should be understood that the polymer hydrogel 22 can fill all or part of the volume of the recessed portion 18.

[0134] The area occupied by each recess opening can be selected based on criteria similar to those set forth above for pore volume. For example, the area of ​​each recess opening can be at least about 1×10 -3 μm 2 , about 1×10 -2 μm 2 , about 0.1μm 2 , about 1μm 2 , about 10μm 2 , about 100μm 2 The area occupied by each recess opening may be greater than, less than, or in between the values ​​specified above.

[0135] The depth of each recess 18 can be large enough to accommodate a portion of the polymer hydrogel 22. In one example, the depth can be about 0.1 μm, about 0.5 μm, about 1 μm, about 10 μm, about 100 μm, or more or less. In some examples, the depth is about 0.4 μm. The depth of each recess 18 can be greater than, less than, or between the values ​​specified above.

[0136] In some cases, the diameter or length and width of each recess 18 may be about 50 nm, about 0.1 μm, about 0.5 μm, about 1 μm, about 10 μm, about 100 μm, or more or less. The diameter or length and width of each recess 18 may be greater than, less than, or between the values ​​specified above.

[0137] After the resin composition 10 is patterned and cured, the cured patterned resin 10 ′ may be processed to prepare a surface for application of the polymer hydrogel 22 .

[0138] In one example, the cured patterned resin 10' can be exposed to a silanization reaction that attaches silane or a silane derivative to the cured patterned resin 10'. Silanization introduces the silane or silane derivative throughout the surface, including in the recesses 18 (e.g., on the bottom surface and along the sidewalls) and on the gap regions 20.

[0139] Silanization can be achieved using any silane or silane derivative. The choice of silane or silane derivative may depend in part on the polymer to be used to form the polymer hydrogel 22 (e.g. Figure 2 ) as it may be desirable to form a covalent bond between the silane or silane derivative and the polymer hydrogel 22. The method for attaching the silane or silane derivative to the cured patterned resin 10' may vary depending on the silane or silane derivative used. Several examples are described herein.

[0140] Examples of suitable silanization methods include vapor deposition, spin coating, or other deposition methods.Some examples of methods and materials that can be used to silanize the cured patterned resin 10' are described herein, but it should be understood that other methods and materials can be used.

[0141] The attachment of silane or silane derivatives forms a pre-treated (eg, silanized) cured patterned resin 10 ′ that includes silanized recessed portions and silanized interstitial regions.

[0142] In other examples, the cured patterned resin 10' may not be exposed to silanization. Instead, the cured patterned resin 10' may be exposed to plasma ashing, and then the polymer hydrogel 22 may be directly spin-coated (or otherwise deposited) on the plasma-ashed cured patterned resin 10'. In this example, the plasma ashing may produce a surfactant (e.g., hydroxyl (C-OH or Si-OH) and / or carboxyl groups) that may adhere the polymer hydrogel 22 to the cured patterned resin 10'. In these examples, the polymer hydrogel 22 is selected so that it reacts with the surface groups produced by the plasma ashing.

[0143] In yet other examples, the cured patterned resin 10' may contain unreacted epoxy groups; and therefore may not be exposed to silanization because the unreacted epoxy groups may react directly with the amino functional groups of the polymer hydrogel 22. In this example, for example, if it is desired to clean the surface of potential contaminants, plasma ashing may be performed.

[0144] The polymer hydrogel 22 may then be applied to the pre-treated cured patterned resin 10 ′ (eg Figure 1D). The polymer hydrogel 22 can be any gel material that can swell when absorbing liquid and shrink when the liquid is removed, such as by drying. In one example, the polymer hydrogel 22 includes an acrylamide copolymer. Some examples of acrylamide copolymers are represented by the following structure (I):

[0145]

[0146] in:

[0147] R A is selected from the group consisting of azido, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxyl, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol;

[0148] R B is H or optionally substituted alkyl;

[0149] R C , R D and R E are each independently selected from H and optionally substituted alkyl;

[0150] -(CH2) p - each of which may be optionally substituted;

[0151] p is an integer ranging from 1 to 50;

[0152] n is an integer in the range of 1 to 50,000; and

[0153] m is an integer in the range of 1 to 100,000.

[0154] A specific example of the acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidopentyl)acrylamide-co-acrylamide) (PAZAM).

[0155] One of ordinary skill in the art will recognize that the arrangement of recurring "n" and "m" features in structure (I) is representative and that the monomer subunits may be present in the polymer structure in any order (e.g., random, block, patterned, or a combination thereof).

[0156] The molecular weight of the acrylamide copolymer may be in the range of about 5 kDa to about 1500 kDa, or about 10 kDa to about 1000 kDa, or in one specific example may be about 312 kDa.

[0157] In some examples, the acrylamide copolymer is a linear polymer. In some other examples, the acrylamide copolymer is a lightly cross-linked polymer.

[0158] In other examples, the polymer hydrogel 22 can be a variation of structure (I). In one example, the acrylamide unit can be N,N-dimethylacrylamide. In this example, the acrylamide unit in structure (I) can be replaced by Substitute, where R D , R E and R F Each is H or C1-C6 alkyl, R G and R H Each is a C1-C6 alkyl group (rather than H in the case of acrylamide). In this example, q can be an integer in the range of 1 to 100,000. In another example, in addition to the acrylamide units, N,N-dimethylacrylamide can also be used. In this example, in addition to the recurring "n" and "m" features, structure (I) can also include Where R D , R E and R F are each H or C1-C6 alkyl, and R G and R H Each is a C1-C6 alkyl group. In this example, q may be an integer in the range of 1 to 100,000.

[0159] As another example of a polymer hydrogel 22, the recurring "n" feature in structure (I) may be replaced with a monomer comprising a heterocyclic azido group having structure (II):

[0160]

[0161] Where R 1 is H or C1-C6 alkyl; R2 is H or C1-C6 alkyl; L is a linker comprising a straight chain having 2 to 20 atoms selected from carbon, oxygen and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a straight chain comprising 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N-substituted amide having H or C1-C4 alkyl attached to N; and Z is a nitrogen-containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl or pyrimidinyl.

[0162] As yet another example, the gel material may include repeating units of each of structures (III) and (IV):

[0163]

[0164] Where R 1a , R 2a , R 1b and R 2b Each of R is independently selected from hydrogen, optionally substituted alkyl or optionally substituted phenyl; 3a and R 3b Each of L is independently selected from hydrogen, optionally substituted alkyl, optionally substituted phenyl or optionally substituted C7-C14 aralkyl; and each L 1 and L 2 are independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.

[0165] In yet another example, acrylamide copolymers are formed using nitroxide-mediated polymerization, and thus at least some of the copolymer chains have alkoxyamine end groups. In the copolymer chain, the term "alkoxyamine end group" refers to a dormant species -ONR1R2, wherein each of R1 and R2 may be the same or different and may independently be a linear or branched alkyl or cyclic structure, and wherein the oxygen atom is attached to the remainder of the copolymer chain. In some examples, alkoxyamines may also be introduced into some of the recurring acrylamide monomers, such as at position R of structure (I). A Thus, in one example, structure (I) includes alkoxyamine terminal groups; and in another example, structure (I) includes alkoxyamine terminal groups and alkoxyamine groups in at least some of the side chains.

[0166] It should be understood that other molecules can be used as polymer hydrogel 22, as long as they can be functionalized with the desired chemical substances (e.g., primers 24, 26). Some examples of suitable materials for polymer hydrogel 22 include functionalized silanes, such as norbornene silanes, azidosilanes, alkyne functionalized silanes, amine functionalized silanes, maleimide silanes, or any other silanes having functional groups that can be connected to the desired chemical components, respectively. Still other examples of suitable materials for polymer hydrogel 22 include those with colloidal structures, such as agarose; or those with polymer mesh structures, such as gelatin; or those with cross-linked polymer structures, such as polyacrylamide polymers and copolymers, acrylamide (SFA) or azidated versions of SFA without silane. Examples of suitable polyacrylamide polymers can be synthesized from acrylamide and acrylic acid or acrylic acid containing vinyl groups, or from monomers that form [2+2] photocycloaddition reactions. Still other examples of suitable materials for polymer hydrogel 22 include mixed copolymers of acrylamide and acrylates. A variety of polymer architectures containing acrylic monomers (e.g., acrylamide, acrylate, etc.) can be used in the examples disclosed herein, such as branched polymers, including dendritic polymers (e.g., multi-arm polymers or star polymers), etc. For example, monomers (e.g., acrylamide) can be incorporated randomly or blockwise into the branches (arms) of the dendrimer.

[0167] The polymer hydrogel 22 can be deposited on the surface of the pre-treated cured patterned resin 10' using spin coating, or dipping or dip coating, or flow of functionalized molecules under positive or negative pressure, or another suitable technique. The polymer hydrogel 22 can be present in a mixture. In one example, the mixture includes water containing PAZAM or a mixture of ethanol and water containing PAZAM.

[0168] After coating, the polymer hydrogel 22 may also be exposed to a curing process to form a coating of the polymer hydrogel 22 throughout the patterned substrate (i.e., in the recessed portions 18 and on the gap regions 20). In one example, curing the polymer hydrogel 22 may be performed at a temperature in the range of room temperature (e.g., about 25° C.) to about 95° C. for a time in the range of about 1 millisecond to about several days. In another example, the time may be in the range of 10 seconds to at least 24 hours. In yet another example, the time may be in the range of about 5 minutes to about 2 hours.

[0169] The attachment of the polymer hydrogel 22 to the recessed portion 18 and the interstitial region 20 may be performed by covalent bonding. The covalent connection of the polymer hydrogel 22 to the silanized or plasma ashed recessed portion helps to maintain the polymer hydrogel 22 in the recessed portion 18 throughout the life of the final flow cell during various uses. The following are some examples of reactions that can occur between silane or silane derivatives and the polymer hydrogel 22.

[0170] When the silane or silane derivative contains norbornene or a norbornene derivative as an unsaturated moiety, the norbornene or the norbornene derivative can: i) undergo a 1,3-dipolar cycloaddition reaction with the azide / azido group of PAZAM; ii) undergo a coupling reaction with a tetrazine group attached to PAZAM; undergo a cycloaddition reaction with a hydrazone group attached to PAZAM; undergo a photoclick reaction with a tetrazole group attached to PAZAM; or undergo a cycloaddition reaction with a nitrile oxide group attached to PAZAM.

[0171] When the silane or silane derivative comprises cyclooctyne or cyclooctyne derivative as the unsaturated moiety, the cyclooctyne or cyclooctyne derivative can: i) undergo a strain-facilitated azide-alkyne 1,3-cycloaddition (SPAAC) reaction with the azide / azide group of PAZAM, or ii) undergo a strain-facilitated alkyne-nitrile oxide cycloaddition reaction with the nitrile oxide group attached to PAZAM.

[0172] When the silane or silane derivative contains a bicyclononyne as the unsaturated moiety, the bicyclononyne can undergo similar SPAAC alkyne cycloaddition reactions with azides or nitrile oxides attached to PAZAM due to the strain in the bicyclic ring system.

[0173] In order to form the polymer hydrogel 22 in the recessed portion 18 and not on the gap region 20 of the cured patterned resin 10', the gap region 20 may be polished to remove the polymer hydrogel 22. The polishing process may be performed using a chemical slurry (including, for example, an abrasive, a buffer, a chelating agent, a surfactant and / or a dispersant), which may remove the polymer hydrogel 22 from the gap region 20 without adversely affecting the underlying cured patterned resin 10' and / or substrate 12 at those regions. Alternatively, polishing may be performed using a solution that does not include abrasive particles. The chemical slurry may be used in a chemical mechanical polishing system. In this example, a polishing head / pad or other polishing tool is capable of polishing the polymer hydrogel 22 from the gap region 20 while leaving the polymer hydrogel 22 in the recessed portion 18 and leaving the underlying cured patterned resin 10' at least substantially intact. As an example, the polishing head may be a Strasbaugh ViPRR II polishing head. In another example, polishing may be performed using a polishing pad and a solution without any abrasive. For example, the polishing pad can be used with a solution that does not contain abrasive particles (eg, a solution that does not include abrasive particles).

[0174] Figure 1DThe polymer hydrogel 22 in the recess 18 is depicted. A cleaning process may then be performed. This process may utilize a water bath and ultrasonic treatment. The water bath may be maintained at a relatively low temperature in the range of about 22° C. to about 30° C. The silanized, coated, and polished patterned substrate may also be spin dried, or dried via another suitable technique.

[0175] like Figure 1E As shown, a grafting process is performed to graft primers 24, 26 onto the polymer hydrogel 22 in the recess 18. The primers 24, 26 may be any forward amplification primers and / or reverse amplification primers. In this example, the primers 24, 26 are two different primers.

[0176] It is desirable that the primers 24, 26 be immobilized to the polymer hydrogel 22. In some examples, the immobilization may be performed by single-point covalent attachment to the polymer hydrogel 22 at the 5' end of the respective primers 24, 26. Any suitable covalent attachment means known in the art may be used. In some examples, the immobilization may be performed by strong non-covalent attachment (e.g., biotin-streptavidin).

[0177] Each of the primers 24, 26 has a universal sequence for capture and / or amplification purposes. As an example, the primers 24, 26 may include a P5 primer and a P7 primer, a P15 primer and a P7 primer, or any combination of PA primers, PB primers, PC primers, and PD primers described herein. For example, the primers 24, 26 may include any two PA, PB, PC, and PD primers, or any combination of a PA primer and a PB, PC, or PD primer, or any combination of a PB primer and a PC or PD primer, or any combination of a PC primer and a PD primer.

[0178] Examples of P5 and P7 primers are used on the surface of commercial flow cells sold by Illumina Inc., for example in HiSeq TM 、HiSeqX TM 、MiSeq TM 、MiSeqDX TM 、MiNISeq TM 、NextSeq TM 、NextSeqDX TM 、NovaSeq TM 、iSEQ TM 、Genome Analyzer TM and other instrument platforms. The P5 primer is:

[0179] P5:5'→3'

[0180] AATGATACGGCGACCACCGAGAUCTACAC(SEQ.ID.NO.1)

[0181] The P7 primer can be any of the following:

[0182] P7#1: 5' → 3'

[0183] CAAGCAGAAGACGGCATACGAnAT(SEQ.ID.NO.2)

[0184] P7#2: 5' → 3'

[0185] CAAGCAGAAGACGGCATACnAGAT(SEQ.ID.NO.3)

[0186] where "n" is the number of 8-oxoguanines in each sequence.

[0187] The P15 primers are:

[0188] P15:5'→3'

[0189] AATGATACGGCGACCACCGAGAnCTACAC(SEQ.ID.NO.4)

[0190] wherein "n" is allyl-T (a thymine nucleotide analogue having an allyl functional group).

[0191] The above other primers (PA-PD) include:

[0192] PA 5'→3'

[0193] GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG(SEQ.ID.NO.5)

[0194] cPA(PA')5'→3'

[0195] CTCAACGGATTAACGAAGCGTTCGGACGTGCCAGC(SEQ.ID.NO.6)

[0196] PB 5'→3'

[0197] CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT(SEQ.ID.NO.7)

[0198] cPB(PB')5'→3'

[0199] AGTTCATATCCACCGAAGCGCCATGGCAGACGACG(SEQ.ID.NO.8)

[0200] PC 5'→3'

[0201] ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT(SEQ.ID.NO.9)

[0202] cPC(PC')5'→3'

[0203] AGTTGCGGATTCGACGCGTTGATATTAGCGGCCGT(SEQ.ID.NO.10)

[0204] PD 5'→3'

[0205] GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC(SEQ.ID.NO.11)

[0206] cPD(PD')5'→3'

[0207] GCTGCATCGAATAGTCCGGCTAACGTAACGCGGC(SEQ.ID.NO.12)

[0208] The P5 and P7 sequences show a cleavage site (e.g., U or "n"). Although not shown in the example sequence of PA-PD, it should be understood that any of these primers may include a cleavage site at any point in the chain, such as uracil, 8-oxoguanine, allyl-T, etc. In any example, the cleavage sites of primers 24 and 26 should be different from each other so that the cleavage of primers 24 and 26 does not occur at the same time. Examples of suitable cleavage sites include enzymatically cleavable nucleobases or chemically cleavable nucleobases, modified nucleobases, or linkers (e.g., between nucleobases). Enzymatically cleavable nucleobases may be easily cleaved by reacting with glycosylases and endonucleases, or exonucleases. A specific example of a cleavable nucleobase is deoxyuracil (dU), which can be targeted by the USER enzyme. Other abasic sites may also be used. Examples of chemically cleavable nucleobases, modified nucleobases or linkers include 8-oxoguanine, vicinal diols, disulfides, silanes, azobenzenes, photocleavable groups, allyl T (a thymine nucleotide analog with an allyl functional group), allyl ethers or azido functional ethers.

[0209] Each of the primers 24 and 26 disclosed herein may further include a polyT sequence at the 5' end of the primer sequence. In some examples, the polyT region includes 2 to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7 or 10 T bases.

[0210] The 5' end of each primer 24, 26 may also include a linker. Any linker containing a terminal alkyne group or another suitable terminal functional group capable of attaching to a surface functional group of the polymer hydrogel 22 may be used. Examples of suitable terminal functional groups include tetrazine, azido, amino, epoxy or glycidyl, phosphorothioate, thiol, aldehyde, hydrazine, phosphoramidite, triazolinedione or biotin. In one example, the primers 24, 26 are terminated with a hexynyl group. In some specific examples, a succinimide (NHS) ester-terminated primer may react with an amine at the surface of the polymer hydrogel 22, an aldehyde-terminated primer may react with a hydrazine at the surface of the polymer hydrogel 22, or an alkyne-terminated primer may react with an azide at the surface of the polymer hydrogel 22, or an azide-terminated primer may react with an alkyne or DBCO (dibenzocyclooctyne) at the surface of the polymer hydrogel 22, or an amino-terminated primer may react with an activated carboxylic acid group or NHS ester at the surface of the polymer hydrogel 22, or a thiol-terminated primer may react with an alkylating reactant (e.g., iodoacetamide or maleimide) at the surface of the polymer hydrogel 22, a phosphoramidite-terminated primer may react with a thioether at the surface of the polymer hydrogel 22, or a primer modified by biotin may react with streptavidin at the surface of the polymer hydrogel 22.

[0211] In one example, grafting of the primers 24, 26 can be achieved by flow-through deposition (e.g., using a temporarily bonded cap), thick coating, spraying, whipped dispensing, or another suitable method of attaching the primers 24, 26 to the polymer hydrogel 22. Each of these example techniques can utilize a primer solution or mixture that can include the primers 24, 26; water; a buffer; and a catalyst.

[0212] Thick coating can involve placing a flow cell precursor (shown in Figure 1DThe flow cell precursor is immersed in a series of temperature controlled baths (in a bath). The bath may also be flow controlled and / or covered with a nitrogen layer. The bath may include a primer solution or a mixture. In various baths, primers 24, 26 will be attached to the primer-grafted functional groups of the polymer hydrogel 22 in at least some of the recesses 18. In one example, a flow cell precursor is introduced into a first bath comprising a primer solution or a mixture, where a reaction occurs to attach primers 24, 26, and then the flow cell precursor is moved to an additional bath for washing. Moving between baths may involve a robot arm or may be performed manually. A drying system may also be used in thick coatings.

[0213] Spray coating can be achieved by spraying the primer solution or mixture directly onto the flow cell precursor. The sprayed wafer can be incubated at a temperature in the range of about 0° C. to about 70° C. for a time in the range of about 4 minutes to about 60 minutes. After incubation, the primer solution or mixture can be diluted and removed using, for example, a spin coater.

[0214] The whipping distribution can be performed according to the pooling and rotation separation method, and therefore can be realized by a spin coater. The primer solution or mixture can be applied to the circulation cell precursor (manually or via an automated process). The applied primer solution or mixture can be applied to the entire surface of the circulation cell precursor or spread across the entire surface. The primer-coated circulation cell precursor can be incubated for a time in the range of about 2 minutes to about 60 minutes at a temperature in the range of about 0°C to about 80°C. After incubation, the primer solution or mixture can be diluted and removed using, for example, a spin coater.

[0215] In other examples, the primers 24, 26 may be pre-grafted to the polymer hydrogel 22 and thus may be present in the recess 18 once the polymer hydrogel 22 is applied.

[0216] Figure 1E and Figure 2 An example of a flow cell surface after grafting of primers 24 , 26 or after a pre-grafted polymer hydrogel has been applied and removed from the gap region 20 is shown.

[0217] Figure 1E and Figure 2 The example shown is an example of a flow cell surface without a cover or other flow cell surface bonded thereto. In one example, the cover can be bonded to at least a portion of the cured patterned resin 10', for example, at some of the gap regions 20. The bond formed between the cover and the cured patterned resin 10' can be a chemical bond or a mechanical bond (e.g., using fasteners, etc.).

[0218] The cover can be any material that is transparent to the excitation light directed toward the substrate 12 and the cured patterned resin 10'. For example, the cover can be glass (e.g., borosilicate, fused silica, etc.), plastic, etc. A commercially available example of a suitable borosilicate glass is D Commercially available examples of suitable plastic materials (ie, cycloolefin polymers) are available from Zeon Chemicals LP. product.

[0219] The cover may be bonded to the cured patterned resin 10' using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activated bonding, glass frit bonding, or other methods known in the art. In one example, a spacer layer may be used to bond the cover to the cured patterned resin 10'. The spacer layer may be any material that seals at least some of the cured patterned resin 10' and the cover together. In some examples, the spacer layer may be a radiation absorbing material that aids in bonding the cured patterned resin 10' and the cover.

[0220] In other examples, a flow cell surface (one of the flow cell surfaces) is Figure 1E and Figure 2 The two flow cell surfaces in (shown in) can be bonded together so that the recessed portion 18 faces the flow channel formed between the two flow cell surfaces. The flow cell can be bonded at the gap region 20 using similar techniques and materials described herein for bonding the cap.

[0221] The circulation cell may include a single flow channel or any desired number of flow channels separated from each other by fluid. This enables each flow channel to receive and process different samples at different times. In examples with multiple flow channels, it will be appreciated that each flow channel includes a functionalized recess and a corresponding inlet and outlet for introducing reagents into and removing reagents from the flow channel.

[0222] Methods of using a flow cell

[0223] The flow cell disclosed herein can be used in a variety of sequencing methods or techniques, including techniques generally referred to as sequencing by synthesis (SBS), cycle array sequencing, ligation sequencing, pyrosequencing, etc. In any of these techniques, since the polymer hydrogel 22 and attached primers 24, 26 are present in the recess 18 rather than on the interstitial region 20, amplification will be limited to the recess 18.

[0224] As an example, a sequencing-by-synthesis (SBS) reaction can be performed on a HiSeqTM 、HiSeqX TM 、MiSeq TM 、MiSeqDX TM 、MiNISeq TM 、NovaSeq TM 、iSeq TM 、NextSeqDX TM or NextSeq TM The sequencer system is run on a system. In SBS, the extension of a nucleic acid primer (e.g., a sequencing primer) along a nucleic acid template (i.e., a sequencing template) is monitored to determine the sequence of the nucleotides in the template. The underlying chemical process can be polymerization (e.g., catalyzed by a polymerase) or ligation (e.g., catalyzed by a ligase). In a specific polymerase-based SBS process, fluorescently labeled nucleotides are added to the sequencing primer (thereby extending the sequencing primer) in a template-dependent manner, so that the detection of the order and type of nucleotides added to the sequencing primer can be used to determine the sequence of the template.

[0225] Prior to sequencing, the capture and amplification primers 24, 26 may be exposed to a sequencing library, which is amplified using any suitable method, such as cluster generation.

[0226] In one example of cluster generation, a high-fidelity DNA polymerase is used to copy library fragments from hybrid primers 24, 26 by 3' extension. The original library fragments are denatured so that the copies are fixed. Isothermal bridge amplification can be used to amplify fixed copies. For example, the copied template loops back to hybridize with adjacent complementary primers 24, 26, and the polymerase replicates the copied template to form a double-stranded bridge, which is denatured to form two single strands. These two chains loop back and hybridize with adjacent complementary primers 24, 26, and extend again to form two new double-stranded loops. The process is repeated for each template copy by isothermal denaturation and amplification cycles to produce dense clonal clusters. Each cluster of double-stranded bridges is denatured. In one example, the antisense strand is removed by specific base cleavage, leaving a forward template polynucleotide chain. Clustering results in the formation of several template polynucleotide chains in each recess in the recess 18. This example of clustering is bridge amplification, and is an example of executable amplification. It will be appreciated that other amplification techniques may be used, such as the Exclusion Amplification (Examp) workflow (Illumina Inc.).

[0227] A sequencing primer may be introduced that hybridizes to a complementary sequence on the template polynucleotide chain. This sequencing primer prepares the template polynucleotide chain for sequencing. The 3' ends of the template and any flow cell-bound primers 24, 26 (not attached to the copy) may be blocked to prevent interference with the sequencing reaction, and in particular to prevent undesired priming.

[0228] In order to trigger sequencing, the incorporation mixture can be added to the circulation cell. In one example, the incorporation mixture comprises a liquid carrier, a polymerase and a fluorescently labeled nucleotide. The fluorescently labeled nucleotide may comprise a 3'OH blocking group. When the incorporation mixture is introduced into the circulation cell, the fluid enters the flow channel and flows into the recess 18 (wherein there is a template polynucleotide chain).

[0229] Fluorescently labeled nucleotides are added to the sequencing primer (thereby extending the sequence) by a polymerase in a template-dependent manner, so that the detection of the order and type of nucleotides added to the sequencing primer can be used to determine the sequence of the template. More specifically, one of the nucleotides is incorporated into the nascent chain that extends the sequencing primer and is complementary to the template polynucleotide chain by the corresponding polymerase. In other words, in at least some of the template polynucleotide chains on the flow cell, the corresponding polymerase extends the hybridized sequencing primer by one of the nucleotides incorporated into the mixture.

[0230] Incorporation of nucleotides can be detected by an imaging event.During an imaging event, an illumination system (not shown) can provide excitation light to the flow cell surface.

[0231] In some examples, the nucleotide may further include a reversible termination property (e.g., a 3'OH blocking group) that terminates further primer extension once the nucleotide is added to the sequencing primer. For example, a nucleotide analog having a reversible terminator portion may be added to the sequencing primer such that subsequent extension does not occur until a deblocking agent is delivered to remove the portion. Thus, for examples using reversible termination, the deblocking agent may be delivered to the flow cell after detection occurs.

[0232] Washing may occur between the various fluid delivery steps.The SBS cycle may then be repeated n times to extend the sequencing primer by n nucleotides, thereby detecting a sequence of length n.

[0233] In some examples, the forward strand can be sequenced and removed, and then the reverse strand constructed and sequenced as described herein.

[0234] Although SBS has been described in detail, it will be appreciated that the flow cells described herein may be used for genotyping with other sequencing protocols, or in other chemical and / or biological applications.

[0235] Although Figures 1A to 1E and Figure 2The examples described in the foregoing illustrate the use of the example NIL resin composition 10 for forming a flow cell surface, but it should be understood that the NIL resin composition 10 disclosed herein can also be used in other applications. As an example, the NIL resin composition 10, 10' can be used in any optical-based sequencing technology. As other examples, the NIL resin composition 10, 10' can be used in planar waveguides, in complementary metal oxide semiconductors (CMOS), etc.

[0236] In order to further illustrate the present disclosure, examples are given herein. It should be understood that these examples are provided for illustrative purposes and should not be construed as limiting the scope of the present disclosure.

[0237] Non-limiting working examples

[0238] Example 1

[0239] Three example resin compositions and two comparative example resin compositions were prepared using epoxy-substituted cyclosiloxane monomers. The solids of the corresponding resins are shown in Table 1, where the amounts are given in mass % based on the total mass of solids.

[0240] Table 1 - Resin Solids

[0241]

[0242] Example resins 1 to 3 contain different amounts of the fluorinated monomer, glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether. Comparative resin 4 does not contain any surface additives, and Comparative resin 5 contains a polyacrylate surface additive ( Available from BYK).

[0243] Propylene glycol methyl ether acetate (PGMEA) was added to each of the resin solids in the resin solids. The final concentration of each of the example resins and each of the comparative example resins was about 18% by mass.

[0244] Each of the embodiment resin compositions 1 to 3 and the comparative example resin compositions 4 to 5 was spin coated on a corresponding glass wafer. The used working stamp (previously used 25 times) was manually rolled on each coated wafer in the coated wafer. The working stamp had a center-to-center pitch of 624nm and a feature height of 350nm. The resin composition was then exposed to UV curing under a 365nm UV LED light source, and 330mW / cm was measured at the sample level. 2 Power output. Curing takes place for 30 seconds. After curing, the working impression is released.

[0245] Atomic force microscopy (AFM) was used to check the quality of the imprint by measuring the depth of each recess. The target recess depth was 350 nm. The AFM results are shown in Table 2.

[0246] Table 2 - AFM results

[0247] Resin ID Depth of recess (nm) Example 1 362 Example 2 360 Example 3 351 Comparative Example 4 356 Comparative Example 5 362

[0248] These results indicate that the fluorinated monomer is compatible with the nanoimprint process and performs as well as the comparative polyacrylate surface additives.

[0249] Example 2

[0250] One example resin composition and two comparative example resin compositions were prepared using each of: i) an epoxy-substituted cyclosiloxane monomer and ii) a non-silicone epoxy monomer. The solids of the resins produced using the epoxy-substituted cyclosiloxane monomers are shown in Table 3A, and the solids of the resins produced using the non-silicone epoxy monomers are shown in Table 3B, wherein the amounts in each of these tables are given as mass % based on the total mass of the solids.

[0251] Table 3A - Resin Solids

[0252]

[0253] Table 3B - Resin Solids

[0254]

[0255] Example resins 6 and 9 contain 1.6 mass % of the fluorinated monomer, glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether. Comparative example resins 8 and 11 do not contain any surface additives, and comparative example resins 7 and 10 contain a polyacrylate surface additive ( Available from BYK).

[0256] Propylene glycol methyl ether acetate (PGMEA) was added to each of the resin solids in the resin solids. The final concentration of each of the example resins and each of the comparative example resins was about 18% by mass.

[0257] Each of Example Resin Compositions 6 and 9 and Comparative Example Resin Compositions 7, 8, 10 and 11 was spin coated on a corresponding glass wafer. The working stamp was manually rolled on each of the coated wafers. The working stamp had a center-to-center pitch of 624 nm. The resin composition was then exposed to a power output of 330 mW / cm2 measured at the sample level. 2UV curing was performed under a 365nm UV LED light source. Curing was performed for 30 seconds. After curing, the working impression was released.

[0258] The water contact angle of the imprinted resin was measured using a goniometer (which measures the static water contact angle of a sessile water droplet in air on a surface), and the results are shown in Figure 3 (where each imprint is identified by the resin used to create it). Figure 3 As shown, the fluorinated monomers (of Example Resins 6 and 9) increased the water contact angle of both Example stamps in a similar manner as the polyacrylate surface additives (of Comparative Resins 7 and 10). These results indicate that the fluorinated monomers perform as well as the comparative polyacrylate surface additives in reducing surface energy. Based on these results, it is believed that fluorinated compounds may also help extend the life of working stamps.

[0259] Example 3

[0260] Example Resin 6 was used in this example. Example Resin 6 was spin coated onto an unpatterned glass die and exposed to a power output of 330 mW / cm2 measured at the sample level. 2 UV curing was performed under a 365 nm UV LED light source. Curing was performed for 30 seconds.

[0261] The coated glass die was ashed in air plasma at 595 W RF power for 30 seconds.The surface activated die was exposed to pure chemical vapor of [(5-bicyclo[2.2.1]hept-2-enyl)ethyl]trimethoxysilane at 60° C. overnight to silanize the surface.

[0262] The silanized coated glass die was bonded to a cover glass with fluidic channels engraved therein. Norland Optical Adhesive 81 was used for bonding and the adhesive was UV cured for 9 minutes under a UV lamp with broad spectrum emission and a power output of 3 mW measured at the sample level.

[0263] A 0.175 mass % N,N-dimethylacrylamide aqueous solution was introduced into the flow cell and incubated at 70°C for 75 minutes. This attached the hydrogel layer to the silanized surface of the coated glass die. The P5 and P7 primers were grafted onto the hydrogel layer from an 18 μM aqueous solution (incubated at 60°C for 30 minutes).

[0264] The bound flow cell was then exposed to clustering using 0.67 pM PhiX library. The resulting templates were sequenced using violet illumination and blue illumination, the optical settings for these sequencing are shown in Table 4.

[0265] Table 4 - Optical settings

[0266]

[0267] The 12 synthetic sequencing (SBS) cycles are followed by the removal of fluorescent dye from the 3' blocking group in the 13th cycle. The 14th cycle consists of an additional washing step by rinsing a modified incorporation mixture through a flow cell, which does not include any fully functional nucleotides (ffN). In the 15th cycle, complementary strands are dehybridized from clusters. After clustering on an unpatterned flow cell, each region of the polymer hydrogel can remain unclustered. Cycles 13 to 15 are included as controls to run to determine whether ffN is attached to these cluster outer regions of substrate. Figure 4 is a graph showing signal intensity (Y-axis) versus cycle number (X-axis). Figure 4 The results in Figure 4 indicate that ffN was not bound to the surface (data for cycles 13 to 15) and was detected on the clusters (data for cycles 1 to 12). This data illustrates the unexpected result that the fluorinated monomer did not interfere with polymer hydrogel attachment, primer grafting, template generation, or sequencing. Images taken on slice 3 of the flow cell in cycle 2 of sequencing when using blue illumination Figure 5A and Figure 5B ( Figure 5A ) and when using purple lighting, Fig. 6A and Figure 6B ( Fig. 6A These results further demonstrate the unexpected compatibility of fluorinated monomers with sequencing and the overall feasibility of fluorinated monomers as leveling agents in the resin compositions disclosed herein.

[0268] Additional Notes

[0269] Terms

[0270] 1. A nanoimprint lithography (NIL) resin composition, the NIL resin composition comprising:

[0271] There are three monomers in total, among which:

[0272] Two of the three monomers are selected from the group consisting of:

[0273] two different epoxy-substituted silsesquioxane monomers;

[0274] two different epoxy-substituted cyclosiloxane monomers; and

[0275] two different non-silicone epoxy monomers; and

[0276] The third monomer of the three monomers is a fluorinated monomer, the fluorinated monomer being present in an amount ranging from about 0.5 mass % to about 4 mass % based on the total solid content of the NIL resin composition;

[0277] photoinitiator; and

[0278] Solvent.

[0279] 2. The NIL resin composition according to clause 1, wherein the fluorinated monomer is selected from the group consisting of: 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl)bis(ethylene oxide), glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether, glycidyl 2,2,3,3-tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl)ethylene oxide, (2,2,3,3,4,4,5,5,

[00147] The invention relates to ethylene oxide comprising: (1,2,6,7,7,7-tridecafluoroheptyl)oxirane, (2,2,3,3,4,4,5,5,6,7,7,7-dodecafluoro-6-(trifluoromethyl)heptyl]oxirane, (2,2,3,3,4,4,5,5,6,7,7,8,9,9,9-hexadecfluoro-8-(trifluoromethyl)nonyl]oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-heneicosfluoroundecyl)oxirane, and combinations thereof.

[0280] 3. The NIL resin composition according to clause 1 or 2, wherein:

[0281] The two monomers of the three monomers are the two different epoxy-substituted silsesquioxane monomers; and

[0282] The two different epoxy-substituted silsesquioxane monomers consist of epoxycyclohexylethyl polysilsesquioxane and glycidyl polysilsesquioxane.

[0283] 4. The NIL resin composition according to clause 3, wherein the two different epoxy-substituted silsesquioxane monomers are present in a mass ratio ranging from about 3:7 to about 7:3.

[0284] 5. The NIL resin composition according to clause 1 or 2, wherein:

[0285] The two monomers of the three monomers are the two different epoxy-substituted cyclosiloxane monomers; and

[0286] The two different epoxy-substituted cyclosiloxane monomers consist of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidylcyclotetrasiloxane.

[0287] 6. The NIL resin composition according to clause 5, wherein the two different epoxy-substituted cyclosiloxane monomers are present in a mass ratio ranging from about 3:7 to about 7:3.

[0288] 7. The NIL resin composition according to clause 1 or 2, wherein:

[0289] The two monomers of the three monomers are the two different non-silicone epoxy monomers; and

[0290] The two different non-silicone epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl)adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, 1,2-cyclohexanedicarboxylic acid diglycidyl ester, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate.

[0291] 8. The NIL resin composition according to clause 7, wherein the two different non-silicone epoxy monomers are present in a mass ratio ranging from about 4:1 to about 1:4.

[0292] 9. The NIL resin composition according to one of clauses 1 to 8, wherein the photoinitiator is selected from the group consisting of free radical photoinitiators, cationic photoinitiators, and combinations thereof.

[0293] 10. A flow cell, comprising:

[0294] substrate;

[0295] A cured patterned resin positioned over a substrate, the cured patterned resin comprising embossed recesses separated by gap regions, the cured patterned resin comprising a cured form of a nanoimprint lithography (NIL) resin composition comprising:

[0296] There are three monomers in total, among which:

[0297] Two of the three monomers are selected from the group consisting of:

[0298] two different epoxy silsesquioxane monomers;

[0299] two different epoxy cyclosiloxane monomers; and

[0300] two different non-silicone epoxy monomers; and

[0301] The third monomer of the three monomers is a fluorinated monomer, the fluorinated monomer being present in an amount ranging from about 0.5 mass % to about 4 mass % based on the total solid content of the NIL resin composition;

[0302] photoinitiator; and

[0303] Solvents;

[0304] a polymer hydrogel positioned within each of the recessed portions; and

[0305] A primer set is attached to the polymer hydrogel.

[0306] 11. The flow cell according to clause 10, wherein the substrate is silanized glass or silanized silicon.

[0307] 12. A flow cell according to clause 10 or 11, wherein the fluorinated monomer is selected from the group consisting of: 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl)bis(ethylene oxide), glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether, glycidyl 2,2,3,3-tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl)ethylene oxide, (2,2,3,3,4,4,5,5,

[00147] The invention relates to ethylene oxide comprising: (1,2,6,7,7,7-tridecafluoroheptyl)oxirane, (2,2,3,3,4,4,5,5,6,7,7,7-dodecafluoro-6-(trifluoromethyl)heptyl]oxirane, (2,2,3,3,4,4,5,5,6,7,7,8,9,9,9-hexadecfluoro-8-(trifluoromethyl)nonyl]oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-heneicosfluoroundecyl)oxirane, and combinations thereof.

[0308] 13. A flow cell according to one of clauses 10 to 12, wherein:

[0309] The two monomers of the three monomers are the two different epoxy-substituted silsesquioxane monomers;

[0310] The two different epoxy-substituted silsesquioxane monomers consist of epoxycyclohexylethyl polysilsesquioxane and glycidyl polysilsesquioxane; and

[0311] The two different epoxy-substituted silsesquioxane monomers are present in a mass ratio ranging from about 3:7 to about 7:3.

[0312] 14. A flow cell according to one of clauses 10 to 12, wherein:

[0313] The two monomers of the three monomers are the two different epoxy-substituted cyclosiloxane monomers;

[0314] The two different epoxy-substituted cyclosiloxane monomers consist of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidylcyclotetrasiloxane; and

[0315] The two different epoxy-substituted cyclosiloxane monomers are present in a mass ratio ranging from about 3:7 to about 7:3.

[0316] 15. A flow cell according to one of clauses 10 to 12, wherein:

[0317] The two monomers of the three monomers are the two different non-silicone epoxy monomers;

[0318] The two different non-silicone epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl)adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, 1,2-cyclohexanedicarboxylic acid diglycidyl ester, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate; and

[0319] The two different non-silicone epoxy monomers are present in a mass ratio ranging from about 4:1 to about 1:4.

[0320] 16. A method comprising:

[0321] A nanoimprint lithography (NIL) resin composition is deposited on a substrate, the NIL resin composition comprising:

[0322] There are three monomers in total, among which:

[0323] Two of the three monomers are selected from the group consisting of:

[0324] two different epoxy silsesquioxane monomers;

[0325] two different epoxy cyclosiloxane monomers; and two different non-silicone epoxy monomers; and a third monomer of the three monomers is a fluorinated monomer, the fluorinated monomer being present in an amount ranging from about 0.5 mass % to about 4 mass % based on the total solids content of the NIL resin composition;

[0326] photoinitiator; and

[0327] Solvents;

[0328] nanoimprinting the deposited NIL resin composition using a working stamp; and curing the deposited NIL resin composition to form a cured patterned resin.

[0329] 17. The method according to clause 16, wherein the fluorinated monomer is selected from the group consisting of: 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl)bis(ethylene oxide), glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether, glycidyl 2,2,3,3-tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl)ethylene oxide, (2,2,3,3,4,4,5,5,6,

[00147] The invention relates to ethylene oxide comprising: (1,2,3,4,5,6,7,7,7-tridecafluoroheptyl)oxirane, (2,2,3,3,4,4,5,5,6,7,7,7-tridecafluoroheptyl)oxirane, (2,2,3,3,4,4,5,5,6,7,7,7-dodecafluoro-6-(trifluoromethyl)heptyl]oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,8,9,9,9-hexadecanoyl-8-(trifluoromethyl)nonyl]oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-heneicosfluoroundecyl)oxirane, and combinations thereof.

[0330] 18. A method according to clause 16 or 17, wherein:

[0331] The two monomers of the three monomers are the two different epoxy-substituted silsesquioxane monomers;

[0332] The two different epoxy-substituted silsesquioxane monomers consist of epoxycyclohexylethyl polysilsesquioxane and glycidyl polysilsesquioxane; and

[0333] The two different epoxy-substituted silsesquioxane monomers are present in a mass ratio ranging from about 3:7 to about 7:3.

[0334] 19. A method according to clause 16 or 17, wherein:

[0335] The two monomers of the three monomers are the two different epoxy-substituted cyclosiloxane monomers;

[0336] The two different epoxy-substituted cyclosiloxane monomers consist of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidylcyclotetrasiloxane; and

[0337] The two different epoxy-substituted cyclosiloxane monomers are present in a mass ratio ranging from about 3:7 to about 7:3.

[0338] 20. A method according to clause 16 or 17, wherein:

[0339] The two monomers of the three monomers are the two different non-silicone epoxy monomers;

[0340] The two different non-silicone epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl)adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, 1,2-cyclohexanedicarboxylic acid diglycidyl ester, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate; and

[0341] The two different non-silicone epoxy monomers are present in a mass ratio ranging from about 4:1 to about 1:4.

[0342] 21. A method according to any one of clauses 16 to 20, wherein:

[0343] Curing is performed using a 365 nm UV light source; and

[0344] The deposited NIL resin composition is exposed to ultraviolet light for a time ranging from about 3 seconds to about 30 seconds.

[0345] It should be understood that all combinations of the foregoing concepts and additional concepts discussed in more detail below (assuming such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. Specifically, all combinations of the claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be understood that terms explicitly adopted herein that may also appear in any disclosure incorporated by reference should be given a meaning most consistent with the specific concepts disclosed herein.

[0346] The references to "one example", "another example", "an example", etc. throughout this specification mean that the specific elements (e.g., features, structures, and / or characteristics) described in conjunction with the example are included in at least one example described herein, and may or may not be present in other examples. In addition, it should be understood that the elements used in any example may be combined in various examples in any suitable manner, unless the context clearly indicates otherwise.

[0347] While several examples have been described in detail, it is to be understood that modifications may be made to the disclosed examples. Therefore, the above description should be considered non-limiting.

Claims

1. A nanoimprint lithography (NIL) resin composition, the NIL resin composition comprising: There are three monomers in total, among which: Two of the three monomers are selected from the group consisting of: two different epoxy-substituted silsesquioxane monomers; two different epoxy-substituted cyclosiloxane monomers; and two different non-silicone epoxy monomers; and The third monomer of the three monomers is a fluorinated monomer, the fluorinated monomer being present in an amount ranging from about 0.5 mass % to about 4 mass % based on the total solid content of the NIL resin composition; photoinitiator; and Solvent.

2. The NIL resin composition according to claim 1, wherein the fluorinated monomer is selected from the group consisting of: 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl)bis(ethylene oxide), glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether, glycidyl 2,2,3,3-tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl)ethylene oxide, (2,2,3,3,4,4,5,5,6,6,7,7,7-tridecafluoroheptyl)ethylene oxide, 2,2,3,3,4,4,5,5,6,7,7,7-dodecafluoro-6-(trifluoromethyl)heptyl]ethylene oxide, 2,2,3,3,4,4,5,5,6,6,7,7,8,9,9,9-hexadecanoyl-8-(trifluoromethyl)nonyl]ethylene oxide, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-heneicosfluoroundecyl)ethylene oxide, and combinations thereof.

3. The NIL resin composition according to claim 1, wherein: The two monomers of the three monomers are the two different epoxy-substituted silsesquioxane monomers; and The two different epoxy-substituted silsesquioxane monomers consist of epoxycyclohexylethyl polysilsesquioxane and glycidyl polysilsesquioxane. 4 . The NIL resin composition of claim 3 , wherein the two different epoxy-substituted silsesquioxane monomers are present in a mass ratio ranging from about 3:7 to about 7:

3.

5. The NIL resin composition according to claim 1, wherein: The two monomers of the three monomers are the two different epoxy-substituted cyclosiloxane monomers; and The two different epoxy-substituted cyclosiloxane monomers consist of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidylcyclotetrasiloxane.

6. The NIL resin composition of claim 5, wherein the two different epoxy-substituted cyclosiloxane monomers are present in a mass ratio ranging from about 3:7 to about 7:

3.

7. The NIL resin composition according to claim 1, wherein: The two monomers of the three monomers are the two different non-silicone epoxy monomers; and The two different non-silicone epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl)adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, 1,2-cyclohexanedicarboxylic acid diglycidyl ester, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate.

8. The NIL resin composition of claim 7, wherein the two different non-silicone epoxy monomers are present in a mass ratio ranging from about 4:1 to about 1:

4.

9. The NIL resin composition of claim 1, wherein the photoinitiator is selected from the group consisting of free radical photoinitiators, cationic photoinitiators, and combinations thereof.

10. A circulation cell, comprising: substrate; a cured patterned resin positioned over the substrate, the cured patterned resin comprising embossed recesses separated by gap regions, the cured patterned resin comprising a cured form of a nanoimprint lithography (NIL) resin composition comprising: There are three monomers in total, among which: Two of the three monomers are selected from the group consisting of: two different epoxy silsesquioxane monomers; two different epoxy cyclosiloxane monomers; and two different non-silicone epoxy monomers; and The third monomer of the three monomers is a fluorinated monomer, the fluorinated monomer being present in an amount ranging from about 0.5 mass % to about 4 mass % based on the total solid content of the NIL resin composition; photoinitiator; and Solvents; a polymer hydrogel positioned within each of the recessed portions; and A primer set is attached to the polymer hydrogel.

11. The flow cell of claim 10, wherein the substrate is silanized glass or silanized silicon.

12. The flow cell of claim 10, wherein the fluorinated monomer is selected from the group consisting of 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl)bis(ethylene oxide), glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether, glycidyl 2,2,3,3-tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl)ethylene oxide, (2,2,3,3,4,4,5,5, [00147] The invention relates to ethylene oxide comprising: (1,2,6,7,7,7-tridecafluoroheptyl)oxirane, (2,2,3,3,4,4,5,5,6,7,7,7-dodecafluoro-6-(trifluoromethyl)heptyl]oxirane, (2,2,3,3,4,4,5,5,6,7,7,8,9,9,9-hexadecfluoro-8-(trifluoromethyl)nonyl]oxirane, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-heneicosfluoroundecyl)oxirane, and combinations thereof.

13. The flow cell of claim 10, wherein: The two monomers of the three monomers are the two different epoxy-substituted silsesquioxane monomers; The two different epoxy-substituted silsesquioxane monomers consist of epoxycyclohexylethyl polysilsesquioxane and glycidyl polysilsesquioxane; and The two different epoxy-substituted silsesquioxane monomers are present in a mass ratio ranging from about 3:7 to about 7:

3.

14. The flow cell of claim 10, wherein: The two monomers of the three monomers are the two different epoxy-substituted cyclosiloxane monomers; The two different epoxy-substituted cyclosiloxane monomers consist of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidylcyclotetrasiloxane; and The two different epoxy-substituted cyclosiloxane monomers are present in a mass ratio ranging from about 3:7 to about 7:

3.

15. The flow cell of claim 10, wherein: The two monomers of the three monomers are the two different non-silicone epoxy monomers; The two different non-silicone epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl)adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, 1,2-cyclohexanedicarboxylic acid diglycidyl ester, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate; and The two different non-silicone epoxy monomers are present in a mass ratio ranging from about 4:1 to about 1:

4.

16. A method comprising: A nanoimprint lithography (NIL) resin composition is deposited on a substrate, the NIL resin composition comprising: There are three monomers in total, among which: Two of the three monomers are selected from the group consisting of: two different epoxy silsesquioxane monomers; two different epoxy cyclosiloxane monomers; and two different non-silicone epoxy monomers; and The third monomer of the three monomers is a fluorinated monomer, the fluorinated monomer being present in an amount ranging from about 0.5 mass % to about 4 mass % based on the total solid content of the NIL resin composition; photoinitiator; and Solvents; Nanoimprinting the deposited NIL resin composition using a working stamp; and The deposited NIL resin composition is cured to form a cured patterned resin.

17. The method of claim 16, wherein the fluorinated monomer is selected from the group consisting of: 2,2'-(2,2,3,3,4,4,5,5-octafluorohexane-1,6-diyl)bis(ethylene oxide), glycidyl 2,2,3,3,4,4,5,5-octafluoropentyl ether, glycidyl 2,2,3,3-tetrafluoropropyl ether, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,9-heptadecafluorononyl)ethylene oxide, (2,2,3,3,4,4,5,5,6,6,7,7,7-tridecafluoroheptyl)ethylene oxide, 2,2,3,3,4,4,5,5,6,7,7,7-dodecafluoro-6-(trifluoromethyl)heptyl]ethylene oxide, 2,2,3,3,4,4,5,5,6,6,7,7,8,9,9,9-hexadecanoyl-8-(trifluoromethyl)nonyl]ethylene oxide, (2,2,3,3,4,4,5,5,6,6,7,7,8,8,9,9,10,10,11,11,11-heneicosfluoroundecyl)ethylene oxide, and combinations thereof.

18. The method of claim 16, wherein: The two monomers of the three monomers are the two different epoxy-substituted silsesquioxane monomers; The two different epoxy-substituted silsesquioxane monomers consist of epoxycyclohexylethyl polysilsesquioxane and glycidyl polysilsesquioxane; and The two different epoxy-substituted silsesquioxane monomers are present in a mass ratio ranging from about 3:7 to about 7:

3.

19. The method of claim 16, wherein: The two monomers of the three monomers are the two different epoxy-substituted cyclosiloxane monomers; The two different epoxy-substituted cyclosiloxane monomers consist of epoxycyclohexyltetramethylcyclotetrasiloxane and glycidylcyclotetrasiloxane; and The two different epoxy-substituted cyclosiloxane monomers are present in a mass ratio ranging from about 3:7 to about 7:

3.

20. The method of claim 16, wherein: The two monomers of the three monomers are the two different non-silicone epoxy monomers; The two different non-silicone epoxy monomers are independently selected from the group consisting of trimethylolpropane triglycidyl ether, 3,4-epoxycyclohexylmethyl-3,4-epoxycyclohexanecarboxylate, bis((3,4-epoxycyclohexyl)methyl)adipate, 4-vinyl-1-cyclohexene 1,2-epoxide, vinylcyclohexene dioxide, 4,5-epoxytetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, glycidyl methacrylate, 1,2-epoxyhexadecane, poly(ethylene glycol) diglycidyl ether, pentaerythritol glycidyl ether, 1,2-cyclohexanedicarboxylic acid diglycidyl ester, tetrahydrophthalic acid diglycidyl ester, 1,2-epoxy-3-phenoxypropane, and glycidyl methacrylate; and The two different non-silicone epoxy monomers are present in a mass ratio ranging from about 4:1 to about 1:

4.

21. The method of claim 16, wherein: Curing is performed using a 365 nm UV light source; and The deposited NIL resin composition is exposed to ultraviolet light for a time ranging from about 3 seconds to about 30 seconds.

Images