Humanized monoclonal antibody for blocking PLK3 and application thereof

Abstract

The invention relates to the field of biological engineering and biological treatment, in particular to a humanized monoclonal antibody targeting Polo-like kinase 3 (PLK3) and application of the humanized monoclonal antibody in resisting human immunodeficiency virus infection and tumor immunity. According to the humanized PLK3 monoclonal antibody provided by the invention, the heterology of the antibody can be reduced by the prepared humanized PLK3 monoclonal antibody, and clinical application is facilitated. The humanized monoclonal antibody prepared aiming at the human PLK3 can realize the function of treating AIDS, the function of enhancing the killing function of CTL on tumor cells and a new strategy for treating malignant tumors by being combined with NK cells, the safety of an antibody drug is improved, the antibody drug stays at a theoretical level, and clinical practical application can be realized.

Description

Technical Field

[0001] The present invention relates to the fields of bioengineering and biotherapy, and in particular to a humanized monoclonal antibody targeting Polo-like kinase 3 (PLK3) and its application in anti-human immunodeficiency virus infection and anti-tumor immunity. Background Art

[0002] Acquired immunodeficiency syndrome (AIDS) has always been a major public health problem in my country and even in the world. There is no effective cure strategy so far. Although antiretroviral therapy can inhibit the replication of human immunodeficiency virus (HIV) in the body and reduce the plasma viral load to below the detection limit, it cannot eliminate the integrated virus lurking in HIV reservoir cells. Once the drug is stopped, the virus is quickly released from the reservoir and spreads in the body, and the viral load quickly rebounds to the pre-treatment level, so infected people need to take medication for life. The existence of viral reservoirs is the fundamental reason why AIDS cannot be cured. Therefore, there is an urgent need to establish methods for accurately detecting the size of the reservoir and safely and effectively clearing the reservoir.

[0003] Malignant tumors are a major public health problem worldwide and the primary factor contributing to the global disease burden. my country ranks first in the world in terms of new cancer cases and deaths, and the burden of malignant tumors in my country is increasing. The treatments for malignant tumors mainly include: surgical treatment, radiotherapy and chemotherapy, hormone therapy and targeted therapy, but they are often accompanied by serious side effects and are not effective for patients in the middle and late stages. As an emerging treatment method, immunotherapy has become an important treatment for many tumors. However, current immune checkpoint blockade therapy and cell therapy therapies have limitations such as low response rate and complex operation, which makes them difficult to widely promote. Therefore, there is an urgent need to develop new treatment strategies for anti-tumor immunotherapy, which is of great significance for prolonging patient survival and improving patient prognosis.

[0004] Antibodies have the ability to clearly and highly specifically target and bind to antigens, and have played an increasingly important role in basic research and clinical treatment. They are widely used in the fields of biopharmaceuticals and immunotherapy, such as the treatment of infectious diseases, malignant tumors, and autoimmune diseases. The safety of therapeutic antibodies is one of the important factors affecting their clinical application. Non-human antibodies can induce immune responses, and the neutralization reactions produced by the use of non-human antibodies will limit the application of antibody drugs in the treatment of human diseases and hinder the development of therapeutic antibodies.

[0005] Tumor immunotherapy mainly includes two categories: drug immunotherapy and cell immunotherapy. The first type of drug immunotherapy is to inhibit tumor immune negative regulatory receptors, such as PD-1. PD-1 monoclonal antibodies can relieve the immunosuppression of T cells, reactivate T cells and enhance their ability to attack tumor cells. This type of drug has shown significant efficacy in a variety of malignant tumors (such as melanoma, non-small cell lung cancer, renal cell carcinoma, etc.). However, PD-1 monoclonal antibodies have only shown significant efficacy in some patients, and a considerable number of patients still have no significant response to PD-1 monoclonal antibody treatment. As the treatment progresses, tumor cells may escape the attack of the immune system through various mechanisms, leading to drug resistance problems. Therefore, it is urgent to find new immune checkpoints and develop humanized monoclonal antibodies as therapeutic drugs. The second type of cell immunotherapy is to screen and amplify immune cells with efficient tumor recognition activity, cultivate and activate a large number of effector cells in vitro, restore the anti-tumor function of the immune system, and exert good anti-tumor effects. In recent years, there have been more and more clinical studies on cell immunotherapy for solid tumors. Some cell therapies have been approved for clinical use abroad due to their good efficacy and safety, which will bring new hope to tumor patients. NK cells are an important component of the innate immune system and have the natural ability to kill tumor cells and virus-infected cells. As a type of cell therapy, NK cells can directly kill tumor cells through a variety of mechanisms (such as releasing perforins and granzymes, and expressing death receptor ligands). In addition, NK cells also regulate the functions of other immune cells by secreting cytokines, thereby indirectly enhancing anti-tumor immune responses. In recent years, NK cell therapy has become an important research direction for tumor immunotherapy due to its rapid and potent anti-tumor effects. However, immunosuppressive factors in the tumor microenvironment may inhibit the immune function of NK cells, making it difficult for them to effectively exert their anti-tumor effects. Therefore, the combination of new immune checkpoint humanized monoclonal antibodies and NK cells in the treatment of malignant tumors will improve the effectiveness of tumor immunotherapy.

[0006] In addition to the PD-1 / PD-L1 pathway, there are other immune checkpoints that affect the killing effect of immune cells. We have identified a new immune checkpoint, PLK3, and using its humanized monoclonal antibody to block its pathway can significantly enhance the effect of NK cells in killing tumor cells. The combination of PLK3 monoclonal antibody and NK cell therapy for malignant tumors can significantly improve the response rate of treatment and the efficacy of immunotherapy, and achieve better clinical treatment results. Summary of the invention

[0007] In view of the problems existing in the prior art, the present invention provides a humanized PLK3 monoclonal antibody and its application, which can achieve the function of treating AIDS, enhance the function of CTL killing tumor cells, and a new strategy for combining with NK cells to treat malignant tumors.

[0008] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions.

[0009] The present invention discloses a humanized PLK3 monoclonal antibody, comprising a heavy chain variable region and a light chain variable region, characterized in that: the amino acid sequence of the heavy chain variable region VH is as shown in SEQ ID NO: 1, and the amino acid sequence of the light chain variable region VL is as shown in SEQ ID NO: 2.

[0010] The present invention also discloses a humanized PLK3 monoclonal antibody, comprising a heavy chain variable region and a light chain variable region, characterized in that: the amino acid sequence of the heavy chain variable region VH is as shown in SEQ ID NO: 3, and the amino acid sequence of the light chain variable region VL is as shown in SEQ ID NO: 4.

[0011] The present invention also discloses a use of any one of the above humanized PLK3 monoclonal antibodies in preparing a product for detecting HIV virus.

[0012] The present invention also discloses a use of any one of the above humanized PLK3 monoclonal antibodies in the preparation of a drug for treating HIV virus.

[0013] The present invention also discloses a use of any one of the above humanized PLK3 monoclonal antibodies in the preparation of a research reagent for preventing and treating HIV virus infection.

[0014] The present invention also discloses a tumor drug preparation, characterized in that the drug preparation comprises any one of the above humanized PLK3 monoclonal antibodies or any one of the above humanized PLK3 monoclonal antibodies combined with cytotoxic T lymphocytes.

[0015] The present invention also discloses a sensitizer for enhancing the killing ability of cytotoxic T lymphocytes, characterized in that it comprises any one of the above humanized PLK3 monoclonal antibodies.

[0016] The present invention also discloses a pharmaceutical composition, characterized in that the pharmaceutical composition comprises any one of the above-mentioned PLK3 monoclonal antibodies, NK cells and chemotherapy drugs.

[0017] The present invention also discloses a sensitizer for NK cell immunotherapy, characterized in that the sensitizer comprises any one of the above-mentioned humanized PLK3 monoclonal antibodies.

[0018] The present invention also discloses the use of the above-mentioned tumor drug preparation or the above-mentioned cytotoxic T lymphocyte killing ability sensitizer or the above-mentioned pharmaceutical composition or the above-mentioned NK cell immunotherapy sensitizer in the preparation of drugs for treating malignant tumors.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows.

[0020] The present invention constructs a humanized PLK3 monoclonal antibody for the first time, including a heavy chain variable region and a light chain variable region, which can realize the detection and clearance of HIV reservoirs, reduce the heterogeneity of antibodies, improve the response rate of tumor treatment, and is conducive to clinical application.

[0021] Previous HIV reservoir detection methods require strong cell activation in vitro, which leads to changes in the physiological (resting) characteristics of infected cells, and because the reservoir size is overestimated due to the inability to distinguish whether the provirus is intact, the detection results are not true and accurate enough and cannot be applied clinically. The present invention inhibits or eliminates the activity of PLK3 protein through humanized PLK3 monoclonal antibodies, achieving non-activation of reservoir cells, that is, maintaining the physiological state of reservoir cells while triggering cells to release a large number of progeny viruses, thereby detecting the virus under physiological conditions, and the infected cells are eliminated by the immune system or antiviral drugs, which can be applied clinically.

[0022] The humanized PLK3 monoclonal antibody used in the present invention can promote the immune killing of tumor cells by CTL, and the effect is better when used in combination with other anti-tumor drugs. It solves multiple bottleneck problems in existing immunotherapy, including: immunosuppression, low response rate of PD-1 antibody drugs, immune tolerance, etc., provides new targets and treatment strategies for anti-tumor immunotherapy, and has important practical value.

[0023] The present invention proposes for the first time to achieve dual immune activation through the combined use of PLK3 monoclonal antibody and NK cells. PLK3 monoclonal antibody restores the anti-tumor function of immune cells, and NK cells directly kill tumor cells. The synergistic effect of the two improves the therapeutic effect and the intensity and durability of the anti-tumor response. Compared with the NK cell therapy method, the present invention effectively avoids the immune escape of tumor cells and reduces the drug resistance of tumor cells by blocking the PLK3 pathway. The present invention overcomes the difficulty of maintaining the activity and persistence of NK cells in existing therapies, effectively transforms the tumor microenvironment through combined therapy, enhances the killing efficiency and persistence of NK cells, and provides a more lasting therapeutic effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Flow chart for the preparation of humanized PLK3 monoclonal antibodies.

[0025] Figure 2 A graph showing the binding ability of humanized PLK3 monoclonal antibody to PLK3 antigen.

[0026] Figure 3 This is a comparison of the infection ability of humanized PLK3 monoclonal antibodies against HIV in the supernatant.

[0027] Figure 4This is a comparison chart of the humanized PLK3 monoclonal antibody and the HIV p24 content in the supernatant.

[0028] Figure 5 Comparison of the effect of humanized PLK3 monoclonal antibody on the viral particle-associated genomic RNA content in the supernatant.

[0029] Figure 6 Humanized PLK3 monoclonal antibody against CD4 + Diagram of the effects of HIV infection on T cell release.

[0030] Figure 7 Humanized PLK3 monoclonal antibody against CD4 + Graph showing the effect of T lymphocytes on the amount of progeny virus produced.

[0031] Figure 8 Humanized PLK3 monoclonal antibody against CD4 + Diagram of the effects of HIV infection on T cell release.

[0032] Fig. 9 Humanized PLK3 monoclonal antibody against CD4 + Graph showing the effect of T lymphocytes on the amount of progeny virus produced.

[0033] Fig.10 This is a comparison of the effects of humanized PLK3 monoclonal antibody and PD-1 monoclonal antibody on CTL killing of human non-small cell lung cancer cell line A549.

[0034] Fig.11 This is a comparison of the effects of humanized PLK3 monoclonal antibody and PD-1 monoclonal antibody on CTL killing of human non-small cell lung cancer cell line A549.

[0035] Fig.12 This is a comparison of the effects of humanized PLK3 monoclonal antibody and PD-1 monoclonal antibody on CTL killing of human non-small cell lung cancer cell line A549.

[0036] Fig.13 Schematic diagram of medication and cell infusion time for the combined use of PLK3 monoclonal antibody and NK cells.

[0037] Fig.14 The effect diagram of the combined application of PLK3 monoclonal antibody and NK cells.

[0038] Fig.15 Graph showing changes in target lesion tumor size following NK cell therapy.

[0039] Fig.16 Changes in target lesion tumor size in the combined treatment of PLK3 monoclonal antibody and NK cells. DETAILED DESCRIPTION

[0040] The present invention is further described in detail below with specific embodiments, but it should not be understood that the scope of the above subject matter of the present invention is limited to the following embodiments, and all technologies realized based on the content of the present invention belong to the scope of the present invention.

[0041] Unless otherwise specified, all reagents and materials used in the present invention are commercially available.

[0042] Example 1: Preparation process of humanized PLK3 monoclonal antibody.

[0043] 1. Construction and amplification of phage library.

[0044] Phage libraries HDB169 and HDB323 were constructed from the same set of donors with variable CDRH3 genes. They have the same germline, including constant CDRH1, CDRH2 and random CDRH3. Before each round of panning, the library was amplified and induced to obtain Fab-displaying phage. First, 50mL × L1-blue cells were grown in 2YT medium containing 10µg / mL TET until the OD value reached 0.6~0.8, infected with phage, added 1µM IPTG, and grown at 37℃ for 3h. The phage supernatant was collected by centrifugation and purified by PEG according to standard methods. The purified phage was resuspended in 1mL PBS and stored at 4℃. Input phage No. 1 was obtained from 5×10 10 The output phages amplified from the original phages are used as the input phages for the next round of amplification.

[0045] 2. Affinity screening of phage library against PLK3.

[0046] Add 1 mL of antigen to the immunotube and incubate overnight at 4°C for antigen coating. Use 1% BSA at 5 × 10 12Resuspend the input phage No. 1 at a density of 100 pfu / mL and incubate in a casein-coated immunotube for 2 hours. The phage to be selected was rotated and incubated in an immunotube coated with PLK3 for 2 hours, washed 10-15 times with PBST to remove unbound phage, and then rotated and incubated with PBS containing 0.5µg / mL PLK3 antibody for 2 hours. The bound phage was eluted with 1mL of freshly prepared 100mM triethylamine and neutralized with 0.5mL of 1M Tris-HCl at pH=6.4, and transferred to a new 1.5mL Ep tube, marked as output phage No. 1 (O1), and used as input phage No. 2 for the second round of affinity screening. The same method was used for three affinity screenings to obtain output phage No. 3 (O3), which was stored on ice.

[0047] 3. Screen and sequence Fab-positive phages from the O3 phage pool.

[0048] O3 phage was plated at a density of 300 pfu per plate and grown at 37°C for 8 h before binding to anti-κ antibody-coated filters overnight at 22°C. Biotinylated anti-HA at a dilution of 1:500 and NeutrAvidin-AP conjugate at a dilution of 1:1000 were added to the filters to detect Fab-positive phages, which were picked and eluted with 100 µL phage elution buffer. The Fab gene was amplified by PCR in Fab-positive phages, with the upstream amplification primer sequence (Fab-F): CACTCATTAGGCACCCCAGG and the downstream primer amplification sequence (Fab-VH-R): GTAGTCCTTGACCAGGCA. The sequences were sequenced, with the upstream sequencing primer (Fab-VH-R): GTAGTCCTTGACCAGGCA and the downstream sequencing primer (Fab-VK-R): TACTTTGGCCTCTCTGGGATA. The VL and VH sequences were analyzed to identify unique targets and determine target diversity. Phage single-point ELISA (SPE) was then performed. 96-well Greiner plates were coated with antigen overnight at 4°C and blocked with 1% casein. High-titer antigen-positive clone (HT) phage was blocked with 0.1% casein for 1 hour and then incubated on the antigen plate for 2 hours. The plate was washed with PBST. Anti-M13-HRP was diluted 1:5000 with 1% casein to detect phage bound to the antigen. 10-15µL of the eluted phage was used to infect 1mL of XL1-blue cells to prepare high-titer phage. The obtained high-titer phage was first grown in 15mL of XL1-blue cells and induced with IPTG for 3 hours, and then the induced phage was purified by PEG. The phage titer should be determined before the experiment.

[0049] 4. Preparation and Purification of PLK3 Antibody.

[0050] (1) Resuscitate 293F cells according to ATCC standard procedures and culture in FreeStyle™ 293 Expression Medium until the cell density reaches 1-2×10 6 The cells were centrifuged at 1000 rpm for 5 min to remove the culture medium, the bottom of the tube was tapped to loosen the cell pellet and resuspended in pre-warmed FreeStyle™ 293 Expression Medium, and the cells were counted and the culture medium was 1-3 × 10 5 The cells were plated at a density of 10 cells / mL and cultured at 37°C, 8% CO2, and 125 rpm.

[0051] (2) For each transfection sample, use Opti-MEM ® I Dilute a total of 15 µg of plasmid DNA to a total volume of 0.5 mL and gently mix (the optimal mass ratio of light chain and heavy chain plasmids is 1:1. For each transfection, use 7.5 µg of plasmid DNA encoding the light chain and 7.5 µg of plasmid DNA encoding the antibody heavy chain); At the same time, use Opti-MEM ® IDilute 30µL of 293fectin™ reagent to 0.5mL, mix well and incubate at room temperature for 5min. Add the diluted plasmid to the diluted 293fectin™ reagent, mix well and incubate at room temperature for 20min to form DNA-lipid complexes.

[0052] (3) Digest 293F cells and resuspend 1.5×10 cells in 14 mL of culture medium. 7 The cells were placed in a 125 mL conical flask, 1 mL of DNA-liposome complex was added to 14 mL of cell suspension, and the cells were cultured at 37 ° C, 8% CO2, and 125 rpm. After 24 hours, 15 mL of preheated culture medium was added to the conical flask to continue the culture. After 4 days, the supernatant was collected by centrifugation at 300 g and 4 ° C for 3 minutes, and the supernatant was transferred to a new tube, and the cell debris was removed by centrifugation at 5000 g and 4 ° C for 5 minutes (or filtered with a 0.22 µm syringe filter), and the supernatant was transferred to another new tube. 10 µL of supernatant was taken from each sample for SDS-PAGE electrophoresis.

[0053] (4) The remaining supernatant was mixed with protein A IgG binding buffer at a ratio of 1:1 on ice. The stock resin was mixed by inversion and 500 µL was taken. The resin was rotated at 200 g for 2 min. The supernatant was carefully removed. The resin was resuspended in 500 µL of 1× PBS. The resin was rotated at 200 g for 2 min. The supernatant was carefully removed. Repeat twice. The protein A agarose resin was then bound to the sample and rotated at 10 rpm at 4°C overnight.

[0054] (5) Equilibrate the column with 4 mL of binding buffer restored to room temperature, add the sample resin mixture to the equilibrated column, let it flow through the column by gravity, and then wash the column with 10 mL of preheated binding buffer. Be careful not to let the column dry. Prepare and label 10 Eppi tubes for each sample and add 50 µL of neutralization buffer to each Eppi tube. Add 3 mL of elution buffer restored to room temperature to the column and plug it with a stopper. After standing for 2 minutes, remove the stopper and collect 500 µL of eluate in each Eppi tube in turn. Vortex briefly after collection and add 2 mL of elution buffer to the column after collecting 5-6 Eppi tubes. Determine the protein concentration in each Eppi tube. For each sample, add the portion with higher protein concentration (usually in Eppi tubes 1-5) to the Amicon filter and spin at 3700g in a rotor at 4°C for 20-40 minutes (or until the retained sample volume reaches 100 µL). Remove the collection tubes and add 4 mL of 1× PBS to each filter. Collect the remaining liquid containing the sample IgG1 antibody into a new Eppendorf tube. The concentration of each sample can be measured using the Pierce™ BCA Protein Assay Kit (following the protocol provided in the kit). Figure 1 ).

[0055] Example 2.

[0056] Binding experiments showed that the constructed humanized PLK3 monoclonal antibody has the ability to recognize and bind to the target PLK3 protein. The specific detection steps are as follows: 0.25µg PLK3 humanized monoclonal antibody was coated on the ELISA plate, or no antibody was coated (no coat), and incubated overnight at 4°C; the plate was blocked with 200µL / well of 1% casein, and blocked at room temperature for 1h; peptide-PLK3 was blocked with 200µL / well of 0.1% BSA at room temperature for 1h; 0.25µg peptide-PLK3 was added to the plate and incubated at room temperature for 2h; 50µL / well of Streptavidin-HRP was added to the plate and incubated at room temperature for 1h; the plate was washed 3 times with 200µL / well of washing solution, and the absorbance value was detected using TMB solution ( Figure 2 ).

[0057] Example 3.

[0058] The heavy chain and light chain sequences of the five antibodies are shown in the following table: Note: Positive antibodies are antibodies that can effectively block the activity of PLK3 protein; negative antibodies are antibodies that cannot block the activity of PLK3 protein.

[0059] Example 4.

[0060] Humanized PLK3 monoclonal antibody was used to block the enzymatic activity of PLK3 protein, thus enhancing HIV infection ability. The specific experimental steps are as follows: 1×10 6 293T cells / well were plated and cultured at 37°C, 5% CO2. For each transfection sample, a total of 2µg of plasmid DNA was diluted to a total volume of 50µL using DMEM and gently mixed (1µg of plasmid DNA for pcDNA3.1-PLK3 and pNL4.3); at the same time, 6µL of LipoD293™ transfection reagent was diluted to 50µL using DMEM, and the diluted LipoD293™ reagent was added to the diluted plasmid, mixed and incubated at room temperature for 10min to form DNA liposome complexes. 100µL of DNA liposome complexes were added to 1mL of cell culture medium. After 6h of transfection, 1mL of fresh culture medium was replaced and 10µg of humanized PLK3 monoclonal antibody was added. After 48h of treatment, the supernatant was used to infect 2×10 5 TZM-bl reporter cells were used to obtain the infection level of the virus. The background RLU ( Figure 3 ).

[0061] When treated with humanized PLK3 monoclonal antibody, the transcription level of HIV Gag in 293T cells was not affected, while the core antigen p24 of viral particles in the culture supernatant increased. The specific experimental steps are as follows: using the pre-treatment steps similar to those in this example, the supernatant was taken for HIV p24 ELISA detection ( Figure 4 ), total RNA was extracted from 293T cells for qPCR to quantify Gag transcripts, and normalized to the internal reference gene glyceraldehyde phosphate dehydrogenase ( Figure 5 ).

[0062] Example 5.

[0063] Using humanized PLK3 monoclonal antibody to block the enzymatic activity of PLK3 protein, we observed that peripheral blood-derived CD4 + The specific experimental steps are as follows: 30 mL of peripheral blood samples were collected from HIV-infected patients who had not received combined antiviral treatment and anti-coagulated with potassium ethylenediaminetetraacetic acid. The peripheral blood was subjected to density gradient centrifugation using Ficoll lymphocyte separation medium to separate PBMCs. Then, EasySep™ HumanCD4 + T Cell Enrichment Kit for CD4 + T lymphocytes, at 2×10 6 CD4 +The separated CD4 + T lymphocytes were added with 10 µg / mL humanized PLK3 monoclonal antibody, or 100 U / mL interleukin-2 and 25 µL Dynabeads ® Human T Activator CD3 / CD28 / 1×10 6 After 48 h of culture, the supernatant was used to infect 2×10 5 TZM-bl reporter cells were used to obtain the infection level of the virus. The background RLU ( Figure 6 ).

[0064] When treated with humanized PLK3 monoclonal antibody, the amount of progeny virus produced by CD4+T cells of HIV-infected individuals who have not received combined antiviral therapy also increased significantly. The specific experimental steps are as follows: Using the pre-treatment steps similar to those in this example, the amount of progeny virus produced in the cell supernatant was detected by ultrasensitive p24 ELISA method ( Figure 7 ).

[0065] Example 6.

[0066] Using humanized PLK3 monoclonal antibody to block the enzymatic activity of PLK3 protein, we observed that peripheral blood-derived CD4 + The specific experimental steps are as follows: 30 mL of peripheral blood samples anticoagulated with EDTA dipotassium were collected from HIV-infected patients receiving combined antiviral therapy, and the peripheral blood was subjected to density gradient centrifugation using Ficoll lymphocyte separation medium to separate PBMCs; then EasySep™ Human CD4 + T Cell Enrichment Kit for CD4 + T lymphocytes, at 2×10 6 CD4 + The cells were plated at a density of 100 μg / mL T lymphocytes / mL and cultured at 37°C with 5% CO2. The isolated cells were added with 10 μg / mL humanized PLK3 monoclonal antibody, or 100 U / mL interleukin-2 and 25 μL Dynabeads ® Human T Activator CD3 / CD28 / 1×10 6 After 48 h of culture, the supernatant was used to infect 2×10 5 TZM-bl reporter cells were used to obtain the infection level of the virus. The background RLU ( Figure 8 ).

[0067] When treated with humanized PLK3 monoclonal antibody, the amount of progeny virus produced by CD4+T cells of HIV-infected patients receiving combined antiviral therapy also increased significantly. The specific experimental steps are as follows: using the pre-treatment steps similar to those in this example, the amount of progeny virus produced in the cell supernatant was detected by ultrasensitive p24 ELISA method ( Fig. 9 ).

[0068] Example 7.

[0069] Blocking the enzymatic activity of PLK3 protein using humanized PLK3 monoclonal antibody can enhance CD8 + The specific experimental steps are as follows: On day 0, 100 mL of peripheral blood from healthy subjects was collected, and Ficoll lymphocyte separation medium was used for density gradient centrifugation to separate PBMCs. 6 The cells were plated at a density of 10 cells / 3 mL and cultured in an incubator. After the mononuclear cells adhered to the wall for 2-3 hours, the cells were gently blown and washed repeatedly. The non-adherent cells were transferred to a new centrifuge tube and purified using EasySep™ Human CD8 + T Cell Enrichment Kit for CD8 + T lymphocytes, and 2×10 6 / mL was cultured in RPMI1640 medium containing 10% FBS; 2mL of RPMI 1640 medium (1× concentration medium) containing 10% FBS, 100ng / mL IL-4 and 100ng / mL GM-CSF was added to the well plate and continued to culture to induce monocytes into dendritic cells. On the second day, 1mL of RPMI1640 medium (2× concentration medium) containing 10% FBS, 200ng / mL IL-4 and 200ng / mL GM-CSF was replaced; CD8 + T cells were supplemented with 100 U / mL interleukin-2 and 25 µL Dynabeads ® Human T Activator CD3 / CD28 / 1×10 6On the 4th day, 1 mL of 2× concentration culture medium was replaced. On the 5th day, monocytes were induced to differentiate into dendritic cells. Tumor antigen 50 μg / mL (human non-small cell lung cancer cell line A549, human gastric cancer cell line MKN-45 or human cervical cancer cell line HeLa) was added to the dendritic cells for stimulation for 16 hours to allow the dendritic cells to take up tumor antigens. On the 6th day, the culture medium of dendritic cells was replaced with RPMI1640 medium containing 10% FBS, and TNF-α (10 ng / mL) was added and cultured for a further 24 hours to induce them into mature dendritic cells. On the 7th day, CD8 + T cells were co-cultured with dendritic cells, and IL-7 (10 ng / mL) was added and cultured for 24 h. On day 8, IL-10 (10 ng / mL) was added. On day 15, CD8 + T cells (i.e., cytotoxic CD8 + T cells) and counted, based on 2×10 6 / mL density was inoculated in a 6-well plate, and 10μg / mL of humanized PLK3 monoclonal antibody was added for 24h. PD-1 monoclonal antibody was used as a positive control. + T cells and target cells were mixed at a ratio of 4:1 and co-cultured for 48 h. Flow cytometry was used to detect CD8 + The results showed that humanized PLK3 monoclonal antibody can significantly enhance the killing of CD8 + The killing effect of T cells on human non-small cell lung cancer cell line A549, human gastric cancer cell line MKN45 and human cervical cancer cell line HeLa, such as Fig.10 , 11 , as shown in Figure 12.

[0070] Example 9.

[0071] Patients with extensive-stage small cell lung cancer (ES-SCLC) were included. The inclusion criteria included: 1) patients with histologically confirmed ES-SCLC who had never been treated; 2) aged 18-75 years, regardless of gender; 3) performance status (ECOG) score 0-2 points; 4) expected survival of more than 3 months; 5) patients with measurable target lesions (according to RECIST V1.1); 6) patients with asymptomatic or stable brain metastases after local radiotherapy. The medication and cell infusion time are as follows: Fig.13 NK cell therapy: 50 mL of peripheral blood was collected one day before the medication cycle, and NK cells were isolated and expanded in vitro; the first NK cell infusion was completed on the 14th day (cell number 1×10 6If no intolerable toxicity occurs, 50 mL of peripheral blood will be collected on the 21st day of the medication cycle for the second cycle of NK cell therapy, and so on. Chemotherapy or PLK3 monoclonal antibody combined with chemotherapy: PLK3 monoclonal antibody 200 mg, d1; etoposide 100 mg / m 2 , d1-3; carboplatin AUC=5, d1 or cisplatin 75 mg / m 2 , d1. Q3W, 4~6 cycles (according to the investigator's judgment). If there is no disease progression and no intolerable toxicity occurs, autologous NK cells or PLK3 monoclonal antibody combined with autologous NK cells will continue to be used for maintenance treatment. The overall treatment time shall not exceed 2 years (≤35 cycles). Survival follow-up showed that the median progression-free survival (PFS) of NK cell therapy was 6 months (95% CI: 3.358-8.642), the 6-month PFS was 46% (95% CI: 18.05-74.25), and the 1-year PFS was 30.77% (95% CI: 5.68-55.86); the median progression-free survival (PFS) of PLK3 monoclonal antibody combined with NK cell therapy was 8 months (95% CI: NR-30.899), the 6-month PFS was 61.54% (95% CI: 35.08-88.00), and the 1-year PFS was 46.2% (95% CI: 26.76-81.04). Fig.14 In the analysis of target lesion remission, NK cell therapy achieved 100% reduction in the maximum tumor size of target lesions in 0 patients; PLK3 monoclonal antibody combined with NK cell therapy achieved 100% reduction in the maximum tumor size of target lesions in 2 patients, as shown in Figure 2. Fig.15 and Fig.16 shown.

[0072] In summary, the present invention provides a humanized PLK3 monoclonal antibody. The prepared humanized PLK3 monoclonal antibody can detect and eliminate HIV reservoirs, reduce the heterogeneity of antibodies, improve the response rate of tumor treatment, and is conducive to clinical application; HIV-1 infected cells are treated with the monoclonal antibody to release progeny viruses, which can be used to accurately detect and eliminate such infected cells, and finally achieve the function of treating AIDS. In addition, the monoclonal antibody is used to block PLK3 on the surface of cytotoxic T lymphocytes (CTL), enhance the function of CTL to kill tumor cells, and finally achieve the function of anti-tumor treatment. At the same time, the present invention also provides a new strategy for treating malignant tumors with PLK3 monoclonal antibodies combined with NK cells. This strategy uses PLK3 monoclonal antibodies combined with autologous peripheral blood-derived NK cells, or allogeneic peripheral blood-derived NK cells, or allogeneic umbilical cord blood-derived NK cells, or induced pluripotent stem cells (iPSC)-derived NK cells for treatment, while activating adaptive immunity and innate immunity, improving the overall anti-tumor effect, and enhancing the treatment response rate. Combination therapy uses multiple attack mechanisms to make it difficult for tumor cells to evade the immune system's attack through a single escape mechanism, thereby reducing the problem of drug resistance. In addition, combination therapy changes the tumor microenvironment, which is more conducive to the infiltration and activity of NK cells and improves their persistence in the body, thereby improving the anti-tumor effect and providing a safer, more effective and lasting treatment option for malignant tumors.

[0073] The above description is only a preferred embodiment of the present invention and is not intended to limit the scope of the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A humanized PLK3 monoclonal antibody, comprising a heavy chain variable region and a light chain variable region, characterized in that: The amino acid sequence of the heavy chain variable region VH is shown in SEQ ID NO:1, and the amino acid sequence of the light chain variable region VL is shown in SEQ ID NO:

2.

2. A humanized PLK3 monoclonal antibody, comprising a heavy chain variable region and a light chain variable region, characterized in that: The amino acid sequence of the heavy chain variable region VH is shown in SEQ ID NO:3, and the amino acid sequence of the light chain variable region VL is shown in SEQ ID NO:

4.

3. Use of the humanized PLK3 monoclonal antibody according to any one of claims 1 to 2 in the preparation of a product for detecting HIV virus.

4. Use of the humanized PLK3 monoclonal antibody according to any one of claims 1 to 2 in the preparation of a drug for treating HIV virus.

5. Use of the humanized PLK3 monoclonal antibody according to any one of claims 1 to 2 in the preparation of research reagents for preventing and treating HIV virus infection.

6. A tumor drug preparation, characterized in that: The pharmaceutical preparation comprises the humanized PLK3 monoclonal antibody according to any one of claims 1-2 or the humanized PLK3 monoclonal antibody according to any one of claims 1-2 combined with cytotoxic T lymphocytes.

7. A sensitizer for enhancing the killing ability of cytotoxic T lymphocytes, characterized in that: Comprising the humanized PLK3 monoclonal antibody according to any one of claims 1-2.

8. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the PLK3 monoclonal antibody, NK cells and chemotherapy drugs according to any one of claims 1-2.

9. A sensitizer for NK cell immunotherapy, characterized in that: The sensitizer comprises the humanized PLK3 monoclonal antibody according to any one of claims 1-2.

10. Use of the tumor drug preparation according to claim 6, the cytotoxic T lymphocyte killing ability sensitizer according to claim 7, the pharmaceutical composition according to claim 8, or the NK cell immunotherapy sensitizer according to claim 9 in the preparation of a drug for treating malignant tumors.

Images