Efficient connection kit for multiple gene segments applied to saccharomyces cerevisiae and in-vitro connection method for multiple gene segments

Abstract

The invention discloses an efficient connection kit for multiple gene segments applied to saccharomyces cerevisiae and an in-vitro connection method for the multiple gene segments. The kit provided by the invention comprises connecting plasmids: HCKanP, HC KanT, HCKanIGG6, HcAmp1, HcAmp2, HcAmp3 and HcKanWh, wherein the nucleotide sequences of the connecting plasmids are as shown in SEQ ID NO.1-7 in sequence; meanwhile, an in-vitro connection method of multiple gene segments is constructed, the defect that only 1-2 genes can be expressed through single transformation of traditional yeast is overcome, and the provided connection method can realize one-pot connection of connection of two transcription units and eight gene segments at most in a single time, so that the transgenic efficiency of the saccharomyces cerevisiae is multiplied. The gene fragment in-vitro assembly method developed by the invention is simple and efficient, can greatly improve the transgenosis efficiency of the saccharomyces cerevisiae, and has important significance for connecting a plurality of long fragment genes in the field of synthetic biology.

Description

Technical Field

[0001] The present invention belongs to the field of gene engineering technology, and more specifically, relates to a highly efficient ligation kit for multiple gene fragments in Saccharomyces cerevisiae and a multi-gene fragment in vitro ligation method. Background Art

[0002] Natural products are substances synthesized by organisms in nature. They are usually produced in plants, animals, microorganisms and other organisms, and have diverse structures and functions. They have an important impact on human life and health, play a role in the medical field, and provide rich resources for food and other industries. With the development of biotechnology, it is now possible to achieve large-scale synthesis of certain natural products in plants or microorganisms through biotechnology. This emerging discipline that brings together disciplines such as engineering, biology and computer science is called synthetic biology. Saccharomyces cerevisiae is a model eukaryotic microorganism. Due to its fast growth rate, mature genetic transformation system, and organelles similar to those of plant cells, it has now become one of the important microbial chassis in the field of synthetic biology.

[0003] When using synthetic biology to synthesize some natural products, it is often necessary to perform a large amount of metabolic engineering on our target organisms, including overexpression of endogenous or exogenous genes, knockout of genes related to endogenous competitive metabolic pathways, and introduction of key synthetic genes. In Saccharomyces cerevisiae, overexpression of exogenous genes requires the participation of promoter (PRO), open reading frame (ORF), and terminator (TER), which together form a transcription unit (TU). When performing transgenic operations, TUs must first be assembled in vitro and then transferred into the Saccharomyces cerevisiae genome. Therefore, the efficiency of the connection between fragments directly affects the efficiency of transgenics.

[0004] Seamless cloning (infusion) and Gibson assembly technology are conventional means for connecting gene fragments. Although these two methods are simple to operate and have efficient connection, since they need to obtain the connection fragments by PCR during the implementation process, there is a certain probability that base mutations will be introduced, and the more connected fragments, the higher the probability of mutations. The Golden Gate assembly technology is an important tool in synthetic biology, which is used to assemble DNA fragments efficiently and tracelessly. This technology is based on the principle of restriction endonucleases, allowing researchers to accurately assemble DNA fragments into target sequences through a series of enzyme cutting and connection steps. Through highly modular gene fragments, the connection method based on the Golden Gate assembly technology principle can efficiently complete the one-pot connection between different gene fragments. However, the application of this method to the in vitro connection of Saccharomyces cerevisiae has a connection limit. A single transformation can only express 1-2 genes, and at most 3-4 genes can only be expressed, and the connection efficiency of multiple gene fragments is low. At present, there is still a lack of products and methods that can efficiently connect multiple gene fragments. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the defects and shortcomings of the existing in vitro ligation of gene fragments in brewer's yeast, such as low transformation efficiency and inability to simultaneously transform multiple genes, and to provide an efficient ligation kit for multiple gene fragments in brewer's yeast and an in vitro ligation method for multiple gene fragments.

[0006] The purpose of the present invention is to provide a highly efficient ligation kit suitable for multiple gene fragments in Saccharomyces cerevisiae.

[0007] Another object of the present invention is to provide an efficient ligation kit for use in multiple gene fragments in Saccharomyces cerevisiae.

[0008] Another object of the present invention is to provide an in vitro ligation method for efficiently ligating gene fragments in Saccharomyces cerevisiae.

[0009] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0010] The present invention provides a connection kit for simultaneously transforming multiple gene fragments, comprising a promoter connection plasmid HCKan_P, a terminator connection plasmid HCKan_T, a gene fragment connection plasmid HCKan_IGG6, transcription unit assembly plasmids HcAmp_1, HcAmp_2, HcAmp_3, and a transcription unit connection plasmid HcKan_Wh, wherein the nucleotide sequences of the plasmids are shown in SEQ ID NO.1-7 in sequence.

[0011] The present invention combines infusion assembly technology, Golden Gate assembly technology and IGG6 sequence principle to develop a series of long fragments suitable for in vitro connection of Saccharomyces cerevisiae and its plasmid vector system Ys6Fab. In the Ys6Fab system constructed by the plasmid provided by the present invention, one transcription unit can express two genes, shortening the length of a single transcription unit (less a promoter and a terminator, about 800-1000bp), and breaking through the defect that only 1-2 genes can be expressed in a single transformation of traditional yeast; the system and method provided by the present invention can realize a one-pot connection of two transcription units and 8 gene fragments at most at a time, and a single transformation of Saccharomyces cerevisiae can realize the integration of 1-6 genes in Saccharomyces cerevisiae according to experimental requirements, so that the transgenic efficiency of Saccharomyces cerevisiae is doubled. The gene fragment in vitro assembly method developed by the present invention is simple and efficient, and has great application prospects in the field of synthetic biology.

[0012] Furthermore, the plasmid linker sequences of the connecting plasmids: HCKan_P, HCKan_T, HCKan_IGG6, HcAmp_1, HcAmp_2, HcAmp_3, HcKan_Wh are as follows:

[0013] HCKan_P: Pre-linker sequence 5'- CGTCTC GqG GAGACC -3', rear linker sequence 5'- GGTCTC TgT GAGACG -3';

[0014] HCKan_IGG6: Pre-linker sequence 5'- CGTCTC G JZ GAGACC -3', rear linker sequence 5'- GGTCTC TAGc GAGACG -3';

[0015] HCKan_T: front linker sequence 5'- CGTCTC gTAG GAGACC -3', rear linker sequence 5'- GGTCTC Tc GAGACG -3';

[0016] HcAmp_1: Pre-linker sequence 5'- GGTCTC TACCTgcta GAGACG -3', rear linker sequence 5'- CGTCTC acctcTGAGa GAGACC -3';

[0017] HcAmp_2: Pre-linker sequence 5'- GGTCTC TACCTgcta GAGACG -3', rear linker sequence 5'- CGTCTC acctcAGGCa GAGACC -3';

[0018] HcAmp_3: Pre-linker sequence 5'- GGTCTC AGGCggcta GAGACG -3', rear linker sequence 5'- CGTCTC acctcTGAGa GAGACC -3';

[0019] HcKan_Wh: Pre-linker sequence 5'- CGTCTC GGTCTC tCTCA-3', followed by a linker sequence 5'-AGGTa GAGACC GAGACG -3';

[0020] The underlined part in the above sequence is the restriction site.

[0021] Preferably, restriction endonucleases BsaI and BsmbI are also included.

[0022] The present invention provides application of the ligation kit in in vitro expression of exogenous genes.

[0023] The present invention provides application of the ligation kit in ligating different gene fragments in Saccharomyces cerevisiae.

[0024] The present invention provides a recombinant expression vector constructed by using the ligation kit.

[0025] The present invention provides a recombinant bacterium constructed by using the ligation kit.

[0026] The present invention also provides the use of the recombinant expression vector or recombinant bacteria in in vitro connection of multiple gene fragments.

[0027] The present invention provides an in vitro ligation method for efficiently ligating gene fragments in Saccharomyces cerevisiae. The plasmid in the ligation kit is used to respectively connect different promoters, open reading frames and terminators, and the connected promoters, open reading frames and terminators are assembled to obtain transcription units, and then a plurality of different transcription units are connected, and the transcription units are transferred into the genome of Saccharomyces cerevisiae.

[0028] Furthermore, HcKan_IGG6 plasmid was used to connect the open reading frames of two different gene fragments.

[0029] Preferably, the corresponding plasmid in the kit is selected according to the experimental requirements, and the one-pot ligation is completed by restriction endonuclease BsaⅠ or BsmbⅠ.

[0030] In addition, the present invention also provides application of the above method in the efficient assembly of multiple gene fragments.

[0031] The present invention has the following beneficial effects:

[0032] The kit provided by the present invention contains a series of in vitro connection plasmids of Saccharomyces cerevisiae that can connect multiple gene fragments, and a plasmid vector system and connection method are also constructed. In the plasmid vector system of the present invention, one transcription unit can express two genes, which not only shortens the fragment length (one promoter and one terminator are missing, about 800-1000bp), but also breaks through the defects that traditional yeast can only express 3-4 genes and a single transformation can only express 1-2 genes. The kit and method provided by the present invention can express 6-8 genes, and a maximum of two transcription units can be achieved at a time. The one-pot connection of 8 gene fragments connects, which doubles the transgenic efficiency of Saccharomyces cerevisiae. The in vitro assembly method of gene fragments developed by the present invention is simple and efficient, which can greatly improve the transgenic efficiency of Saccharomyces cerevisiae, and has great application prospects in the field of synthetic biology. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 These are the plasmid maps of HcKan and HcAmp (a in the figure: HcKan plasmid map; b: HcAmp plasmid map; c: positive clone and negative clone plasmids are distinguished by red and white colonies, red represents negative plasmids, and white represents positive plasmids).

[0034] Figure 2 Schematic diagram of the working principle of the Ys6Fab system.

[0035] Figure 3 is the connection order of different HcAmps.

[0036] Figure 4 The results of enzyme digestion verification of the ligation between promoter CDC19 and HcKan_P (left: actual enzyme digestion results; lane A: 15000 DNA marker; lane B: BsmBIⅠ enzyme digestion results; right: theoretical enzyme digestion results; MW lane: 10000 DNA marker; lane 1: theoretical enzyme digestion results).

[0037] Figure 5 For FjTAL, ARO4 K229L Verification of ligation with HcKan_IGG6 (left: actual enzyme digestion results; lane A: 15000 DNA marker; lane B: BsmBI enzyme digestion results; right: theoretical enzyme digestion results; MW lane: 10000 DNA marker; lane 1: theoretical enzyme digestion results).

[0038] Figure 6 P CDC19-PhCHS-IGG6-MsCHI-T TPO3 Verification of ligation and digestion with HcAmp_1 (left: actual digestion results; lane A: 15000 DNA marker; lane B: digestion results using BsaⅠ; right: theoretical digestion results; MW lane: 10000 DNA marker; lane 1: theoretical digestion results).

[0039] Figure 7 P TDH2 -AaFNS-IGG6-CcFNS-T CYC1 , P CCW12 -CitFNS-IGG6-CsFNS-T CYC1 Ligation and restriction enzyme digestion verification with HcKan_Wh (left: actual restriction enzyme digestion results; lane A: 15000 DNA marker; lane B: EcoRⅠ restriction enzyme digestion results; right: theoretical restriction enzyme digestion results; MW lane: 10000 DNA marker; lane 1: theoretical restriction enzyme digestion results).

[0040] Figure 8 The results of HPLC detection of naringenin produced by yeast engineered strain fermentation (A: naringenin standard product; B: engineered strain fermentation sample). DETAILED DESCRIPTION

[0041] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0042] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0043] Example 1 Plasmid design

[0044] Based on the principle of Golden Gate assembly technology, the present invention first synthesized two basic plasmids HcKan and HcAmp based on the existing universal plasmid pSMA RTHCKan. Among them, HcKan contains three main parts: replicon, kanamycin resistance gene, and red fluorescent protein reporter gene, and has BsmBI and BsaⅠ restriction sites at both ends of the red fluorescent protein sequence, such as Figure 1 As shown in a. HcAmp contains three main parts: the replicon sequence, the ampicillin resistance sequence, and the red fluorescent protein sequence. There are also BsmBI and BsaⅠ restriction sites at both ends of the red fluorescent protein sequence, as shown in Figure 1 As shown in b. Due to the presence of a red fluorescent protein reporter gene on the plasmid, the colony will appear red when the fragment is not correctly connected to the vector, otherwise it will appear white, as shown in Figure 1 As shown in c.

[0045] A series of plasmids were designed by using HcKan and HcAmp plasmids: HcKan_P, HcKan_T, HcKan_IGG6, HcAmp_1, HcAmp_2, HcAmp_3, HcKan_Wh, and the nucleotide sequences of the plasmids are shown in SEQ ID NO.1 to 7. Among them, HcKan_IGG6 was designed based on the existing IGG6 sequence, which is a short sequence screened from filamentous fungi. When IGG6 is used to connect two independent ORFs, a single ribosome can complete the translation of the two ORFs, and the process only requires the participation of a promoter and terminator.

[0046] Two type Ⅱs restriction endonucleases are BsaⅠ and BsmbⅠ. Unlike conventional type Ⅱ restriction endonucleases, the sites recognized by these two endonucleases are different from the sites of cutting. According to this feature, the plasmids cut by BsaⅠ and BsmbⅠ can present a variety of sticky ends, and different sticky ends are called connectors. By designing different connectors, seamless and orderly connections between different fragments can be completed. HcKan_P, HcKan_T, HcKan_IGG6, HcAmp_1, HcAmp_2, HcAmp_3, and HcKan_Wh plasmids all have precisely designed connectors. The specific plasmid connector design is shown in Table 1.

[0047] Table 1 Linker design for multiple plasmids

[0048]

[0049]

[0050] Note: The underlines in the table represent the restriction sites of BsaⅠ and BsmbⅠ.

[0051] Based on seamless cloning assembly technology and Golden Gate assembly technology, the transcription unit (TU2) of yeast genes was defined into three biological parts according to the structure of Saccharomyces cerevisiae genes, using the IGG6 sequence principle (connecting two independent ORFs in a head-to-tail manner). The three parts are: ①PRO: The sequence from the start codon to 500bp outward or from the start codon to the stop codon of the previous gene (the shorter of the two) is the promoter interval, representing the promoter of the gene (PRO). ②ORF: The interval from the start codon to the stop codon is the ORF interval, representing the gene sequence. ③TER: The sequence from the stop codon to 200bp outward or from the stop codon to the start codon of the next gene (the shorter of the two) is the terminator interval, representing the terminator of the gene.

[0052] Therefore, the present invention has developed a long fragment in vitro ligation method suitable for Saccharomyces cerevisiae, named as Ys6Fab plasmid vector system. In the Ys6Fab system, we define the transcription unit as: a promoter, a terminator and two ORF2s connected by IGG6 sequences (two ORFs connected by IGG6 sequences), and the new transcription unit is called TU2. The working principle diagram of different plasmids in the Ys6Fab system is shown in the figure. Figure 2 As shown in Figure 1, a transcription unit consists of a promoter, a terminator, and two ORFs. Figure 3 As shown in the figure, up to 3 transcription units can be transformed at one time, that is, 6 ORFs can be expressed. Ys6Fab combines the advantages of several different systems. A single transformation of Saccharomyces cerevisiae can achieve the integration of 1-6 genes in Saccharomyces cerevisiae according to experimental requirements, which can double the efficiency of Saccharomyces cerevisiae transgenic.

[0053] Example 2 Construction of plasmid

[0054] 1. ORF selection

[0055] This example selected 6 genes related to the synthesis of flavonoid compounds, namely: the tyrosine ammonia lyase FjTAL gene from the species Flavobacterium johnsoniae, whose nucleotide sequence is shown in SEQ ID NO.8; the 4-coumaric acid coenzyme a ligase Pc4CL gene from the species Petroselinum crispum, whose nucleotide sequence is shown in SEQ ID NO.9; the chalcone synthase PhCHS gene from the species Petunia X hybria, whose nucleotide sequence is shown in SEQ ID NO.10; the chalcone isomerase MsCHI gene from the species Medicagosativa, whose nucleotide sequence is shown in SEQ ID NO.11. And two feedback inhibition insensitive alleles ARO4 from Saccharomyces cerevisiae that can increase the accumulation of 3-deoxy-d-arabinoic acid-7-phosphate (DAHP) and prephenic acid K229L and ARO7 G141S , and their nucleotide sequences are shown in SEQ ID NOs. 12 to 13. Taking the transfer of these 6 genes into Saccharomyces cerevisiae as an example, a detailed in vitro ligation method for efficiently ligating gene fragments in Saccharomyces cerevisiae is provided.

[0056] 2. Selection of promoter and terminator

[0057] The promoters are P CDC19 , P GAL7 With P PGK1, whose sequences are shown in SEQ ID NO.14~16; the terminators are T TPO3 , T SSA1 With T VPS13 , and their sequences are shown in SEQ ID NOs.17 to 19 respectively.

[0058] 3. Connection with HcKan_P and HcKan_T

[0059] (1) Linking of promoter, with P CDC19 Take the connection with HcKan_P as an example: obtain the CDC19 promoter sequence by PCR, design and synthesize primers, and add Bs aⅠ and BsmBI cleavage sites and special sticky ends (underlined for cleavage sites) at the 5' end of the upstream and downstream primers. Specifically: Upstream primer (F): 5'- AGCGTGGGTCTCAG ACAGATTGGGAGATTTTCATAG-'3; downstream primer (R): 5'- TAGCCGAGACCCAGCAC TGTGATGATGTTTTATTTGTTTTG-'3.

[0060] The CDC19 promoter sequence was amplified using the Saccharomyces cerevisiae S288c genome as a template. The PCR conditions were: 95°C for 3 min; 95°C for 15 s, 55°C for 15 s, 72°C for 1 min, 34 cycles; 72°C for 5 min. After the PCR was completed, the gel was cut and the product was recovered.

[0061] The ligation system of the recovered product and HcKan_P is: promoter 40ng, HcKan_P 40ng, BsaⅠ0.5μL, T4 ligase 0.5μL, 10x T4 ligase buffer 1μL, add double distilled water to make up to 10μL volume. The ligation procedure is: 37℃1h; 50℃15min; 80℃15min.

[0062] After the ligation is completed, the product is transformed into E. coli and then coated with kanamycin-resistant plates. The growing colonies will be red and white. After the white colonies are selected for culture, the plasmid is extracted and the enzyme digestion verification is performed. The verification results are as follows: Figure 4 As shown, the actual enzyme digestion results are consistent with the theoretical results. Then the plasmid with correct enzyme digestion was finally identified as positive by Sanger sequencing to obtain HcKan_P CDC19 .

[0063] (2) Promoter P PGK1 , P GAL7 Connection method and P CDC19 Same, P PGK1 The amplification primers are: upstream primer (F) 5'- A GCGTGGGTCTCAGGTTTGCAAAAAGAACAAAACTG-'3 and downstream primer (R) 5'- TAGCCGAGACCCAGCAC CATTGTTTTATATTTGTTGTAAAAA GTAG-'3 (underlined for restriction enzyme cutting site), and finally sequenced and identified HcKan_P PGK1 .P GAL7 The amplification primers are: upstream primer (F) 5'- AGCGTGGGTCTCAG AGTTTAGACGGTAGCAACAAG-'3 and downstream primer (R) 5'- TAGCCGAGACCCAGCAC TTTTGAGGGAATATTCAAC TG-'3 (underlined for restriction site), and finally sequenced and identified HcKan_P GAL7 .

[0064] (3) The method of connecting the terminator to the HcKan_T plasmid is similar to that of the promoter, except that the cloning of the terminator requires the addition of the AGCGTGGGTCTCATAGC sequence to the 5' end of the F primer and the addition of the CCTCCGAGACCCAGCAC sequence to the 5' end of the R primer.

[0065] Terminator T TPO3 The amplification primers were: 5'-AGCGTGGGTCTCATAGCGAGTAACGATTTT ACGAATCG-'3 and 5'-CCTCCGAGACCCAGCACTTTGTTTAGGATAGCAATAG-'3; terminator T SSA1 The amplification primers were 5'-AGCGTGGGTCTCATAGCGCCAATTGGTGCG G-'3 and 5'-CCTCCGAGACCCAGCACACCATTAGTGTTAGCGATAATC-'3, and the terminator T VPS13 The amplification primers were 5'-AGCGTGGGTCTCATAGCTCACATATGAAAGTATAT ACCCG-'3 and 5'-CCTCCGAGACCCAGCACCGCGCTGCGGATATTTCTAAG-'3, and finally sequenced and identified HcKan_T TPO3 、HcKan_T SSA1 and HcKan_T VPS13 .

[0066] 4. Ligation of ORF and HcKan_IGG6 plasmid

[0067] (1) FjTAL and ARO4 K229L Connections

[0068] The HcKan_IGG6 plasmid was linearized using BasⅠ. Subsequently, the FjTAL gene was cloned using primers 5'-ATGGTCAGT CGTCTCgGCTATTAATTGTTTATCAGGTGGTCTTTC-'3 and 5'-CAATCAAACAT GAAAGCTATCTCTCTGC-'3. The ARO4 gene was cloned using primers 5'-TTACGCT GGAGTCCGTCTCgGATGAGTGAATCTCCAATGTTC-'3 and 5'-ATAGCTTTCATG TTTGATTGCTATTTCTTGTTAACTTCTCTTC-'3. K229L Gene cloning. FjTAL and ARO4 K229L The IgG6 sequence and 15 bp homology arms were added in between.

[0069] After the PCR product was recovered by gel, all fragments were infused and connected. The infusion system was: 200ng of FjTAL fragment, ARO4 K229L 200 ng fragment, 100 ng linearized HcKan_IGG6, 5 μL infusion enzyme, double distilled water was added to make up the reaction volume to 10 μL. The reaction conditions were 37°C, 15 min.

[0070] The reaction product was transformed into E. coli and coated with kanamycin plates. The next day, white colonies were picked for culture and then verified by plasmid enzyme digestion. The results were as follows: Figure 5 As shown, the actual enzyme digestion results were consistent with the theoretical results. Then the plasmid that passed the enzyme digestion verification was further sequenced and finally sequenced and identified to obtain HcKan_Fj TAL-IGG6-ARO4 K229L .

[0071] (2) The connection between PhCHS and MsCHI was the same as the above steps. The primers used for PhCHS were 5'-GCGGCCTCCATAACAGGTTTGATTGTTACGTTGCCACAGAATGAAG-'3 and 5'-TTACGCTGGAGTCCGTCTCGGATGGTGACAGTTGAAGAGTACAG-'3, and the primers used for MsCHI were 5'-CAATCAAACGCGGCCTCCATAACAGC-'3 and 5'-TAGCCGAG ACGACTGACCATGCTAATTACCTATCTTAAACGCCCC-'3; finally, HcKan_PhCHS-IGG6-MsCHI was obtained by sequencing and identification.

[0072] (3) Pc4CL and ARO7 G141SThe ligation was performed in the same manner as above. The primers used for Pc4CL were 5'-ATGGTCAGTCGTCTCGGCTATTATTTGGGTAGGTCGCCG-'3 and 5'-CAATCAA ACATGGGGGACTGTGTGG-'3, ARO7 G141S The primers used were 5'-CAGTCCCCCATGT TTGATTGTTACTCTTCCAACCTTCTTAGC-'3 and 5'-TTACGCTGGAGTCCGTCT CGGATGGATTTCACAAAACCAG-'3; finally, sequencing and identification yielded HcKan_Pc4CL-IGG6-ARO7 G141S .

[0073] Example 3 Connection of transcription units

[0074] An independent transcription unit consists of a promoter module, a gene module, and a terminator module. CDC19 -PhCHS-IGG6-MsCHI-T TPO3 As an example, the HcKan_P prepared in Example 2 was used. CDC 19 、HcKan_T TPO3 , HcKan_PhCHS-IGG6-MsCHI, connected by HcAmp_1, the connection system is: HcKan_P CDC19 40ng, HcKan_PhCHS-IGG6-MsCHI 120ng, HcKan_T TPO3 40ng, HcAmp_1 40ng, 10x T4 ligase buffer 1μL, BsmBI 0.5μL, add double distilled water to the reaction volume of 10μL. After 1h of enzyme digestion at 55℃, add 0.5μL T4 ligase, then continue at 25℃ for 1.5h, 50℃ for 15min, and 80℃ for 15min. The reaction product was transformed into E. coli and coated with ampicillin plates. The next day, white colonies were picked for culture, plasmids were extracted, and plasmid enzyme digestion verification was performed. The results are as follows Figure 6 As shown in the figure, the actual enzyme digestion results are consistent with the theoretical results. Then the plasmid with the correct enzyme digestion was further sequenced and verified, and finally HcAmp_1-P CDC19 -PhCHS-IGG6-MsCHI-T TPO3 .

[0075] Connect and verify with the above connection method to obtain HcAmp_1-P GAL7 -FjTAL-IGG6-ARO4 K229L -T V PS13With HcAmp_1-P PGK1 -Pc4CL-IGG6-ARO7 G141S -T SSA1 .

[0076] Example 4 Connection between two transcription units

[0077] The plasmid HcKan_Wh designed based on Example 1 is used to connect two different transcription units. Before connection, the two transcription units need to be connected to HcAmp_2 and HcAmp_3 respectively. The two transcription units selected in this example are: HcAmp_2-P TDH2 -AaFNS-IGG6-CcFNS-T CYC1 With HcAmp_3-P CCW12 -CitFNS-IGG6-CsFNS-T CYC1 , prepared according to the method of Examples 2 to 3, and their sequences are shown in SE Q ID NOs. 20 to 21.

[0078] Connection system: HcAmp_2-P TDH2 -AaFNS-IGG6-CcFNS-T CYC1 200ng, HcAmp_3-P CCW12 -CitFNS-IGG6-CsFNS-T CYC1 200ng, HcKan_Wh 100ng, BsaⅠ0.5μL, T4 ligase 0.5μL, add double distilled water to make up to 10uL volume. 37℃15min, 25℃15min, cycle 45 times, 80℃15min.

[0079] The reaction product was then transformed into E. coli and coated with kanamycin plates. The next day, white colonies were picked and cultured, and plasmids were extracted and verified by plasmid enzyme digestion. The results were as follows: Figure 7 As shown in the figure, the actual enzyme digestion results are consistent with the theoretical results. The plasmid with the correct enzyme digestion was further sequenced and verified, and finally HcKan_Wh-P was obtained. TDH2 -AaFNS-IGG6-CcFNS-T CYC1 -P CCW12 -CitFNS-IGG6-CsFNS-T CYC1 .

[0080] In summary, this example takes the in vitro connection of six key genes for the synthesis of flavonoid compounds as an example, and the Ys6Fab method can be used to quickly connect transcription units in vitro.

[0081] Example 5: Transformation of the Saccharomyces cerevisiae genome into transcription units

[0082] The HcAmp_1-P obtained in Example 3 CDC19 -PhCHS-IGG6-MsCHI-T TPO3 、HcAmp_1-P GAL7 -FjTAL-IGG6-ARO4 K229L -T VPS13 With HcAmp_1-P PGK1 -Pc4CL-IGG6-ARO7 G141S -T SSA1 , these in vitro assembled transcription units are integrated into the Saccharomyces cerevisiae genome through homologous recombination.

[0083] Saccharomyces cerevisiae has a strong homologous recombination ability, so this example uses 6 independent fragments for genome integration. 60bp homology arms are added between the 6 fragments by PCR, and then each fragment is transferred into Saccharomyces cerevisiae at the same time. In this example, chromosome X of Saccharomyces cerevisiae is selected for integration. The genome of Saccharomyces cerevisiae S288c is used as a template, and the upstream homology arm is amplified using primers 5'-CGTCTATGAGGAGACTGTTAG-'3 and 5'-GACCACTTCGAGAGCAAG-'3; the histidine synthesis protein is amplified using primers 5'-GGGCAGA GAAACTCGCAGGCAACTTGCTCTCGAAGTGGTCCCTGATGCGGTATTTTCT C-'3 and 5'-TGCTATCCTAAACAAACCTCGGCCTCCTCTAGTACACTC-'3; the downstream homology arm is amplified using primers 5'-GTTTTGTTCTTTTTGCAAACCCTGCATAATCGGC CTC-'3 and 5'-CTCGCCAAGGCATTACC-'3. Using HcAmp_1-P CD C19 -PhCHS-IGG6-MsCHI-T TPO3 As template, primers 5'-AGAGTGTACTAGAGGAGGCCGAGGTTTGTTTAGGATAGCAATAG-'3 and 5'-TTAGAAATATCCGCAGCGCGACA GATTGGGAGATTTTCATAG-'3 were used to amplify P CDC19 -PhCHS-IGG6-MsCHI-T TPO3 Sequence. Using HcAmp_1-P GAL7 -FjTAL-IGG6-ARO4 K229L -T VPS13As template, primers 5'-ATGAAAATC TCCCAATCTGTCGCGCTGCGGATATTTCTA-'3 and 5'-TTATCGCTAACACTAATGGTAGTTTAGACGGTAGCAACAAGAATATAG-'3 were used to amplify P CDC19 -PhCHS-IGG6-Ms CHI-T TPO3 Sequence. Using HcAmp_1-P PGK1 -Pc4CL-IGG6-ARO7 G141S -T SSA1 As template, primers 5'-TTGTTGCTACCGTCTAAACTACCATTAGTGTTAGCGATAATC-'3 and 5'-TG TGAGGCCGATTATGCAGGGTTTGCAAAAAGAACAAAACTG-'3 were used to amplify P PGK1 -Pc4CL-IGG6-ARO7 G141S -T SSA1 sequence.

[0084] The 6 fragments obtained in the previous step were transformed into Saccharomyces cerevisiae using the Yeast Transformation System 2 (Product No. 630439) produced by TAKARA. The transformed Saccharomyces cerevisiae was plated on SD-His medium for screening and verification.

[0085] The yeast that was successfully verified was then fermented and the cells were broken and then naringenin was detected using high performance liquid chromatography. The results of liquid chromatography showed that the genes involved were stably expressed in the genome of Saccharomyces cerevisiae. Figure 8 As shown, naringenin was shown to be present in the fermented samples.

[0086] Example 6 A highly efficient in vitro gene fragment ligation method for use in Saccharomyces cerevisiae

[0087] Based on the plasmids designed in Example 1: HcKan_P, HcKan_T, HcKan_IGG6, HcAmp_1, HcAmp_2, HcAmp_3, HcKan_Wh, the operation method for connecting multiple gene fragments in vitro is as follows:

[0088] (1) Construction of promoter and terminator standardized plasmids: Select the gene to be connected, and use PCR to amplify multiple promoter and terminator sequences from the genome of Saccharomyces cerevisiae strain S288c according to the promoter region and terminator region defined in Example 1. Connect the promoter and terminator sequences to the HcKan_P and HcKan_T plasmids by Golden Gate assembly.

[0089] (2) HcKan_ⅠGG6 is designed to connect ORF fragments. One HcKan_ⅠGG6 will connect two different ORFs. Specifically, ORFs are obtained by PCR. The primers for PCR need to be specially designed. The F primer of the front ORF needs to be added with a 15 bp HcKan_ⅠGG6 homologous sequence, and the R primer needs to be added with an ⅠGG6 sequence; the F primer of the back ORF needs to be added with an ⅠGG6 sequence, and the R primer needs to be added with a 15 bp HcKan_ⅠGG6 homologous sequence. The ORF fragments are recovered by gel cutting after PCR. HcKan_ⅠGG 6 is linearized with BsaⅠ and then recovered by gel cutting. The three recovered fragments are connected by infusion.

[0090] (3) The connected HcKan_P, HcKan_T and HcKan_IGG6 plasmids connected with gene fragments were connected into the corresponding HcAmp plasmid through Golden Gate assembly.

[0091] (4) The ligation between HcAmp plasmids was also performed by Golden Gate assembly. According to the experimental needs, a suitable HcAmp plasmid was constructed and finally ligated into the HcKan_Wh plasmid.

[0092] After testing, it was found that the Ys6Fab system can connect up to 2 transcription units, and a single transcription unit can connect 4 fragments, that is, 8 fragments can be connected in one pot, which can double the transgenic efficiency of brewer's yeast. In addition, the Ys6Fab system can also be theoretically applied to other microorganisms to express exogenous genes.

[0093] In summary, the present invention provides a saccharomyces cerevisiae in vitro connection plasmid vector system and method that can connect multiple gene fragments. One transcription unit in the Ys6Fab plasmid vector system can express two genes, and the fragment length is shortened (one promoter and one terminator are missing, about 800-1000bp). Taking the in vitro connection of flavonoid compound synthesis genes as an example, the Ys6Fab method is used for in vitro connection, and finally the flavonoid compound synthesis genes from different sources can be successfully connected and expressed in saccharomyces cerevisiae, thereby improving the transgenic efficiency of saccharomyces cerevisiae. The connection plasmid vector system and method provided by the present invention can realize a one-pot connection of up to 8 fragments, and a yeast transformation can express 6-8 genes, which doubles the transgenic efficiency of saccharomyces cerevisiae. The in vitro assembly method of gene fragments developed by the present invention is concise and efficient, which can greatly improve the transgenic efficiency of saccharomyces cerevisiae, and has great application prospects in the field of synthetic biology.

[0094] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A ligation kit, characterized in that: The kit comprises: a promoter-linked plasmid HCKa n_P, a terminator-linked plasmid HCKan_T, a gene fragment-linked plasmid HCKan_IGG6, transcription unit assembly plasmids HcAmp_1, HcAmp_2, HcAmp_3, and a transcription unit-linked plasmid HcKan_Wh, and the nucleotide sequences of the plasmids are shown in SEQ ID NOs. 1 to 7, respectively.

2. The ligation kit according to claim 1, characterized in that: Also included are the restriction endonucleases BsaI and BsmbI.

3. Use of the ligation kit according to claim 1 or 2 in in vitro expression of exogenous genes.

4. Use of the ligation kit according to claim 1 or 2 in ligating different gene fragments in Saccharomyces cerevisiae.

5. A recombinant expression vector constructed using the ligation kit according to claim 1 or 2.

6. A recombinant bacterium constructed using the ligation kit according to claim 1 or 2.

7. Use of the recombinant expression vector according to claim 5 or the recombinant bacterium according to claim 6 in in vitro ligation of multiple gene fragments.

8. An in vitro ligation method for efficiently ligating gene fragments in Saccharomyces cerevisiae, characterized in that: The plasmid in the ligation kit according to claim 1 or 2 is used to connect different promoters, open reading frames, and terminators respectively, and the connected promoters, open reading frames, and terminators are assembled to obtain transcription units, and then multiple different transcription units are connected to transfer the transcription units into the Saccharomyces cerevisiae genome.

9. The method according to claim 8, characterized in that: HcKan_IGG6 plasmid was used to connect two different open reading frames.

10. Use of the method according to claim 8 or 9 in the efficient assembly of multiple gene fragments.

Images