76results about How to "Improve transgenic efficiency" patented technology

The invention discloses an STS molecular marker for identifying high rice bacterial blight resistant genes. A nucleotide sequence of the molecular marker is SEQ ID NO: 1. The STS molecular marker is the following primer pairs, wherein the nucleotide sequence is 5'--3', the forward primer is 5'GGGAGAAATTGGCCCCAGTTAGAGAA3', the reverse primer is 5' GCTTCACTTGATCACTGCTGTTTG3'. Use of the STS molecular marker for helping to selectively breeding rice bacterial blight resistant Xa7 genes or cloning Xa7 genes.

The invention discloses an efficient, rapid and stable genetic transformation method for strawberries 'beauty'. The method comprises the steps of activation of culture, preparation of plant materials, infection, co-culture, screening culture and rooting culture, solves the problems of the pollution of agrobacterium and infectious microbes in a traditional agrobacterium-mediated method, low conversion efficiency of the strawberries 'beauty' and long period of the strawberries 'beauty' from transgenosis and transgenic detection to field transplanting, shortens the period, further solves the problems of large workload and heavy work of transgenic detection, simplifies a detection method, and increases the detection speed. On the basis of the established 'beauty' strawberry leaf regeneration system, the method researches various factors for influencing agrobacterium tumefaciens transforming the 'beauty' strawberry leaves, optimizes various parameters, simplifies the operation process, and determines the best transformation conditions.

The invention discloses a targeting vector and a reconstituted cell for the Cas9-mediated site-specific integration of FABP4 (adipose fatty acid-binding protein) gene and MSTN (myostatin) gene point mutation. The invention utilizes an electroporation method to co-transfect a Cas9 eukaryotic expression vector and a targeting vector targeting the MSTN gene to Luxi bovine fetal fibroblasts, consequently, gene targeting for the Luxi bovine fetal fibroblasts is realized, and bovine fetal fibroblasts with FABP4 gene and MSTN gene point mutation knocked in the MSTN site are obtained. By Junction of PCR (Polymerase Chain Reaction) screening and verification, targeted positive cloned cells are obtained. The positive cloned cells as donor cells are transplanted into denucleated bovine oocytes, so that a transgenic cloned embryo can be obtained, and thereby a solid foundation is laid for the rapid and efficient development of high-quality new genetically modified beef varieties.

The invention provides a method for quickly building a genetic transformation regeneration system of wine grape Riesling, and belongs to the technical field of transgenic breeding of grapes. The method is characterized by comprising the following steps: performing tissue culture to induce grape anther to obtain callus; subculturing and screening to obtain embryonic callus; with embryonic callus as a receptor, screening through a selective medium by an agrobacterium tumefaciens-mediated method to obtain resistant callus; and then regenerating a grape plant. Whether the gene gfp is expressed can be observed and reported by PCR (Polymerase Chain Reaction) verification and through a stereo fluorescence microscope, and a transformant also can be identified quickly, therefore, the grape transgenosis efficiency can be improved. Compared with the prior art, the method has the advantages that the culture medium has a good effect on culturing and screening, and achieves quick regeneration of a Riesling transgenic grape plant, thus the grape transgenosis efficiency is greatly improved, and the regeneration rate reaches 81%; the transformation cycle is short, the transgenic plant can be obtained within seven months; the transformant is greatly increased; the transformation rate can reach 63%.

The invention discloses an expression vector resisting PCV2 and a transgenic pig and construction methods thereof, belonging to the field of gene engineering. The expression vector is constructed by respectively connecting an H1 promoter and a pPB-sh2 sequence to a pUC57-H1 plasmid and then connecting a fusion fragment containing a loxP-Neo/EGFP gene expression cassette to pPB-H1-sh2. The vector is introduced into the genome of a pig, and somatic cell nuclear transfer technology is employed to produce the transgenic pig. The expression vector provided by the invention has a piggyback transposon, greatly improves transformation efficiency, changes a common plasmid series recombination transgene integration model into a single-site single-copy integration model and better simulates the internal environment of a biological gene. The constructed transgenic pig degrades PCV2mRNA through siRNA synthesized by itself, thereby fundamentally inhibiting PCV2 infection.

The invention discloses an efficient, fast and stable gene transformation method for blueberries. The method comprises the following steps of 1 activation of culture, 2 plant material preparation, 3 preculture, 4 infection, 5 co-culture, 6 leaf washing, 7 callus induction, 8 bud induction and 9 root induction culture. According to the method, the gene transformation efficiency of the blueberries is improved, and the transformation rate can be above 10%. The concentration of bacterium liquid is reduced, and infection time is prolonged, so that agrobacterium pollution is avoided, and infection efficiency is improved. No drug or agentia assisting in infection is added to the infection bacterium liquid. Acetosyringone or other agentia assisting in infection is usually added in a traditional method, consequently, leaves are damaged, and the regeneration capacity of the leaves is reduced. Damage to the leaves of the blueberries is reduced, and the survival rate and regeneration rate of leaf culture are increased. A carrier carrying high expression and reporter genes is adopted, transgenic plants can be directly screened out through observation, and tedious work in traditional detection is avoided. The period of transgenosis is shortened.

The invention relates to a PiggyBac transposon mediated transgenic vector for inducing cell immortalization, a construction method and an application, which belongs to the gene engineering technical field. The vector is PB-rtTA-NIT-STP, which is constructed by the following method: constructing a LoxP-SV40P nco-IRES-tk-PolyA-LoxP gene expression cassette; connecting an amplified fragment of the gene expression cassette, constructing a basic transgenic vector PB-NIT; constructing a transgenic vector PB-NIT-STP containing target gene SV40T and p 53; and constructing a screening vector PB-rtTA-NIT-STP containing Tet binding domain rtTA. The transgenic vector constructed by the invention has the advantage of effectively raising the transgene efficiency, and is convenient for screening.

The invention discloses an SNP functional molecular marker and application of a paddy rice fragrance gene. The fragrance gene is badh2, a number-2 exon area inside the gene has an insert loss of 7bp basic group, the SNP functional molecular marker is K_08g badh2-1 and is positioned at 20380271 basic group of number-8 chromosome of the paddy rice, the polymorphism of the SNP functional molecular marker is G/C, and a sequence of the SNP functional molecular marker is SEQ ID No.1. An SNP site is detected by utilizing a KASP method, and whether the paddy rice sample has fragrance or not is determined by virtue of different fluorescent signals. The SNP functional molecular marker developed by the invention can be used for high-flux screening and identification of paddy rice seedling period or natural genetic materials, the operation is simple and convenient, the result is accurate and reliable, the genetic improvement of the character of the paddy rice fragrance quality is accelerated, the breeding workload is reduced, the breeding efficiency is high, and the cost is low.

The invention discloses a parental plasmid for obtaining minicircle DNA, and an application thereof. The parental plasmid is constructed by inserting an attR segment and an attL segment and a [Phi]C31 integrase gene expression cassette in a starting vector pEGFP-N1-attB, wherein the attR segment is inserted between cleavage sites of restriction enzymes SpeI and DraIII of the starting vector; the attL segment is inserted in the cleavage sites of restriction enzymes Af1 III and Ase I of the starting vector; and the [Phi]C31 integrase gene expression cassette is inserted in a cleavage site of the restriction enzyme Af1 III of the starting vector. The minicircle DNA for stable integration can be obtained rapidly, efficiently and economically by using the parental plasmid; subsequent transgenosis operational method is simple and practicable; and the parental plasmid has important biology significance and practical application values.

The invention discloses a method for cultivating high-female few-seed watermelon. The method comprises the steps of obtaining different watermelon translocation materials Y-5 and YN-10, obtaining a watermelon high-female gene material H-12, performing high-female gene transfer on the Y-5 and the YN-10 taken as recurrent parents together with the H-12 by adopting the methods of generation-II back cross, generation-II self cross and generation-I test cross, hybridizing a homozygous YNC-10 high-female translocation material and a homozygous YC-5 high-female translocation material, and obtaining the high-female few-seed watermelon with objective traits through a field variety comparing-testing-breeding procedure. The method transfers different chromosome translocation to a female-parent material and a male-parent material respectively, thereby not only improving transfer efficiency but also ensuring that transfer materials are easy to protect. The watermelon cultivated by the method is few in watermelon seeds, convenient to eat, large in quantity of female flowers and easy to cultivate. In addition, due to few seeds, the method also reduces harmful effects of seed respiration on storage, thereby strengthening storage property.

The invention discloses a vector for carrying out site-specific mutagenesis on MSTN (Myostatin) and site-specific integration on PPARgamma (Peroxisome Proliferator-activated Receptor gamma) at the same time, and recombinant cells. The vector comprises a Cas9 cutting expression vector and a targeting vector. According to the vector disclosed by the invention, a recombinant cell strain can be constructed by carrying out co-transfection on host cells by the Cas9 cutting expression vector and the targeting vector, the recombinant cell strain can be used as nuclear transfer donor cells for producing transgenic cloned embryo, function exertion of the MSTN can be inhibited, and meanwhile, specific expression of the PPARgamma in skeletal muscle cells can be realized, so that support is provided for quickly and efficiently developing high-quality transgenic beef new products.

The invention discloses a method of performing gene correction on hemopoietic stem cells of a patient with Mediterranean anemia. The method is characterized by comprising the steps of I, selecting CRISPR target near an HBB gene-28 (A/G) site, and designing a gRNA sequence; II, constructing a template plasmid, and inserting a dual-ITR (inverted terminal repeat) sequence of piggyBac between upstreamand downstream 500bp sequences of the HBB gene CRISPR target; III, co-transfecting the hemopoietic stem cells of the patient with Mediterranean anemia through a transfection reagent, the template plasmid, gRNA and Cas9 carrier, and performing puromycin screening on a cell medium; IV, authenticating and verifying a resistant gene. The CRISPR/Cas9 system and piggyBac are jointly utilized; the hemopoietic stem cells of the patient with Mediterranean anemia can be transfected effectively; homologous recombination efficiency can be improved; -28(A/G) mutation site of the patient with Mediterraneananemia can be corrected effectively.

The invention belongs to the technical field of biology, relates to an instantaneous conversion method of peach leaves, and particularly relates to an instantaneous conversion method of peach seedlingleaves, and mainly solves the problem of low conversion efficiency of the peach leaves. The method comprises the following specific steps of: (1) removing external hard endocarps of peach pits storedin sand at a low temperature (4 DEG C), sowing seeds in nutrient soil, and culturing in an environment with the temperature of 22 DEG C, the humidity of 75% and the illumination of 6,000 to 8,000 lux; (2) culturing peach seedlings with the seedling age of 10 to 15 days for 5 to 8 days under the condition of the illumination intensity of 600 to 800 lux for later use; and (3) selecting the peach seedlings treated in the step (2), and performing instantaneous conversion by a conventional agrobacterium-mediated leaf vacuumizing method. The conversion efficiency of the peach seedling leaves subjected to weak light treatment is extremely remarkably improved; compared with a conventional conversion method, the method has the advantage that the GUS activity is improved by 5.64 times after GUS genes are instantaneously converted.

A method for culturing the less-seed water melon includes such steps as determining the chromosome translocation material to obtain two non-homologous chromosome translocating bodies with different translocation sites, back crossing or selfing or test crossing to transfer them respectively to the male parent and female parent, hybridizing between said male and female parents, discriminating in field, and variety comparison. Its advantages are high transfer efficiency, and high effect to decrease the number of seeds by 45-55%.

The invention provides a dairy cattle mammary epithelial cell immortalizing method. The dairy cattle mammary epithelial cell immortalizing method is characterized in that when primary generation dairy cattle mammary epithelial cells are infected through HPV E6 and E7 viruses to be immortalized, pantropic and facultative virus particles are added, and thus the virus infection efficiency is improved. The invention further provides a method for establishing an immortalized dairy cattle mammary epithelial cell line. The method for establishing the immortalized dairy cattle mammary epithelial cell line comprises the following steps that firstly, dairy cattle mammary tissue is subjected to tissue block primary generation culture in a culture bottle; secondly, the primary generation dairy cattle mammary epithelial cells are infected through the virus method, and the primary generation dairy cattle mammary epithelial cells are immortalized; thirdly, positive clone is selected, and the cell line is cultured. By means of the methods, the dairy cattle mammary epithelial cells can be efficiently immortalized, the dairy cattle mammary epithelial cell line high in growth speed and capable of achieving stable continuous passage is established, the dairy cattle mammary epithelial cells with the physiological function are obtained, and experimental cell materials are provided for researching control over lactation nutrition of the dairy cattle mammary epithelial cells and the pathogenesis of diary cattle mastitis.

The invention discloses a transgenic method based on the RMCE technology. The transgenic method comprises the following steps: establishing a carrier by taking Rosa26 carrier as a framework and adding with Lox2272 locus or Attp70 locus; after correct sequencing of the carrier, electrotransferring to an ES cell, and screening by adopting a culture medium containing antibiotics, thus obtaining a positive ES cell; verifying again by PCR or Southern Blot; transferring plasmids with Flp recombinase into the positive ES cell, thus obtaining a new positive ES cell; and administrating the positive ES cell after successful verification into the blastaea of a mouse through micro-injection, and then transferring into a surrogate mother mouse, thus obtaining an RMCE tool mouse with a fluorescent mark. The transgenic method is obtained by integrating RMCE and recombinase technology, thus having the advantages of the RMCE technology, and also being capable of realizing fixed-point implantation of genes, and moreover, the the test cycle is short, the efficiency is high, and the toxicity caused by random insertion of the genes is also reduced.