Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

76results about How to "Improve transgenic efficiency" patented technology

STS molecular marker for identifying high rice bacterial blight resistant genes and application thereof

The invention discloses an STS molecular marker for identifying high rice bacterial blight resistant genes. A nucleotide sequence of the molecular marker is SEQ ID NO: 1. The STS molecular marker is the following primer pairs, wherein the nucleotide sequence is 5'--3', the forward primer is 5'GGGAGAAATTGGCCCCAGTTAGAGAA3', the reverse primer is 5' GCTTCACTTGATCACTGCTGTTTG3'. Use of the STS molecular marker for helping to selectively breeding rice bacterial blight resistant Xa7 genes or cloning Xa7 genes.
Owner:ZHEJIANG NORMAL UNIVERSITY

Efficient, rapid and stable genetic transformation method for strawberries

The invention discloses an efficient, rapid and stable genetic transformation method for strawberries 'beauty'. The method comprises the steps of activation of culture, preparation of plant materials, infection, co-culture, screening culture and rooting culture, solves the problems of the pollution of agrobacterium and infectious microbes in a traditional agrobacterium-mediated method, low conversion efficiency of the strawberries 'beauty' and long period of the strawberries 'beauty' from transgenosis and transgenic detection to field transplanting, shortens the period, further solves the problems of large workload and heavy work of transgenic detection, simplifies a detection method, and increases the detection speed. On the basis of the established 'beauty' strawberry leaf regeneration system, the method researches various factors for influencing agrobacterium tumefaciens transforming the 'beauty' strawberry leaves, optimizes various parameters, simplifies the operation process, and determines the best transformation conditions.
Owner:JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY

Targeting vector and reconstituted cell for Cas9-mediated site-specific integration of FABP4 (adipose fatty acid-binding protein) gene and MSTN (myostatin) gene point mutation

The invention discloses a targeting vector and a reconstituted cell for the Cas9-mediated site-specific integration of FABP4 (adipose fatty acid-binding protein) gene and MSTN (myostatin) gene point mutation. The invention utilizes an electroporation method to co-transfect a Cas9 eukaryotic expression vector and a targeting vector targeting the MSTN gene to Luxi bovine fetal fibroblasts, consequently, gene targeting for the Luxi bovine fetal fibroblasts is realized, and bovine fetal fibroblasts with FABP4 gene and MSTN gene point mutation knocked in the MSTN site are obtained. By Junction of PCR (Polymerase Chain Reaction) screening and verification, targeted positive cloned cells are obtained. The positive cloned cells as donor cells are transplanted into denucleated bovine oocytes, so that a transgenic cloned embryo can be obtained, and thereby a solid foundation is laid for the rapid and efficient development of high-quality new genetically modified beef varieties.
Owner:NORTHWEST A & F UNIV

New method for improving transgenic efficiency of animals

The invention discloses a new method for improving transgenic efficiency of animals. In the transgenic method, the sperm cells and the oocytes are used as vectors, through improvement of the method, the exogenous genes are respectively led to the sperm cells and the oocytes and the exogenous genes carried by the sperm cells and the oocytes are further integrated in the embryos through fertilization process, thus improving the efficiency of leading the exogenous genes to the nuclei and then realizing high efficiency expression. The method is characterized by respectively transfecting female and male reproductive cell systems by adopting a point injection method before the female and male mice mate with each other and then selecting the male mice 1-5 days and 35-40 days after surgery and the female mice 1-7 days after surgery to mate with each other to obtain the transgenic mouse offspring. By adopting the method, transgenosis of sheep is explored, the transgenic efficiency of big mammals can be improved and a new approach is provided for breeding in the animal husbandry. In the method, a transgenic system adopting female and male reproductive cells for joint mediation is explored.
Owner:INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI

Method for quickly building genetic transformation regeneration system of grapes

The invention provides a method for quickly building a genetic transformation regeneration system of wine grape Riesling, and belongs to the technical field of transgenic breeding of grapes. The method is characterized by comprising the following steps: performing tissue culture to induce grape anther to obtain callus; subculturing and screening to obtain embryonic callus; with embryonic callus as a receptor, screening through a selective medium by an agrobacterium tumefaciens-mediated method to obtain resistant callus; and then regenerating a grape plant. Whether the gene gfp is expressed can be observed and reported by PCR (Polymerase Chain Reaction) verification and through a stereo fluorescence microscope, and a transformant also can be identified quickly, therefore, the grape transgenosis efficiency can be improved. Compared with the prior art, the method has the advantages that the culture medium has a good effect on culturing and screening, and achieves quick regeneration of a Riesling transgenic grape plant, thus the grape transgenosis efficiency is greatly improved, and the regeneration rate reaches 81%; the transformation cycle is short, the transgenic plant can be obtained within seven months; the transformant is greatly increased; the transformation rate can reach 63%.
Owner:TOBACCO RES INST HENAN ACADEMY OF AGRI SCI

Genetic transformation method for populus

The invention discloses a genetic transformation method for populus. The genetic transformation method for populus comprises the steps of 1, adopting an agrobacterium infection solution containing a target gene expression vector for infecting populus sterile leaves, the infected populus leaves are placed on a co-culture medium (containing 100 microM AS) for co-culture; 2, after the leaves on the co-culture medium are torn open, the leaves are inoculated on a screening culture medium for culture, and callus is obtained; 3, the callus is inoculated to a differential medium for culture, and adventive buds are obtained; 4, the adventive buds are inoculated to a rooting medium for culture, and rooting seedlings are obtained; 5, the rooting seedlings are identified. According to the method, thepopulus transformation period is shortened, and the populus transgenosis efficiency is improved, the method has the important technology supporting effect on populus transgenosis breeding and gene function identification, and the certain theoretical and practical significance in forest resistant variety improvement and new variety breeding is achieved.
Owner:BEIJING FORESTRY UNIVERSITY

Method for cultivating starch-content-increased transgenic plant through multi-gene transformation

InactiveCN103173485AImprove conversion rateHigh total starch contentTransferasesFermentationGranule-Bound Starch SynthaseSucrose synthetase
The invention discloses a method for cultivating a starch-content-increased transgenic plant through multi-gene transformation. According to the transgenic plant cultivation method provided by the invention, a selection marker gene, an adenosine diphosphate glucose pyrophosphorylase small subunit gene, an adenosine diphosphate glucose pyrophosphorylase large subunit gene, a sucrose synthase gene, and a granule-bound starch synthase gene are introduced into a target plant, such that a transgenic plant is obtained. The total starch content of the transgenic plant is higher than that of the target plant. As a result of experiment of the invention, a plurality of genes can be simultaneously transferred in one-time through one time of gene gun bombardment, such that transgenic material cultivation period and work load can be greatly shortened. Specifically, the 4 genes related to starch metabolism are simultaneously transferred in, such that the total starch content of a transgenic regenerated plant is higher than that of wild-type plant.
Owner:NORTHEAST NORMAL UNIVERSITY

Expression vector resisting porcine circovirus type 2 (PCV2) and transgenic pig, and construction methods thereof

The invention discloses an expression vector resisting PCV2 and a transgenic pig and construction methods thereof, belonging to the field of gene engineering. The expression vector is constructed by respectively connecting an H1 promoter and a pPB-sh2 sequence to a pUC57-H1 plasmid and then connecting a fusion fragment containing a loxP-Neo / EGFP gene expression cassette to pPB-H1-sh2. The vector is introduced into the genome of a pig, and somatic cell nuclear transfer technology is employed to produce the transgenic pig. The expression vector provided by the invention has a piggyback transposon, greatly improves transformation efficiency, changes a common plasmid series recombination transgene integration model into a single-site single-copy integration model and better simulates the internal environment of a biological gene. The constructed transgenic pig degrades PCV2mRNA through siRNA synthesized by itself, thereby fundamentally inhibiting PCV2 infection.
Owner:SOUTH CHINA AGRI UNIV

Efficient, fast and stable gene transformation method for blueberries

The invention discloses an efficient, fast and stable gene transformation method for blueberries. The method comprises the following steps of 1 activation of culture, 2 plant material preparation, 3 preculture, 4 infection, 5 co-culture, 6 leaf washing, 7 callus induction, 8 bud induction and 9 root induction culture. According to the method, the gene transformation efficiency of the blueberries is improved, and the transformation rate can be above 10%. The concentration of bacterium liquid is reduced, and infection time is prolonged, so that agrobacterium pollution is avoided, and infection efficiency is improved. No drug or agentia assisting in infection is added to the infection bacterium liquid. Acetosyringone or other agentia assisting in infection is usually added in a traditional method, consequently, leaves are damaged, and the regeneration capacity of the leaves is reduced. Damage to the leaves of the blueberries is reduced, and the survival rate and regeneration rate of leaf culture are increased. A carrier carrying high expression and reporter genes is adopted, transgenic plants can be directly screened out through observation, and tedious work in traditional detection is avoided. The period of transgenosis is shortened.
Owner:JIANGSU POLYTECHNIC COLLEGE OF AGRI & FORESTRY

PiggyBac transposon mediated transgenic vector for inducing cell immortalization, its construction method and its application

The invention relates to a PiggyBac transposon mediated transgenic vector for inducing cell immortalization, a construction method and an application, which belongs to the gene engineering technical field. The vector is PB-rtTA-NIT-STP, which is constructed by the following method: constructing a LoxP-SV40P nco-IRES-tk-PolyA-LoxP gene expression cassette; connecting an amplified fragment of the gene expression cassette, constructing a basic transgenic vector PB-NIT; constructing a transgenic vector PB-NIT-STP containing target gene SV40T and p 53; and constructing a screening vector PB-rtTA-NIT-STP containing Tet binding domain rtTA. The transgenic vector constructed by the invention has the advantage of effectively raising the transgene efficiency, and is convenient for screening.
Owner:NORTHWEST A & F UNIV

Method for acquiring transgene cotton

The invention discloses a method for acquiring transgene cottons. The method comprises the following steps of: (1) cutting cotyledons, leaf stalks and a part of hypocotyl of cotton cotyledon seedlings and keeping r 1-3 cm of the hypocoty to obtain tissues to be infected at 25-30 DEG C and with the relative humidity 40-60%, and culturing for 2-3 days under dark environment; (2) scratching double surfaces from the top of a stem tip to the base part of the hypocotyl with the cut of 0.8-1.2 mm in depth; (3) dip-dyeing for 15-45 min in solution A which contains a recombination agrobacterium carrying exogenous genes; (4) co-culturing for 2-4 days and then carrying out resistance screening to obtain the resistant cotton seedling; and (5) grafting the resistant cotton seedling on a cotton rootstock to obtain the transgene cotton. The invention improves the conversion efficiency through adjusting the growth states of the stem tip, determining the appropriate depth of the agrobacterium-converted stem tip infection, adding acetosyringone and adjusting the proper pH value. Transgene plants can be quickly obtained by using the method, and the higher transgene efficiency is higher.
Owner:CHINA AGRI UNIV

Method of improving soybean genetic transformation efficiency by virtue of synergism of surfactant and ultrasonic waves and application of method

ActiveCN103614413AReduce necrosis rateHigh Resistant Cluster Bud RateFermentationGenetic engineeringTransformation efficiencyGenetically modified soybean
The invention discloses a method of improving the soybean genetic transformation efficiency by virtue of the synergism of a surfactant and ultrasonic waves and an application of the method. The method is an agrobacterium tumefaciens mediated soybean cotyledonary node genetic transformation method and comprises the following steps: infecting a soybean cotyledonary node explant by virtue of a recombinant agrobacterium tumefaciens containing a target DNA (Deoxyribonucleic Acid) to obtain an infected explant, co-culturing the infected explant to obtain the infected explant after co-culture, and completing the transformation, wherein the infected explant obtained by infecting the soybean cotyledonary node explant by virtue of the recombinant agrobacterium tumefaciens containing the target DNA is the infected explant obtained by arranging the soybean cotyledonary node explant into an infection liquid of the recombinant agrobacterium tumefaciens to carry out ultrasonic treatment, the infection liquid contains the surfactant, and scratches are not made at the cotyledonary node position of the soybean cotyledonary node explant. The method can be used for culturing a novel variety of transgenic soybeans as well as excavating and identifying gene functions.
Owner:INST OF CROP SCI CHINESE ACAD OF AGRI SCI

SNP molecular marker in close linkage with bacterial blight resistance gene Xa7 and applications of SNP molecular marker

The invention relates to molecular markers, and in particular discloses an SNP molecular marker K_060569 in close linkage with a bacterial blight resistance gene, wherein the sequence of the SNP molecular marker K_060569 is shown as SEQ ID No.1, and the basic group at the 61st bp site is C or G. The invention further provides a primer combination for carrying out Xa7 resistance gene detection on a rice material at high throughput by adopting the KASP reaction, and applications of the molecular marker and the primer combination in detecting the bacterial blight resistance gene Xa7 and in disease resistance assistant breeding of rice. According to the scheme, the KASP technology is adopted for carrying out genetic typing on the searched SNP molecular marker, the Xa7 gene can be rapidly and accurately detected, and the gene transferring breeding efficiency can be greatly improved; during the detection process, the operations such as digestion, electrophoresis and sequencing are not needed, so that the operation is simple and convenient, the high-throughput rapid detection is facilitated, the aerosol pollution of the PCR product, the pollution of EB to the environment, and the harm of formaldehyde to the human body are completely eradicated.
Owner:HUAZHI RICE BIO TECH CO LTD

Assistant plant transgene method based on centrifugal sedimentation

The invention relates to an assistant plant transgene method based on centrifugal sedimentation. The method comprises the following steps: mixing a plant acceptor material with agrobacterium; carrying out centrifugal sedimentation at a reasonable rotating speed, thereby finally obtaining a positive transformant. By virtue of centrifugal sedimentation, not only can the wound area of the acceptor material be increased, but also agrobacterium can penetrate into the acceptor material under the effect of the centrifugal force, so that the plant transgene efficiency is remarkably improved.
Owner:SHANGHAI JIAO TONG UNIV

Parental plasmid for obtaining minicircle DNA, and application thereof

The invention discloses a parental plasmid for obtaining minicircle DNA, and an application thereof. The parental plasmid is constructed by inserting an attR segment and an attL segment and a [Phi]C31 integrase gene expression cassette in a starting vector pEGFP-N1-attB, wherein the attR segment is inserted between cleavage sites of restriction enzymes SpeI and DraIII of the starting vector; the attL segment is inserted in the cleavage sites of restriction enzymes Af1 III and Ase I of the starting vector; and the [Phi]C31 integrase gene expression cassette is inserted in a cleavage site of the restriction enzyme Af1 III of the starting vector. The minicircle DNA for stable integration can be obtained rapidly, efficiently and economically by using the parental plasmid; subsequent transgenosis operational method is simple and practicable; and the parental plasmid has important biology significance and practical application values.
Owner:SHANGHAI CHILDRENS HOSPITAL +1

Method for cultivating high-female few-seed watermelon

The invention discloses a method for cultivating high-female few-seed watermelon. The method comprises the steps of obtaining different watermelon translocation materials Y-5 and YN-10, obtaining a watermelon high-female gene material H-12, performing high-female gene transfer on the Y-5 and the YN-10 taken as recurrent parents together with the H-12 by adopting the methods of generation-II back cross, generation-II self cross and generation-I test cross, hybridizing a homozygous YNC-10 high-female translocation material and a homozygous YC-5 high-female translocation material, and obtaining the high-female few-seed watermelon with objective traits through a field variety comparing-testing-breeding procedure. The method transfers different chromosome translocation to a female-parent material and a male-parent material respectively, thereby not only improving transfer efficiency but also ensuring that transfer materials are easy to protect. The watermelon cultivated by the method is few in watermelon seeds, convenient to eat, large in quantity of female flowers and easy to cultivate. In addition, due to few seeds, the method also reduces harmful effects of seed respiration on storage, thereby strengthening storage property.
Owner:TIANJIN RES INST OF VEGETABLE

Vector for carrying out site-specific mutagenesis on MSTN (Myostatin) and site-specific integration on PPARgamma (Peroxisome Proliferator-activated Receptor gamma) at same time

ActiveCN109679998ARealize simultaneous editingAchieving the goal of simultaneous editingGenetically modified cellsStable introduction of DNAMyostatinNuclear transfer
The invention discloses a vector for carrying out site-specific mutagenesis on MSTN (Myostatin) and site-specific integration on PPARgamma (Peroxisome Proliferator-activated Receptor gamma) at the same time, and recombinant cells. The vector comprises a Cas9 cutting expression vector and a targeting vector. According to the vector disclosed by the invention, a recombinant cell strain can be constructed by carrying out co-transfection on host cells by the Cas9 cutting expression vector and the targeting vector, the recombinant cell strain can be used as nuclear transfer donor cells for producing transgenic cloned embryo, function exertion of the MSTN can be inhibited, and meanwhile, specific expression of the PPARgamma in skeletal muscle cells can be realized, so that support is provided for quickly and efficiently developing high-quality transgenic beef new products.
Owner:NORTHWEST A & F UNIV

Method of performing gene correction on hemopoietic stem cells of patient with Mediterranean anemia

The invention discloses a method of performing gene correction on hemopoietic stem cells of a patient with Mediterranean anemia. The method is characterized by comprising the steps of I, selecting CRISPR target near an HBB gene-28 (A / G) site, and designing a gRNA sequence; II, constructing a template plasmid, and inserting a dual-ITR (inverted terminal repeat) sequence of piggyBac between upstreamand downstream 500bp sequences of the HBB gene CRISPR target; III, co-transfecting the hemopoietic stem cells of the patient with Mediterranean anemia through a transfection reagent, the template plasmid, gRNA and Cas9 carrier, and performing puromycin screening on a cell medium; IV, authenticating and verifying a resistant gene. The CRISPR / Cas9 system and piggyBac are jointly utilized; the hemopoietic stem cells of the patient with Mediterranean anemia can be transfected effectively; homologous recombination efficiency can be improved; -28(A / G) mutation site of the patient with Mediterraneananemia can be corrected effectively.
Owner:杭州荣耀星泽医药有限公司

Molecular marker for identifying sesame male sterile line of sesame and identifying method thereof

The invention provides a molecular marker for identifying sesame male sterile line of sesame and an identifying method thereof. The molecular marker uses Primer Premier 5.0 software to design primers (InDel70F and InDel70R); when a homozygous recessive sterile plant is amplified by the primers, the length of an amplifying fragment is 140bp; when a dominant homozygous fertile plant is amplified, the length of an amplifying fragment is 130bp; when a dominant hybrid fertile plant is amplified, two amplifying fragments are used, wherein the length of one amplifying fragment is 140bp, and the length of the other amplifying fragment is 130bp. The molecular marker has the advantages that the male sterility aided selection of the sesame is performed by the molecular marker, the transformation cycle is shortened, the transformation efficiency is improved, the troublesome procedure of selfing identification of sterility required by each generation in the transformation process is not needed, the traditional phenotype selection is converted into the gene selection, and the accuracy and scientificity of selection are improved; the male sterile line of the sesame is identified by the molecular marker in the seedling period, the production purity of sesame seeds is guaranteed, the labor is saved, the cost is reduced, and the working efficiency is improved.
Owner:HENAN SESAME RES CENT HENAN ACADEMY OF AGRI SCI

Method for remarkably improving instantaneous conversion efficiency of peach leaves through weak light treatment

The invention belongs to the technical field of biology, relates to an instantaneous conversion method of peach leaves, and particularly relates to an instantaneous conversion method of peach seedlingleaves, and mainly solves the problem of low conversion efficiency of the peach leaves. The method comprises the following specific steps of: (1) removing external hard endocarps of peach pits storedin sand at a low temperature (4 DEG C), sowing seeds in nutrient soil, and culturing in an environment with the temperature of 22 DEG C, the humidity of 75% and the illumination of 6,000 to 8,000 lux; (2) culturing peach seedlings with the seedling age of 10 to 15 days for 5 to 8 days under the condition of the illumination intensity of 600 to 800 lux for later use; and (3) selecting the peach seedlings treated in the step (2), and performing instantaneous conversion by a conventional agrobacterium-mediated leaf vacuumizing method. The conversion efficiency of the peach seedling leaves subjected to weak light treatment is extremely remarkably improved; compared with a conventional conversion method, the method has the advantage that the GUS activity is improved by 5.64 times after GUS genes are instantaneously converted.
Owner:HENAN AGRICULTURAL UNIVERSITY

Cultivation of watermelon with few seeds

A method for culturing the less-seed water melon includes such steps as determining the chromosome translocation material to obtain two non-homologous chromosome translocating bodies with different translocation sites, back crossing or selfing or test crossing to transfer them respectively to the male parent and female parent, hybridizing between said male and female parents, discriminating in field, and variety comparison. Its advantages are high transfer efficiency, and high effect to decrease the number of seeds by 45-55%.
Owner:TIANJIN KERNEL VEGETABLE RES INST

Dairy cattle mammary epithelial cell immortalizing method

The invention provides a dairy cattle mammary epithelial cell immortalizing method. The dairy cattle mammary epithelial cell immortalizing method is characterized in that when primary generation dairy cattle mammary epithelial cells are infected through HPV E6 and E7 viruses to be immortalized, pantropic and facultative virus particles are added, and thus the virus infection efficiency is improved. The invention further provides a method for establishing an immortalized dairy cattle mammary epithelial cell line. The method for establishing the immortalized dairy cattle mammary epithelial cell line comprises the following steps that firstly, dairy cattle mammary tissue is subjected to tissue block primary generation culture in a culture bottle; secondly, the primary generation dairy cattle mammary epithelial cells are infected through the virus method, and the primary generation dairy cattle mammary epithelial cells are immortalized; thirdly, positive clone is selected, and the cell line is cultured. By means of the methods, the dairy cattle mammary epithelial cells can be efficiently immortalized, the dairy cattle mammary epithelial cell line high in growth speed and capable of achieving stable continuous passage is established, the dairy cattle mammary epithelial cells with the physiological function are obtained, and experimental cell materials are provided for researching control over lactation nutrition of the dairy cattle mammary epithelial cells and the pathogenesis of diary cattle mastitis.
Owner:YANGZHOU UNIV

A kind of birch transgenic method

The invention discloses a white birch transgenosis method, belongs to the field of plant gene engineering and aims at solving the problem that white birch transgenosis is low in efficiency, difficult in sterilization and long in period. The method includes: 1, selecting white birch seeds, soaking, and picking mature seeds which are fully expanded by absorbing, submerged at the bottom of a bottle and germinated completely as transgenosis receptors; 2, sterilizing; 3, preparing engineering bacterium liquid used for infection of the seed receptors; 4, longitudinally cutting the seeds, and dip-dyeing; 5, placing the seeds in a liquid callus induction medium for co-culture; 6, obtaining a transgenosis strain to complete through callus culture, differential culture, subculture and rooting culture. By using the method, culture of a white birch explant is not needed, so that transgenosis period is shortened; a liquid co-culture mode is adopted, so that repeated sterilization steps are omitted, and white birch transgenosis efficiency is improved; conversion efficiency is high, period is short, and the problem that white birch transgenosis is low in efficiency, difficult in sterilization and long in period is solved. The white birch stain is high in transplanting survival rate, and the method is simple to operate and easy to master.
Owner:NORTHEAST FORESTRY UNIVERSITY

White birch transgenosis method

The invention discloses a white birch transgenosis method, belongs to the field of plant gene engineering and aims at solving the problem that white birch transgenosis is low in efficiency, difficult in sterilization and long in period. The method includes: 1, selecting white birch seeds, soaking, and picking mature seeds which are fully expanded by absorbing, submerged at the bottom of a bottle and germinated completely as transgenosis receptors; 2, sterilizing; 3, preparing engineering bacterium liquid used for infection of the seed receptors; 4, longitudinally cutting the seeds, and dip-dyeing; 5, placing the seeds in a liquid callus induction medium for co-culture; 6, obtaining a transgenosis strain to complete through callus culture, differential culture, subculture and rooting culture. By using the method, culture of a white birch explant is not needed, so that transgenosis period is shortened; a liquid co-culture mode is adopted, so that repeated sterilization steps are omitted, and white birch transgenosis efficiency is improved; conversion efficiency is high, period is short, and the problem that white birch transgenosis is low in efficiency, difficult in sterilization and long in period is solved. The white birch stain is high in transplanting survival rate, and the method is simple to operate and easy to master.
Owner:NORTHEAST FORESTRY UNIVERSITY

Transgenic method based on RMCE technology

The invention discloses a transgenic method based on the RMCE technology. The transgenic method comprises the following steps: establishing a carrier by taking Rosa26 carrier as a framework and adding with Lox2272 locus or Attp70 locus; after correct sequencing of the carrier, electrotransferring to an ES cell, and screening by adopting a culture medium containing antibiotics, thus obtaining a positive ES cell; verifying again by PCR or Southern Blot; transferring plasmids with Flp recombinase into the positive ES cell, thus obtaining a new positive ES cell; and administrating the positive ES cell after successful verification into the blastaea of a mouse through micro-injection, and then transferring into a surrogate mother mouse, thus obtaining an RMCE tool mouse with a fluorescent mark. The transgenic method is obtained by integrating RMCE and recombinase technology, thus having the advantages of the RMCE technology, and also being capable of realizing fixed-point implantation of genes, and moreover, the the test cycle is short, the efficiency is high, and the toxicity caused by random insertion of the genes is also reduced.
Owner:CYAGEN BIOSCI INC

High-efficiency recombined adenovirus containing ndrg2 gene and pharmic purpose thereof

The invention provides a high-efficiency recombined adenovirus containing an ndrg2 gene and the pharmic purpose thereof. The recombined adenovirus contains the ndrg2 gene, a Gateway system and a Virapower TM Adenoviral Expression system are utilized in the construction process, and the adenovirus is packed by a recombination method in vitro. After being cloned to an introduction carrier, a target gene can be efficiently and quickly cloned to other carriers of a receptor by specific recombination sites on the carriers and recombinase without depending on a restriction enzyme. The package of the adenovirus in vitro simplifies the experiment steps, shortens the operation time, and has high multiplication efficiency, high transgene efficiency and high virus yield efficiency as well as the transduction efficiency as high as 100 percent. The invention solves the technical problem of recombination and package of the ndrg2 gene in vitro as well as probes and determines the lethal effect of the high-efficiency recombined adenovirus to brain glioma cells and cells of lung cancer, liver cancer, gastric cancer and colon cancer. The high-efficiency recombined adenovirus can be used as a medicament for treating brain glioma, long cancer, liver cancer, gastric cancer and colon cancer.
Owner:FOURTH MILITARY MEDICAL UNIVERSITY

Method for improving agrobacterium-mediated malus plant conversion efficiency by using ultrasonic

The invention belongs to the field of biological engineering breeding disclosing a method of increasing the conversion efficiency of Malus plants mediated by Agrobacterium using ultrasonic. Chipping the Malus octa-edged begonia leaves into small pieces, immerging in 75mg.L-1As Agrobacterium suspension with OD600 0.6 for two minutes, treating with 100 w ultrasonic, transferring to regeneration medium for resistance screening, transforming Malus octa-edged begonia leaves to obtain resistant callus and resistant seedling with a conversion rate of 2.2%. Ultrasonic technology is first applicated in the genetic transformation of Malus plants greatly enhancing transgenic efficiency of Malus plants. The application of ultrasonic assisted Agrobacterium-mediated gene transduction for transducting rolC and transforming Malus rootstock octa-edged begonia receives a 2.2% conversion efficiency, which is consumedly higher than ordinary Agrobacterium mediated method with 0.1 ~ 0.8% conversion efficiency.
Owner:NANJING AGRICULTURAL UNIVERSITY