STS molecular marker for identifying high rice bacterial blight resistant genes and application thereof

A technology of resistance to bacterial blight and molecular markers, applied in the field of molecular genetic breeding, can solve the problem that the Xa7 gene has not been cloned, and achieve the effects of improving breeding efficiency, good stability, and short cycle

Inactive Publication Date: 2013-01-23
ZHEJIANG NORMAL UNIVERSITY
View PDF6 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Despite this, the Xa7 gene has not been cloned so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • STS molecular marker for identifying high rice bacterial blight resistant genes and application thereof
  • STS molecular marker for identifying high rice bacterial blight resistant genes and application thereof
  • STS molecular marker for identifying high rice bacterial blight resistant genes and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1. Primer design: According to the Fosmid clone sequence of Zhenhui 084, a pair of PCR primers were designed at both ends of the difference sequence between Zhenhui 084 and Nipponbare genome. The sequence is

[0028] Forward primer: 5' GGGAGAAATTGGCCCCAGTTAGAGAA 3',

[0029] Reverse primer: 5' GCTTCACTTGATCACTGCTGTTTG 3'.

[0030] The primers can be synthesized by Invitrogen Company.

[0031] 2. DNA extraction: Genomic DNA is extracted from rice leaves. There are many DNA extraction methods reported, and one can be selected arbitrarily. This discovery uses a simple rice DNA extraction method reported by Chen Wenyue et al. (China Rice Science, 2005, 19: 561-563).

[0032] 3. PCR amplification: Add 20 ng of rice DNA, 0.25 μM each of forward and reverse primers, 100 μM each of 4 kinds of dNTPs (dCTP, dGTP, dATP, dTTP, 1 ×PCR Buffer, 1 enzyme activity unit of Taq DNA polymerase, dilute to 20 μl with deionized water, and mix thoroughly. The above-mentioned PCR reagents (...

Embodiment 2

[0053] Known rice varieties "Zhenshan 97, Longtefu, and Xieteqing" do not contain the Xa7 gene and are not resistant to bacterial blight PXO86. These three rice varieties were backcrossed with the bacterial blight-resistant rice variety IRBB7 (containing the Xa7 gene) several times, and the molecular markers described in the present invention were used for auxiliary selection, and the Xa7 gene was successfully transferred to this Among varieties, the resistance to bacterial blight was significantly enhanced. Taking Zhenshan 97, one of the varieties, as an example, the specific process is as follows:

[0054] The rice variety IRBB7 containing the Xa7 gene was used as the male parent and crossed with the female parent variety Zhenshan 97 to obtain F 1 Progeny and the recurrent parent Zhenshan 97 were backcrossed multiple times, and the Xa7 gene was transferred to Zhenshan 97. Since the offspring of the backcross would segregate, only a part of the individuals in the population ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an STS molecular marker for identifying high rice bacterial blight resistant genes. A nucleotide sequence of the molecular marker is SEQ ID NO: 1. The STS molecular marker is the following primer pairs, wherein the nucleotide sequence is 5'--3', the forward primer is 5'GGGAGAAATTGGCCCCAGTTAGAGAA3', the reverse primer is 5' GCTTCACTTGATCACTGCTGTTTG3'. Use of the STS molecular marker for helping to selectively breeding rice bacterial blight resistant Xa7 genes or cloning Xa7 genes.

Description

technical field [0001] The invention relates to a molecular marker of a gene with high resistance, broad spectrum and long-lasting resistance to rice bacterial blight and its application in breeding, which belongs to the field of molecular genetic breeding. Background technique [0002] Rice bacterial blight is a worldwide bacterial disease caused by Gram-negative Xanthomonas oryzae pv. Oryzae, Xoo. The "three major diseases". When rice suffers from bacterial blight, the yield is generally reduced by 20-30%, and in severe cases it can reach 50%, or even no harvest, and the quality of rice will also be affected. Since the 1950s, the incidence of rice bacterial blight has gradually expanded and spread to all major rice producing areas in the world (Mew, 1987). At present, the hybrid rice grown in a large area in China has relatively poor resistance to bacterial blight. The main reason is that the three-line hybrid rice Nakano, Dwarf, Oka, D, Yinshui and Honglian are sterile....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor陈析丰陈龙王月顾志敏马伯军
OwnerZHEJIANG NORMAL UNIVERSITY