Composition and method for improving recombination efficiency of transgenic cells

A technology of transgenic cells and compositions, applied in the field of transgenic, can solve the problems of low efficiency of single-nick Cas9 nuclease, ineffective gene sequence, TALEN off-target, etc., and achieve the effect of improving recombination efficiency

Active Publication Date: 2019-12-10
广州赛业百沐生物科技有限公司
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The first is the traditional ES targeting scheme. Its disadvantages are: (1) A series of steps such as complex targeting vector construction, ES cell screening, and chimera mouse breeding are required. Large, time-consuming, and low efficiency; (2) Different strains of mice require different ES cells. At present, the common C57BL / 6 strain is used for ES targeting, and no related strains have been seen for other strains. to report
For example, point mutation models are mainly used to study human diseases, which often require the use of special strains. Since there are no related ES cells, ES targeting technology cannot be used for preparation
[0005] The second is the TALEN scheme: its disadvantages are: (1) The TALEN protein designed to recognize a 20-base sequence contains more than a thousand amino acids, which may cause the body's immune response, which will reduce the role of TALEN in cells; (2) ) TALEN also has off-target problems, which may be caused by the state of chromosomes in cells, such as TALEN technology has no effect on gene sequences in heterochromosomal structures; (3) Is TALEN technology capable of incorporating large fragments? At present, the application of TALEN technology mainly focuses on gene knockout, but whether it is suitable for large fragment gene insertion needs further study
Disadvantages of wild-type hCas9: (1) It is easy to cause off-target effects; (2) It is easy to cause lethality for important mutation points of some important genes
Disadvantages of the mutant Cas9_D10A: Two different sgRNAs recognize the sequences on both sides of the target site separately, and then combine with single-nicking Cas9 nuclease to cut the two strands separately, thereby improving the specificity of target site recognition. Reduced off-target effects, but due to the low efficiency of single-cut Cas9 nuclease, the positive rate of Cas9_D10A scheme is relatively low
The second DNA break repair pathway is homology-mediated repair (HR, homology-directed repair). This repair mechanism based on homologous recombination has high fidelity, but has a low probability of occurrence
[0010] Homozygous lethal transgenic animals, such as transgenic mice, are generally constructed using the method of conditional point mutation of fertilized eggs. The construction process is cumbersome, the construction is very difficult, the positive rate is very low, and the cycle is very long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Composition and method for improving recombination efficiency of transgenic cells
  • Composition and method for improving recombination efficiency of transgenic cells
  • Composition and method for improving recombination efficiency of transgenic cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1: Method for preparing Fars2 gene point mutation rats using CRISPR-Cas9 system

[0077] Specific operations include:

[0078] 1. sgRNA target design

[0079]Extract the 50 bp sequences of the upstream and downstream of the rat Fars2 gene D142 in the NCBI database, as follows, and design the target site:

[0080] ACTTCGATAGCCTGCTAATCCCAGCTGACCACCCCAGCAGGAAGAAGGGGGACAA CTATTACTTGAATCGGGGACACATGCTGAGAGCACACACATCAGCACA (SEQ ID NO.: 1).

[0081] Meet 5'-NNNNNNNNNNNNNNNNNNNN NGG There are 10 in -3', because the gene has homozygous lethality, the designed gRNA uses a more specific mutant Cas9 (Cas9_D10A) to reduce the lethality caused by off-target. Cas9_D10A requires a pair of head-to-head gRNAs to recognize and cut double-stranded DNA. Since the mutation point is D142Y, if the designed gRNA pair does not contain D142, the gRNA will continue to cut after recombination, and no specific positive results will be obtained. Considering For this question, only gRNA pa...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a composition and a method for improving recombination efficiency of transgenic cells. Through transgenic cells processed by adopting a culture medium containing SCR7, RS-1 orL755507, the HDR efficiency of the transgenic cells is improved. According to some embodiment of the invention, through using specific sgRNA combination, the higher transgenic efficiency is achieved,and the defects that a fertilized ovum is damaged more seriously because of secondary injection and the positive reproductive number is insufficient because the birth rate is dropped more seriously are solved.

Description

technical field [0001] The invention relates to the field of transgenes, in particular to a composition and a method for improving the recombination efficiency of transgenic cells. Background technique [0002] Animal models, especially transgenic mouse models, are an important tool for various life science researches and have a wide range of applications. [0003] Among many transgenic animals, point mutant mice are common transgenic animal models due to their ease of cultivation and relatively low cost. There are mainly three methods for preparing point mutant mice in the prior art: [0004] The first is the traditional ES targeting scheme. Its disadvantages are: (1) A series of steps such as complex targeting vector construction, ES cell screening, and chimera mouse breeding are required. Large, time-consuming, and low efficiency; (2) Different strains of mice require different ES cells. At present, the common C57BL / 6 strain is used for ES targeting, and no related stra...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/90C12N15/89A01K67/027
CPCC12N15/907A01K2227/105C12N15/89A01K67/0275A01K2267/0318
Inventor 黎肖容
Owner 广州赛业百沐生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products