Expression vector resisting porcine circovirus type 2 (PCV2) and transgenic pig, and construction methods thereof
A technology of porcine circovirus and its construction method, which is applied in the field of transgenic pigs resistant to porcine circovirus type 2 and its construction, which can solve the problems of undetected whether the siRNA is correctly expressed, unfavorable development of safety tests of transgenic organisms, and slow genetic progress, etc. , to achieve the effect of improving transgenic efficiency, facilitating detection, and inhibiting infection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1 Anti-porcine circovirus type 2 piggyBac transposon expression vector: construction of pPB-H1-sh2-CMV-Neo / EGFP
[0054] Include the following steps:
[0055] (1), synthetic H1 promoter sequence
[0056] The sequence of the H1 promoter comes from the commercial vector pSilencer3.1-H1-neo plasmid (Ambion Company), and its length is 99bp. A restriction site XhoI was added to the 5' end of the H1 promoter sequence, and a restriction site EcoRI was added to the 3' end, and a company was commissioned to synthesize the sequence, and the synthesized H1 sequence was SEQ ID NO:1. Insert the H1 promoter sequence into the plasmid pUC57 (GenScript Biotechnology Co., Ltd.), named pUC57-H1; design primers (H1-F: GAACCCACTGCTTACTGGCTTATCG; H1-R: GGCTGGCAACTAGAAGGCACAGTCGAGGC) to amplify the H1 promoter in the plasmid pUC57-H1 subsequence, and then recover the PCR product; by figure 1 It can be seen that the size of the amplified sequence of the H1 promoter in the plasmid ...
Embodiment 2
[0092] Example 2 Using the expression vector constructed in Example 1 to construct a transgenic pig resistant to porcine circovirus type 2
[0093] Include the following steps:
[0094] 1. Screening for stably expressed monoclonal antibodies
[0095] The transposon plasmid pPB-H1-sh2-CMV-Neo / EGFP (i.e. the expression vector constructed in Example 1) and the transposase plasmid mPB (gifted by Sanger Institute) were mixed and co-transfected into a porcine fetal fibroblast cell line; Antibiotic-free cell growth medium containing 10% fetal bovine serum was used to resuscitate porcine fetal fibroblasts into a 60mm diameter cell culture dish, and the cells were used for transfection when they reached 50%-80% confluency. The transfection steps are as follows:
[0096] (1) Mix the transposon plasmid pPB-H1-sh2-CMV-Neo / EGFP and the transposase plasmid mPB at a molar ratio of 3:1 and add to 1000 μL In the centrifuge tube of I (life technology), mix well;
[0097] (2) PLUS TM Mix...
Embodiment 3 Embodiment 2
[0116] Example 3 The detection of the anti-porcine circovirus type 2 transgenic pig constructed in Example 2
[0117] Detect by the following method
[0118] 1. Green fluorescence detection
[0119] Directly irradiated with blue light for detection, transgenic positive pigs can emit green fluorescence, such as Figure 7 As shown, all anatomical organs of the transgenic pigs emit green fluorescence, which preliminarily proves that the transgenic plasmid resistant to porcine circovirus type 2 has been integrated and can be expressed in the transgenic pigs.
[0120] 2. Detection of DNA level
[0121] Detection of DNA level by PCR, southern blot, IPCR and other methods, Figure 8 For transgenic pig PCR, southern blot results, from Figure 8 It can be seen that the PCR amplification product of the DNA of the transgenic pig and the plasmid (the plasmid integrated into the transgenic pig is the carrier constructed in Example 1, but does not contain the Amp part) has the pPB-sh2 g...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
| control rate | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



