Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Transgenic method based on RMCE technology

A transgenic and technological technology, applied in the field of genetic modification, can solve problems such as uncertain insertion position and copy number, gene silencing, and affecting genome expression, achieving the effects of short cycle, reduced toxicity, time and cost savings

Inactive Publication Date: 2015-11-18
CYAGEN BIOSCI INC
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The invention solves the problem of uncertain insertion position and copy number of existing transgenic technology, causing gene silencing, changing the expression level of cell or tissue-specific genes, and even affecting the expression of the entire genome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic method based on RMCE technology
  • Transgenic method based on RMCE technology
  • Transgenic method based on RMCE technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0050] Introduction to the inserted gene: Human Cholinergic Receptor, Muscarinic4 (CHRM4) gene, Ensembl's gene number is ENSG00000180720, the gene coding region is 1437bp in length; it has various functions, such as participating in the inhibition of adenylate cyclase and the degradation of phosphoinositide. All DNA templates such as EF1α, eGFP gene, and CHRM4 gene in this example were synthesized by Suzhou Jinweizhi Gene Company.

[0051] (1) Construction of tool mouse

[0052] 1. Vector construction: add the Lox2272 site, EF1α, eGFP gene, LoxP site, Frt site, Neo and DTA termination regions to the backbone of the Rosa26 vector. Carrier skeleton such as Figure 21 .

[0053] 1) PCR amplification of the fragment:

[0054] Primers for introducing EF1α and Lox2272 sites:

[0055] mRosa26-EF1a-F / HpaI: GGCTCCGGTGCCCGTCAGT

[0056] mRosa26-EF1α-R / AsisI: TCACGACACCTGAAATGGAAG

[0057] Remarks: The bold part is the homology arm, and the gray part is the sequence of the Lo...

Embodiment 2

[0150] Insert gene introduction: human NQO1 gene, Ensembl's gene number is 14910, the gene coding region is 825bp in length; it encodes a reduced coenzyme / quinone oxidoreductase, also known as DT-lipoamide dehydrogenase (DT-diaphorase) , is a flavin enzyme, NQO1 is widely distributed in organs, but the highest level is in the liver, kidney, and gastrointestinal tract. NQO1 enzyme can be induced by various chemicals, such as polycyclic aromatic hydrocarbons, hydroquinone, acrylate, broccoli (cruciferous plant extract), etc. NQO1 enzyme belongs to phase II metabolic enzymes. Together with other phase I and phase II metabolic enzymes, it constitutes the metabolic network of exogenous toxic substances in vivo and plays an important role in the detoxification and metabolism of the body. Polymorphisms in NQO1 reduce the ability of the NQO1 enzyme to detoxify chemicals, increasing the risk of blood disorders.

[0151] All DNA templates such as CMV and eGFP genes in this example were...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a transgenic method based on the RMCE technology. The transgenic method comprises the following steps: establishing a carrier by taking Rosa26 carrier as a framework and adding with Lox2272 locus or Attp70 locus; after correct sequencing of the carrier, electrotransferring to an ES cell, and screening by adopting a culture medium containing antibiotics, thus obtaining a positive ES cell; verifying again by PCR or Southern Blot; transferring plasmids with Flp recombinase into the positive ES cell, thus obtaining a new positive ES cell; and administrating the positive ES cell after successful verification into the blastaea of a mouse through micro-injection, and then transferring into a surrogate mother mouse, thus obtaining an RMCE tool mouse with a fluorescent mark. The transgenic method is obtained by integrating RMCE and recombinase technology, thus having the advantages of the RMCE technology, and also being capable of realizing fixed-point implantation of genes, and moreover, the the test cycle is short, the efficiency is high, and the toxicity caused by random insertion of the genes is also reduced.

Description

technical field [0001] The invention belongs to the technical field of gene modification, and in particular relates to a transgenic method based on RMCE technology. Background technique [0002] The existing transgenic technology mostly adopts microinjection, which has the advantages of short test period, the length of the target gene fragment can reach 100kb, and high integration efficiency, but there are still many deficiencies and shortcomings, such as foreign genes are inserted randomly. The integration site and copy number of the recipient genome cannot be accurately grasped, which may cause gene silencing, change the expression level of cell or tissue-specific genes, or even affect the expression of the entire genome, resulting in the loss of good traits of the host, or even The emergence of lethal traits. [0003] Compared with similar methods, recombinase-mediated cassette exchange technology (Recombinase-Mediated Massette Exchange, RMCE) has the characteristics of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85A01K67/027
Inventor 郑敦武黎妃凤王正龙苏翠俞晓峰
Owner CYAGEN BIOSCI INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com