Recombinant vector for expressing chromatin domain Y-like protein CDYL and application thereof

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a recombinant vector for expressing chromatin structural domain Y-like protein CDYL and application of the recombinant vector. In order to screen a key crotonyl-coenzyme A metabolic enzyme in heart failure, a medicine for treating heart failure is provided, and the invention provides a recombinant vector for expressing chromatin domain Y-like protein CDYL, which comprises a gene for coding the chromatin domain Y-like protein CDYL. The invention also provides an application of the recombinant vector in preparation of a medicine for preventing or treating heart failure, through over-expression of CDYL, cardiac systolic function impairment caused by constriction of the thoracic aortic arch for four weeks can be improved, myocardial hypertrophy, myocardial fibrosis and heart failure can be improved, pathological myocardial cell hypertrophy can also be reduced, and heart failure can be prevented and treated. The compound can be used for preparing the medicine for treating heart failure and has important practical significance.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a recombinant vector expressing a chromatin domain Y-like protein CDYL and a use thereof. Background Art

[0002] Heart failure is the leading cause of high morbidity and mortality worldwide. Heart failure is a complex multisystem clinical syndrome, and common risk factors include hypertension, coronary artery disease, diabetes, obesity, and aging. With the increase in life expectancy and the acceleration of population aging in my country, heart failure will continue to increase the economic burden. The pathogenesis of heart failure is complex, accompanied by pathological remodeling of cardiac structure, metabolic remodeling, deterioration of cardiac function, and abnormal expression of multiple genes. In clinical diagnosis, diagnosis is usually made based on a combination of multiple examination results, such as a detailed medical history, physical examination, electrocardiogram, echocardiogram, and blood tests for heart failure markers. Most clinical treatment strategies target the neurohormonal system, such as angiotensin II receptor blockers and β-blockers, and there is currently a lack of specific intervention methods in clinical practice. Therefore, further exploration of precise intervention targets for heart failure combined with gene therapy is conducive to timely targeted intervention to prevent the occurrence of heart failure, which is of great clinical significance.

[0003] Post-translational modifications are closely related to the remodeling process caused by various heart diseases and may serve as potential intervention targets for heart failure. Lysine crotonylation (Kcr) is a new evolutionarily conserved histone post-translational modification that is widely present in all core histones (H2A, H2B, H3 and H4), linker histone H1, marked active promoters and potential enhancers. It is essential for chromatin activity and transcriptional events. Kcr is catalyzed by adding crotonyl residues from donor crotonyl-CoA to the target protein. Therefore, crotonyl-CoA is a key factor in determining the level of crotonylation. Crotonyl-CoA in cells is produced by mitochondrial or peroxisomal fatty acid oxidation and metabolic processes such as lysine and tryptophan. Genetic or environmental factors can change the concentration of crotonyl-CoA in cells, thereby changing the level of histone crotonylation and playing a role in physiological and pathological processes. Existing studies have reported that Kcr plays a key role in reproductive development, tumors and tissue fibrosis. Recent studies have also found that cardiac Kcr has important pathophysiological significance in the process of myocardial injury and the maintenance of cardiac homeostasis. However, the regulatory role and mechanism of histone Kcr and crotonyl-CoA metabolism in heart failure remain largely unclear and need to be elucidated.

[0004] Chromodomain Y-like (CDYL) proteins act as crotonyl-CoA hydratase, which can convert crotonyl-CoA into β-hydroxybutyryl-CoA and negatively regulate histone Kcr. It has been reported that CDYL is involved in pathological processes such as tumor pathology and neurodevelopment, but whether it has a relevant role in cardiovascular disease remains to be studied. Summary of the invention

[0005] The technical problem to be solved by the present invention is: to screen therapeutic targets and drugs related to heart failure and provide a new way to treat heart failure.

[0006] The technical solution of the present invention to solve the above technical problem is: providing a recombinant vector expressing the chromatin domain Y-like protein CDYL, wherein the recombinant vector comprises a gene encoding the chromatin domain Y-like protein CDYL.

[0007] Among them, in the above-mentioned recombinant vector, the nucleotide sequence of the gene encoding the chromatin domain Y-like protein CDYL is shown in SEQ ID NO:1.

[0008]

[0009] Among them, in the above-mentioned recombinant vector, the recombinant vector is a viral vector; preferably an adenovirus vector or an adeno-associated virus vector.

[0010] Preferably, the adenovirus vector construction sequence is pAdEasy-EF1-MCS-3flag-CMV-EGFP.

[0011] The target nucleotide sequence inserted into the adenoviral vector is shown in SEQ ID NO:1.

[0012] Preferably, the adeno-associated virus vector is constructed in the sequence of pHBAAV-TNT-3flag-P2A-EGFP.

[0013] The target nucleotide sequence inserted into the adeno-associated virus vector is shown in SEQ ID NO:1.

[0014] The present invention also provides a host cell comprising the above recombinant vector.

[0015] Furthermore, the host cell is a cardiomyocyte.

[0016] The present invention also provides a use of the above-mentioned recombinant vector and host cell in preparing a medicine for preventing or treating heart failure.

[0017] Wherein, in the above use, the heart failure is heart failure caused by pressure overload.

[0018] Wherein, in the above use, the heart failure includes left ventricular systolic dysfunction, myocardial hypertrophy or myocardial fibrosis.

[0019] The beneficial effects of the present invention are:

[0020] The present invention screens crotonyl-CoA hydratase related to heart failure and finds that chromatin domain Y-like protein CDYL is closely related to heart failure. Therefore, the present invention constructs a recombinant vector overexpressing CDYL, and studies have found that the recombinant vector can overexpress CDYL, thereby preventing or treating heart failure, especially heart failure caused by pressure overload. It has a good effect, not only can improve the impaired left ventricular systolic function caused by TAC 4 weeks, relieve myocardial hypertrophy, and reduce myocardial fibrosis. In cell experiments, overexpression of CDYL can also reduce the area of ​​myocardial cells increased by crotonate stimulation, and reduce the expression of myocardial hypertrophy genes such as Nppa and Nppb. The present invention provides a new drug and method for the treatment of heart failure. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1To screen the key crotonyl-CoA-related metabolic enzymes in heart failure. A is the analysis of the gene expression of crotonyl-CoA metabolic enzymes directly regulating heart failure using public databases; B is the analysis of the role of several crotonyl-CoA metabolic enzymes in the prediction of heart failure patients using receiver operating curves; C is the significant downregulation of CDYL protein expression in the heart failure model induced by pressure overload; D is the significant downregulation of CDYL protein expression in the heart failure model induced by angiotensin II. *, p<0.05, ***, p<0.001, n=4.

[0022] Figure 2 Adenoviral vector map.

[0023] Figure 3 Overexpression of CDYL in cardiomyocytes by adenovirus can reduce the area of ​​cardiomyocytes. A is the overexpression efficiency of CDYL in cardiomyocytes detected by western blot; B is that overexpression of CDYL significantly reduced Crotonate-induced cardiomyocyte hypertrophy; C is that overexpression of CDYL downregulated the gene expression of cardiomyocyte hypertrophy markers. ***, p<0.001, n=3-5.

[0024] Figure 4 Adeno-associated virus vector map.

[0025] Figure 5 Overexpression of CDYL in mice significantly improves TAC-induced heart failure. A is the timeline of animal experiment design and the efficiency of CDYL overexpression in animals mediated by adeno-associated virus; B is that overexpression of CDYL significantly reduces ejection fraction (EF) and fraction shortening (FS); C is that overexpression of CDYL significantly reduces myocardial cross-sectional area; D is that overexpression of CDYL significantly reduces myocardial fibrosis; E is that overexpression of CDYL significantly reduces the gene expression of myocardial hypertrophy and myocardial fibrosis markers. ***, p<0.001, n=5-12.

[0026] Figure 6 Overexpression of CDYL in mice significantly improved the established TAC-induced myocardial injury. A is the timeline of animal experiment design; B is that overexpression of CDYL significantly improved the contractile function of the mouse heart; C is that overexpression of CDYL significantly reduced the cross-sectional area of ​​the myocardium; E is that overexpression of CDYL significantly reduced myocardial fibrosis; D is that overexpression of CDYL significantly reduced the gene expression of myocardial hypertrophy and myocardial fibrosis markers. *, p<0.05, ***, p<0.001, n=5-12. DETAILED DESCRIPTION

[0027] The present invention provides a recombinant vector expressing a chromatin domain Y-like protein CDYL. The recombinant vector comprises a gene encoding the chromatin domain Y-like protein CDYL and can overexpress CDYL in vivo, thereby preventing or treating heart failure.

[0028] First, the present invention analyzes the gene expression of crotonyl-CoA metabolic enzymes that directly regulate heart failure in humans and finds that CDYL has significant changes in heart failure. Then, by drawing the receiver operating characteristic (ROC) curve, it is found that CDYL shows the highest efficiency in predicting heart failure, suggesting that CDYL may be closely related to heart failure.

[0029] Afterwards, the present invention established a heart failure model by transverse aortic constriction (TAC) surgery, and detected the expression of CDYL protein in the myocardial tissue of normal mice and mice with heart failure caused by TAC, and found that compared with the normal heart, the expression of CDYL in the heart of heart failure caused by TAC was significantly downregulated, which has the same trend as human heart failure. At the same time, the present invention constructed a heart failure model by angiotensin II, and detected the expression of CDYL protein in the myocardial tissue of normal mice and mice with heart failure induced by angiotensin II (AngⅡ). It was found that compared with the normal heart, the expression of CDYL in the heart of heart failure induced by angiotensin II was significantly downregulated, which also has the same trend as human heart failure.

[0030] Therefore, the present invention conducted a cell experiment, by constructing and synthesizing an adenovirus (Adv) that overexpresses CDYL, and detecting its effect on cardiomyocyte hypertrophy after infecting cardiomyocytes with Ad-CDYL. The results showed that adenovirus significantly upregulated the protein expression of CDYL in cardiomyocytes. Overexpression of CDYL significantly reduced the area of ​​cardiomyocytes and the gene expression of myocardial hypertrophy markers Nppa, Nppb and Myh7, suggesting that CDYL may be associated with cardiomyocyte hypertrophy and heart failure.

[0031] After that, the present invention conducted animal experiments, constructed an adeno-associated virus (AAV) carrying a cardiac troponin T (cTnT) promoter (targeting myocardial cells) overexpressing CDYL, injected and delivered the virus 2 weeks before TAC and 1 week after TAC (after injury occurred), and evaluated the effect of CDYL on heart failure by echocardiography, pathological staining, marker detection, etc. 4 weeks after TAC. The present invention found that whether the virus was injected before or after model construction (after injury occurred), overexpression of CDYL by adeno-associated virus significantly improved cardiac contractile function and reduced myocardial hypertrophy, myocardial fibrosis and heart failure caused by pressure overload. The above study further confirmed that CDYL can be used as a target for the preparation of heart failure drugs.

[0032] The specific implementation modes of the present invention will be further explained below through examples, but it is not intended to limit the protection scope of the present invention to the scope described in the examples.

[0033] Example 1 Screening for important crotonyl-CoA metabolic enzymes associated with heart failure

[0034] The public database (GSE116250) was used to analyze the expression of genes that directly regulate crotonyl-CoA metabolic enzymes in heart failure, mainly including acyl-CoA synthetaseshort-chain family member2 (ACSS2), short-chain acyl-coenzyme A dehydrogenase (ACADS), acyl-CoA oxidase 1 (ACOX1, ACOX3), glutaryl-CoA dehydrogenase (GCDH) and crotonyl-CoA hydratase CDYL. Figure 1 As shown in Figure A, the results showed that CDYL and ACADS were significantly changed in heart failure. In order to observe the potential role of these enzymes in heart failure, we applied the receiver operating characteristic (ROC) curve to analyze the predictive ability of these enzymes in distinguishing between the control group and heart failure patients. The results are shown in Figure 2. Figure 1 As shown in Figure B, the results show that CDYL exhibits the highest efficiency in predicting heart failure. Therefore, in subsequent experiments, we focus on the role of CDYL in heart failure.

[0035] Next, the present invention constructed heart failure mouse models by TAC technique and AngⅡ, respectively, and detected the protein expression of CDYL in the two models.

[0036] The specific steps are as follows:

[0037] (1) The specific implementation method of aortic arch constriction in mice is as follows: SPF-grade healthy C57BL / 6 mice (male, 6-8 weeks, 20-22g) were included and randomly divided into a sham operation (Sham) group and a TAC group. The mice were anesthetized by isoflurane inhalation before surgery. The mice were fixed in a supine position, the chest hair of the mice was removed to expose the thorax, the mice were intubated, and the mice were connected to a small animal ventilator to maintain the breathing of the mice. The muscles were bluntly separated and the chest cavity was opened, the thymus was separated, and the aortic arch and the first, second, and third branches were exposed. A 5-0 silk thread was passed through the blood vessels between the first and second branches, and a 27G needle was used to ligate the aortic arch with silk thread, and then the needle was removed. After the thorax was opened, only the blood vessels were exposed and the thread was passed but not ligated. The chest cavity was closed and the muscle layer and skin were sutured, and the surgical wound was disinfected with iodine. The vital signs of the mice were closely observed after surgery, and they were fed routinely until the end of the experiment.

[0038] (2) Construction of Ang II-induced heart failure mouse model: SPF-grade healthy C57BL / 6 mice (male, 8 weeks, 20-22 g) were enrolled and randomly divided into a control group and an Ang II group. Angiotensin II (1.3 mg / kg / day) was subcutaneously injected into the mice using an Alzet 2004 osmotic pump. The experiment ended after four weeks of routine feeding.

[0039] (3) Western blot detection of CDYL protein expression in mouse heart failure model: Collect cell extract protein, refer to the instructions of the Bio-Tech BCA protein concentration kit (P0012) to quantify the protein, add loading buffer to the extracted protein, heat at 95°C for 10 min to denature the protein. Then perform SDS-PAGE electrophoresis, transfer, blocking, and primary and secondary antibody incubation. Finally, develop the PVDF membrane and obtain images, which are analyzed using Image J. The results are shown in Figure 2. Figure 1 C and Figure 1 As shown in D, the results showed that the protein expression of CDYL was significantly downregulated in the myocardium of mice with heart failure induced by TAC and AngⅡ.

[0040] Example 2 In vitro experiments to verify the function of CDYL

[0041] Adenovirus (Adv) overexpressing CDYL was constructed. The effect of CDYL on cardiomyocyte hypertrophy was studied by infecting neonatal rat cardiomyocytes (NRCMs) with Adv. The recombinant adenovirus overexpressing CDYL used in the present invention was commissioned to be synthesized by Hanheng Biotechnology (Shanghai) Co., Ltd. The pAdEasy-EF1-MCS-3flag-CMV-EGFP vector map is shown in Figure 2 The overexpression target sequence is shown in SEQ ID NO: 1.

[0042] The specific steps are as follows:

[0043] (1) Isolation and culture of cardiomyocytes: Cardiomyocytes were isolated from SD rats (0-1 days old) by using the differential adhesion method. The heart was first removed and placed in a culture dish with iced PBS. The remaining blood in the heart was squeezed out. After washing with PBS twice, 0.25% pancreatin was added and the heart was cut into 1 mm pieces. 3 Tissue blocks of about 100 μm in diameter. Place the tissue fragments in a 50 mL centrifuge tube, add 0.25% trypsin and place it in a 4°C shaker for digestion for 3 hours. Then, terminate the digestion with the upper enzyme digestion solution containing complete culture medium, and continue digesting the tissue clumps in the tube with type II collagenase digestion solution (1.5 mg / mL) prepared with L15 culture medium at 37°C for 30 minutes each time until the tissue fragments are no longer visible. Collect the supernatant containing cell digestion solution to terminate the digestion. Filter all cell suspensions with a 70 μm filter, centrifuge at 400g for 5 minutes, discard the supernatant, collect and resuspend the cells. Culture the cells in a 37°C, 5% CO2 incubator. After 1 hour, the cells that are not attached to the wall are cardiomyocytes, and the cardiomyocytes are planted on the culture plate for continued culture.

[0044] (2) Adv transfection of cardiomyocytes: On the first day, cells were passaged, and the cell confluence was about 50% when virus infection was performed on the second day. On the second day, the 1 / 2 small volume infection method was used, that is, when virus infection was performed, 1 / 2 volume of fresh culture medium was first added, and then the volume was replenished to the culture volume 4 hours after adding adenovirus infection. 24 hours after Adv infection, the cardiomyocytes were starved and then stimulated with crotonate. The cells were randomly divided into the following groups: ①Ad-Control (Ad-Ctrl) group: transfected with negative control virus; ②Ad-Control+Crotonate (Ad-Ctrl+Crotonate) group: transfected with negative control virus for 24 hours and then stimulated with Crotonate for 24 hours to observe the effect of Crotonate on the phenotype of cardiomyocytes; ③Ad-CDYL (Ad-CDYL) group: transfected with adenovirus carrying overexpressed CDYL sequence to illustrate whether the transfected target sequence affects the physiological condition of the cells; ④Ad-CDYL+Crotonate (Ad-CDYL+Crotonate) group: transfected with adenovirus carrying overexpressed CDYL sequence for 24 hours and then stimulated with Crotonate for 24 hours to illustrate the effect of the target sequence on the pathological phenotype induced by Crotonate.

[0045] (3) Detection of CDYL overexpression efficiency: The specific operation steps of Western blot were carried out according to the method mentioned in Example 1. The results are shown in Figure 3 As shown in A, the results show that the recombinant adenovirus obviously overexpressed the protein expression of CDYL. It can be seen that the recombinant adenovirus constructed by the present invention can achieve overexpression of CDYL in cardiomyocytes.

[0046] (3) Immunofluorescence staining: After the neonatal mouse cardiacfibroblasts (NRCMs) were treated accordingly, α-actinin immunofluorescence staining was performed according to the following steps to evaluate the effect of overexpression of CDYL on the area of ​​cardiomyocytes. The specific operation is as follows: discard the cell culture medium, gently rinse the cells twice with PBS buffer, add 4% paraformaldehyde to fix the cells, and fix them at room temperature for 15 minutes. Rinse with PBS on a shaker at low speed for 3 times, 5 minutes each time. Permeabilize the cells with 0.5% Triton X-100 cell permeabilization solution at room temperature for 10 minutes. Rinse with PBS on a shaker at low speed for 3 times, 5 minutes each time. Block the cells with 0.1% BSA blocking solution at room temperature for 30 minutes. After blocking, start incubation with primary antibody, add primary antibody diluted with antibody diluent (α-actinin ratio is 1:200), and incubate at 4°C overnight. The next day, rinse with PBS buffer 3 times and incubate with secondary antibody, incubate at room temperature for 2 hours. Rinse with PBS buffer 3 times, 5 minutes each time. DAPI stain was added to counterstain the cell nucleus and incubated at room temperature for 10 min. Image acquisition: The images were observed and acquired using a confocal microscope and analyzed using Image J. Figure 3 As shown in B, the results show that the cardiomyocyte area in the Ad-Ctrl+Crotonate group was significantly increased compared with the Ad-Ctrl group, while the Ad-CDYL+Crotonate group significantly reduced the increase in cell area induced by Crotonate, indicating that overexpression of CDYL can significantly reduce Crotonate-induced cardiomyocyte hypertrophy.

[0047] (4) Detection of the expression of cardiomyocyte hypertrophy marker genes: RNA was extracted according to the instructions of the kit (Accurate Biotechnology, AG21024), and then reverse transcription reaction and RT-qPCR were performed to detect the expression of related genes. The reverse transcription reaction system is as follows: 5×Reverse Transcripition buffer (4μL), Primer Mix (1μL), RT Enzyme Mix (1μL), RNA and RNAase free Water (14μL). The PCR amplification reaction system consists of the following components: SYBR Green Real time PCR Master Mix (10μL), upstream primer (10μM, 1μL); downstream primer (10μM, 1μL), cDNA and RNAase free Water (8μL); PCR reaction procedure is: pre-denaturation (95℃, 2min); amplification reaction (95℃, 10s; 59℃, 10s; 72℃, 15s), 40 cycles; melting curve analysis (65-95℃). The results showed that compared with the control group, the expression of genes such as Nppa and Nppb in the CDYL overexpression group was significantly reduced ( Figure 3 C). It shows that overexpression of CDYL significantly reduced the expression of heart failure marker genes. Rat Nppa upstream primer sequence: GAAGATGCCGGTAGAAGATGAG (SEQ ID NO: 2), rat Nppa downstream primer sequence: AGAGCCCTCAGTTTGCTTTTC (SEQ ID NO: 3); rat Nppb upstream primer sequence: GGTGCTGCCCCAGATGATT (SEQ ID NO: 4), rat Nppb downstream primer sequence: CTGGAGACTGGCTAGGACTTC (SEQ ID NO: 5); rat Gapdh upstream primer sequence: TGACAACTCCCTCAAGATTGTCA (SEQ ID NO: 6); rat Gapdh downstream primer sequence: GGCATGGACTGTGGTCATGA (SEQ ID NO: 7).

[0048] Example 3 In vivo experiments in mice to verify the function of CDYL

[0049] An adeno-associated virus carrying the cTnT promoter targeting myocardial cells to overexpress CDYL was constructed and commissioned to be synthesized by Hanheng Biotechnology (Shanghai) Co., Ltd. The pHBAAV-TNT-3flag-P2A-EGFP vector map is as follows: Figure 4 The overexpression target sequence is shown in SEQ: NO: 1.

[0050] A mouse model of heart failure caused by pressure overload was established. The virus was injected 2 weeks before and 1 week after TAC. The effect of CDYL on heart failure was evaluated 4 weeks after TAC using echocardiography, pathological staining, and detection of gene markers. Figure 5 A and 6A).

[0051] (1) The specific operation of mouse aortic arch constriction was carried out according to the method mentioned in Example 1.

[0052] (2) Detection of CDYL overexpression efficiency in vivo: Mouse hearts were taken and the overexpression efficiency of CDYL in myocardial tissue was detected according to the western blot operation in Example 2. The results showed that Figure 5 As shown in A.

[0053] (3) Mouse cardiac function assessment: Before ultrasound examination, mice were anesthetized by inhalation of isoflurane. The anesthetized mice were fixed in a supine position on the monitoring table. The chest hair of the mice was removed. The heart rate of the mice was maintained at 400-500 beats / min during the ultrasound examination. The 3100 small animal high-frequency ultrasound imaging system was used, and the MX400 probe (30MHz) was selected. After continuous observation of several cardiac cycles in the long-axis section and short-axis section, echocardiographic images were collected. Vevo LAB 5.5.1 software was used to analyze the images and calculate EF and FS to evaluate the cardiac function of mice. Figure 5 As shown in B, the results show that overexpression of CDYL in animals significantly upregulated EF and FS values, indicating that CDYL can significantly improve the left ventricular contractile function caused by TAC. Figure 6 As shown in Figure B, in the established myocardial injury model, overexpression of CDYL also significantly upregulated EF and FS values. The above results indicate that CDYL can also play a role in improving left ventricular systolic function in the established myocardial injury model.

[0054] (4) Pathological staining: ① After fixing the heart tissue for 24 hours, perform routine dehydration, transparency, paraffin embedding, sectioning, and hematoxylin-eosin (H&E) staining. After staining, seal the slides and scan the slides. ② Dewax the tissue sections at room temperature, rinse with distilled water, perform antigen repair with antigen repair solution, add FITC-Wheat Germ Agglutinin (FITC-WGA), incubate at room temperature in a humidified box for 1 hour, stain the nucleus with DAPI, and seal the slides. Observe and scan under a microscope. Then use Image pro plus software to analyze the cross-sectional area of ​​the myocardium. ③ The tissue sections were routinely dewaxed to water, stained with the prepared Weigert iron hematoxylin stain, differentiated with acidic ethanol differentiation solution, blued with Masson bluing solution, and stained with Ponceau fuchsin staining solution. Washing with water was required between each staining. After Ponceau fuchsin staining, the sections were washed with weak acid working solution (the ratio of weak acid working solution was distilled water: weak acid solution = 2:1), and then washed with phosphomolybdic acid solution. After that, the sections were directly placed in aniline blue staining solution for staining. After washing with the prepared weak acid working solution, the sections were quickly dehydrated with 95% ethanol, and then dehydrated with anhydrous ethanol for 3 times. Finally, the sections were transparentized with xylene for 3 times and sealed with neutral gum. After staining, the sections were scanned. After obtaining the scanned images, the myocardial collagen deposition was analyzed using Image J software. The results are shown in Figure 5 C and Figure 5 As shown in D, the results show that overexpression of CDYL in animals significantly reduced myocardial cross-sectional area and myocardial fibrosis area. Figure 6 C and Figure 6 In the established myocardial injury model shown in D, overexpression of CDYL also produced the same effect. This result shows that CDYL can significantly improve myocardial hypertrophy, myocardial fibrosis and heart failure caused by TAC.

[0055] (5) Detection of heart failure marker genes: Myocardial tissue was collected to extract total RNA, and the gene expression of heart failure markers was detected according to the operation mentioned in Example 2, reverse transcription reaction and RT-qPCR. The primers of mouse marker genes used are as follows: Nppa upstream primer sequence: TCTTCCTCGTCTTGGCCTTT (SEQ ID NO: 8), Nppa downstream primer sequence: CCAGGTGGTCTAGCAGGTTC (SEQ ID NO: 9); Nppb upstream primer sequence: TGGGAGGTCACTCCTATCCT (SEQ ID NO: 10), Nppb downstream primer sequence: GGCCATTTCCTCCGACTTT (SEQ ID NO: 11); Myh7 upstream primer sequence: CGGACCTTGGAAGACCAGAT (SEQ ID NO: 12); Myh7 downstream primer sequence: GACAGCTCCCATTCTCTGT (SEQ ID NO: 13); Fn upstream primer sequence: TAGGATTGGAGACACGTGGA (SEQ ID NO: 14), Fn downstream primer sequence: TGCGGTTGGTAAATAGCTGT (SEQ ID NO: 15); Ctgf upstream primer sequence: GGACACCTAAAATCGCCAAGC (SEQ ID NO: 16); ID NO: 16), Ctgf downstream primer sequence: ACTTAGCCCTGTATGTCTTCACA (SEQ ID NO: 17); Gapdh upstream primer sequence: AGGTCGGTGTGAACGGATTTG (SEQ ID NO: 18) Gapdh downstream primer sequence: TGTAGACCATGTAGTTGAGGTCA (SEQ ID NO: 19). The results are as follows Figure 5 As shown in E, the results show that overexpression of CDYL in animals significantly reduced the gene expression of myocardial hypertrophy markers Nppa, Nppb and Myh7, and also significantly reduced the gene expression of myocardial fibrosis markers Col1a1, Fn1 and Ctgf. Figure 6 In the results shown in E, in the established TAC model, overexpression of CDYL also significantly reduced the gene expression of myocardial hypertrophy markers Nppa, Nppb and Myh7, as well as myocardial fibrosis markers Col1a1, Fn1 and Ctgf. This result shows that overexpression of CDYL can significantly reduce the expression of genes related to heart failure.

[0056] From the above experimental results, it can be seen that CDYL is an important target for the development of drugs for the treatment of heart failure. Overexpression of CDYL can significantly improve ventricular contractile function, significantly improve myocardial hypertrophy, myocardial fibrosis and heart failure caused by TAC, and can also significantly reduce the expression of genes related to heart failure, thereby playing a role in the prevention and treatment of heart failure, which is of great significance.

Claims

1. A recombinant vector expressing a chromatin domain Y-like protein CDYL, characterized in that: The recombinant vector comprises a gene encoding a chromatin domain Y-like protein CDYL.

2. The recombinant vector expressing chromatin domain Y-like protein CDYL according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the chromatin domain Y-like protein CDYL is shown in SEQ ID NO:

1.

3. The recombinant vector expressing chromatin domain Y-like protein CDYL according to claim 1, characterized in that: The recombinant vector is a viral vector.

4. The recombinant vector expressing chromatin domain Y-like protein CDYL according to claim 3, characterized in that: The viral vector is an adenoviral vector or an adeno-associated viral vector.

5. The recombinant vector expressing chromatin domain Y-like protein CDYL according to claim 4, characterized in that: The construction sequence of the adenovirus vector is pAdEasy-EF1-MCS-3flag-CMV-EGFP.

6. The recombinant vector expressing chromatin domain Y-like protein CDYL according to claim 4, characterized in that: The construction sequence of the adeno-associated virus vector is pHBAAV-TNT-3flag-P2A-EGFP.

7. A host cell comprising the recombinant vector expressing the chromatin domain Y-like protein CDYL according to any one of claims 1 to 6.

8. Use of the recombinant vector expressing the chromatin domain Y-like protein CDYL according to any one of claims 1 to 6 and the host cell according to claim 7 in the preparation of a drug for preventing or treating heart failure.

9. The use according to claim 8, characterized in that: The heart failure is heart failure caused by pressure overload.

10. The use according to claim 8, characterized in that: The heart failure includes left ventricular systolic dysfunction, myocardial hypertrophy or myocardial fibrosis.

Images