Digital PCR primer probe combination for detecting MET gene amplification and application thereof

Abstract

The invention provides a digital PCR primer probe combination for detecting MET gene amplification and application thereof. The primer probe combination comprises upstream and downstream primers for amplifying MET genes and a probe for specifically detecting the MET genes, the upstream primer is as shown in SEQ ID NO. 1; 1, and the downstream primer comprises SEQ ID NO. 2; and the probe is shown as SEQ ID NO. 3. According to the present invention, the MET gene copy number detection is performed by using the micro-droplet type digital PCR technology and using the DNA extracted from the tissue and the plasma as the operation object, and the detection method has advantages of short detection period, less reaction number, simple operation and high detection result sensitivity.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, and specifically relates to a digital PCR primer-probe combination for detecting MET gene amplification and its application. Background Art

[0002] Non-small cell lung cancer (NSCLC) is a major type of lung cancer, accounting for approximately 80% of lung cancer cases and one of the most common and fatal tumors worldwide. NSCLC refers to lung cancer that originates from alveolar epithelial cells, bronchial epithelial cells, or other lung tissue cells. NSCLC includes subtypes such as squamous cell carcinoma, adenocarcinoma, and large cell carcinoma, which differ in cell morphology, growth rate, and sensitivity to treatment. Although NSCLC accounts for the majority of lung cancers, approximately 75% of patients are diagnosed in the advanced stage, with a very low 5-year survival rate. Treatment options include surgery, chemoradiotherapy, targeted therapy, and immunotherapy. In short, non-small cell lung cancer is a complex disease involving multiple treatment methods and individual differences. With the advancement of medical research, more and more treatment options for NSCLC are available, and treatment effects are constantly improving.

[0003] The MET gene, also known as c-MET, is a proto-oncogene located on the long arm of human chromosome 7, at 7q21-31. Its DNA is approximately 125 kb long and contains 21 exons and 20 introns. The MET gene is associated with the development of various tumors and is a key driver gene in non-small cell lung cancer (NSCLC).

[0004] MET gene amplification is a key molecular alteration occurring in NSCLC. It refers to an increase in the MET gene copy number (GCN), primarily occurring in two forms: focal amplification and polyploidy. Focal amplification refers to a specific increase in the copy number of the MET gene (and sometimes surrounding genomic regions) within a specific region, while the copy number of other genes on the chromosome remains unchanged. Polyploidy involves larger-scale chromosomal changes, namely, an increase in the copy number of an entire chromosome or a larger portion thereof. In this case, not only the MET gene but also other genes on the chromosome may experience a copy number increase. Both forms of MET gene amplification can lead to increased MET messenger RNA (mRNA) levels, which in turn increases MET protein expression, ultimately leading to aberrant activation of the MET signaling pathway. This aberrant activation of the signaling pathway is associated with tumor proliferation, invasion, and drug resistance. Therefore, detection and treatment of MET gene amplification are of great clinical significance in the treatment of NSCLC.

[0005] MET amplification has been found in a variety of solid tumors and can be used as one of the primary tumor driver gene mutations. Among them, the incidence of primary MET amplification in NSCLC is 1-5%, which is associated with poor prognosis. On the other hand, MET amplification is more common after targeted therapy in NSCLC patients who are positive for other driver genes (such as EGFR, ALK), and is one of the important mechanisms of resistance to EGFR-TKI and ALK-TKI. When the EGFR (or ALK) signaling pathway is inhibited by EGFR-TKI (or ALK-TKI), as a bypass signaling pathway, secondary MET amplification will bypass EGFR (or ALK) and activate downstream pathways, leading to drug resistance. In addition, the level of MET amplification is positively correlated with the efficacy of MET inhibitors, that is, the higher the level of MET amplification, the better the effect of using MET inhibitors.

[0006] With the launch of MET targeted drugs in China, the accessibility of MET inhibitors has been greatly improved. NSCLC patients who are in the late stage and are first-line treated or have developed resistance to targeted drugs such as EGFR-TKI or ALK-TKI should undergo relevant testing as early as possible to allow more patients with high-fold MET amplification to benefit from targeted therapy.

[0007] Currently, MET gene amplification detection can be achieved through four methods: fluorescence in situ hybridization (FISH), immunohistochemistry (IHC), next-generation sequencing (NGS), and droplet digital PCR (ddPCR). Each method has its advantages and disadvantages. ① Fluorescence in situ hybridization (FISH) technology is the gold standard for detecting MET gene amplification. It uses fluorescently labeled probes to specifically bind to the MET gene sequence in cells, directly displaying the physical location and copy number of the gene in the cell nucleus. By calculating the MET gene copy number (GCN) in tumor cells and the ratio of the MET fluorescence signal to the chromosome 7 centromere (MET / CEP7), FISH can determine whether there is gene amplification. The advantage of FISH is its ability to intuitively visualize gene copy number, and the results are easy to interpret. The disadvantage is that there is a lack of global unified standards for interpretation criteria and reliance on manual interpretation, which increases the variability of the results. ② Immunohistochemistry (IHC) utilizes the principle of specific binding between antigens and antibodies. Through chemical reactions, color development of the antibody-labeled chromogen (fluorescein, enzymes, metal ions, isotopes, etc.) is performed to identify antigens (peptides and proteins) within tissue cells, allowing for their localization, qualitative analysis, and relative quantification. A drawback is that the clone numbers and staining properties of MET antibodies currently used for testing vary domestically and internationally, and there is no unified interpretation standard. More clinical research is needed to confirm the clinical value of MET protein overexpression and further clarify the interpretation criteria and benefit threshold. ③ Next-generation sequencing (NGS) technology enables analysis of sequence variations in multiple genes through high-throughput sequencing. In detecting MET amplification, NGS uses information such as sequencing depth and site-specific mutation frequencies to calculate copy number variations in the MET gene and uses algorithms to distinguish between focal amplification and polysomy. A drawback is that differences in design and data analysis strategies exist between different laboratories and commercial assays, leading to inconsistent test results. ④ddPCR is an absolutely quantitative nucleic acid molecular detection technology that directly calculates the copy number of the target gene through amplification and fluorescence signal analysis of the target gene in a single droplet. The advantages of ddPCR are that it provides absolute quantitative gene copy number detection without the need for a standard curve or reference sample, and has high accuracy when detecting low-abundance variants. Its high sensitivity and specificity make it suitable for tracking minimal residual disease. It is simple to operate and can be easily automated, improving detection efficiency and reducing operational errors. However, there is currently no ddPCR method that can effectively detect MET gene amplification.

[0008] Therefore, providing a method for MET gene amplification detection based on droplet digital PCR (ddPCR) technology has important application value. Summary of the Invention

[0009] To address the shortcomings of the existing technology, the present invention aims to provide a digital PCR primer-probe combination for detecting MET gene amplification and its application. This invention utilizes droplet digital PCR (ddPCR) technology to detect MET gene copy number using DNA extracted from tissues and plasma. This method overcomes the shortcomings of existing MET gene amplification detection techniques. The method of the present invention offers a short detection cycle, a small number of reactions, simple operation, and higher sensitivity.

[0010] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0011] In a first aspect, the present invention provides a digital PCR primer-probe combination for detecting MET gene amplification, wherein the primer-probe combination comprises: upstream and downstream primers for amplifying the MET gene, and a probe for specifically detecting the MET gene;

[0012] The upstream primer includes that shown in SEQ ID NO.1; the downstream primer includes that shown in SEQ ID NO.2; and the probe includes that shown in SEQ ID NO.3.

[0013] The detection range of the present invention is the full amplification of the MET gene, so the target is designed to cover the 2-3 exon regions of the MET gene.

[0014] The theoretical copy number of the primer probe screened by the present invention has a good linear relationship with the actual copy number, and the amplification efficiency is higher.

[0015] Preferably, the primer-probe combination further comprises: upstream and downstream primers for amplifying the REF gene, and a probe for specifically detecting the REF gene;

[0016] The upstream primer includes that shown in SEQ ID NO.4; the downstream primer includes that shown in SEQ ID NO.5; and the probe includes that shown in SEQ ID NO.6.

[0017] The REF gene is an internal reference gene. The internal reference gene of the present invention selects a fragment on the human housekeeping gene and undergoes a large number of verifications to ensure that the copy number is stable.

[0018] Preferably, the 5' end of the probe is modified with a fluorescent dye, and the 3' end of the probe is modified with a quencher.

[0019] Preferably, the fluorescent dye is selected from: FAM or VIC.

[0020] Preferably, the quencher is selected from: MGB or BHQ1.

[0021] In a second aspect, the present invention provides a digital PCR kit for detecting MET gene amplification, wherein the kit comprises the digital PCR primer-probe combination for detecting MET gene amplification described in the first aspect.

[0022] Preferably, the kit includes a premix and a quality control product.

[0023] Preferably, the premix comprises a buffer, a DNA polymerase and dNTPs.

[0024] Preferably, the quality control products include negative quality control and positive quality control.

[0025] Preferably, the negative control is a 1:1 plasmid of MET and internal reference; the sequence of the negative control includes that shown in SEQ ID NO.7.

[0026] Preferably, the positive quality control is a plasmid with a 2:1 ratio of MET and internal reference; the sequence of the positive quality control includes that shown in SEQ ID NO.8.

[0027] In a third aspect, the present invention provides a method for detecting MET gene amplification for the purpose of non-disease diagnosis and / or treatment, the method comprising: collecting and extracting a DNA sample, performing digital PCR amplification detection using the digital PCR primer-probe combination for detecting MET gene amplification described in the first aspect or the digital PCR kit for detecting MET gene amplification described in the second aspect, and obtaining a detection result.

[0028] Preferably, the digital PCR amplification procedure includes: pre-denaturation: 94-95°C, 9-10 min; denaturation: 94-95°C, 25-30 s; annealing and extension: 55-56°C, 1-1.5 min; instrument cooling: 4-12°C, 4-5 min.

[0029] Among them, 94-95℃ can be, for example, 94℃ or 95℃; 9-10min can be, for example, 9min or 10min; 25-30 seconds can be, for example, 25, 26, 27, 28, 29 or 30; 55-56℃ can be, for example, 55℃ or 56℃; 1-1.5min can be, for example, 1min or 1.5min; 4-12℃ can be, for example, 4℃, 5℃, 6℃, 7℃, 8℃, 9℃, 10℃, 11℃ or 12℃; 4-5min can be, for example, 4min or 5min.

[0030] Preferably, the judgment criteria of the test results include: demarcating the FAM and VIC areas based on the 2D scatter plot, with the concentrated fluorescence value of the negative droplets as the baseline; the positive threshold: FAM channel copy number / VIC channel copy number>1.10 is positive; the negative threshold: FAM channel copy number / VIC channel copy number≤1.10 is negative.

[0031] The digital PCR system and amplification method of the present invention can achieve absolute quantification of the MET gene and can also determine whether the sample has MET gene amplification based on the ratio of the target and internal reference copy numbers.

[0032] In a fourth aspect, the present invention provides the use of the digital PCR primer-probe combination for detecting MET gene amplification described in the first aspect or the digital PCR kit for detecting MET gene amplification described in the second aspect in MET gene detection for purposes other than disease diagnosis and / or treatment.

[0033] The numerical range described in the present invention includes not only the point values ​​listed above, but also any point values ​​between the above numerical ranges that are not listed. Due to space limitations and for the sake of simplicity, the present invention no longer exhaustively lists the specific point values ​​included in the range.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] (1) The present invention uses DNA as a template for PCR amplification, which is simple and convenient to operate. Compared with detection using RNA as a template, DNA is more stable and easier to operate in terms of extraction and storage.

[0036] (2) The method of the present invention has higher sensitivity and reduces false negative results. The minimum detectable copy number can reach 2.1, which exceeds that of most similar kits.

[0037] (3) The method of the present invention can achieve accurate quantification of MET amplification. It can provide the specific copy number of the MET gene and achieve absolute quantification.

[0038] (4) Both plasma DNA and tissue DNA samples can be tested using the method of the present invention, enabling the detection of a variety of sample types. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a detection flow chart.

[0040] Figure 2 This is a graph of repeatability test results.

[0041] Figure 3 This is a graph of the linear results of a low-ratio reference.

[0042] Figure 4 This is a graph of the linear results of a high-ratio reference product.

[0043] Figure 5 This is the linear plot of primer 2 combination.

[0044] Figure 6 This is the linear plot of primer 3 combination.

[0045] Figure 7This is the consistency result chart of ddPCR and NGS. DETAILED DESCRIPTION

[0046] The technical solution of the present invention is further described below by way of specific embodiments. It should be understood by those skilled in the art that the embodiments are merely to help understand the present invention and should not be regarded as specific limitations of the present invention.

[0047] If no specific techniques or conditions are specified in the examples, the experiments were carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0048] Example 1

[0049] This embodiment provides a digital PCR primer-probe combination for detecting MET gene amplification, which includes: upstream and downstream primers for amplifying MET gene, and a probe for specifically detecting MET gene; upstream and downstream primers for amplifying REF gene, and a probe for specifically detecting REF gene.

[0050] The upstream primer for amplifying the MET gene is shown in SEQ ID NO.1, the downstream primer for amplifying the MET gene is shown in SEQ ID NO.2, and the probe for detecting the MET gene is shown in SEQ ID NO.3.

[0051] The upstream primer for amplifying the REF gene is shown in SEQ ID NO.4, the downstream primer for amplifying the REF gene is shown in SEQ ID NO.5, and the probe for detecting the REF gene is shown in SEQ ID NO.6.

[0052] MET-F: CAGTGGTGGGGAGCACAATAACAG (SEQ ID NO. 1).

[0053] MET-R: AAGTTCCTTCCTGCTTCATGCAC (SEQ ID NO. 2).

[0054] MET-P: FAM-TCAGTTAGTGTCCCGAGAATGGTCA-BHQ1 (SEQ ID NO. 3).

[0055] REF-F: CCGCCGAGGTGTTGGTCT (SEQ ID NO. 4).

[0056] REF-R: CAGGAAAGTAGCTGAACCAGAT (SEQ ID NO. 5).

[0057] REF-P: VIC-AACTCGAAGGTTCTGGGGGTTGTT-BHQ1 (SEQ ID NO. 6).

[0058] Example 2

[0059] This embodiment provides a digital PCR kit for detecting MET gene amplification, which includes the digital PCR primer-probe combination for detecting MET gene amplification described in Example 1, a premix, and a quality control product.

[0060] The quality control products include negative quality control and positive quality control; the negative quality control is a plasmid of MET and internal reference in a 1:1 ratio; the positive quality control is a plasmid of MET and internal reference in a 2:1 ratio.

[0061] The sequence of the negative quality control is (SEQ ID NO.7):

[0062] GATATCCCTCTCTTACAGTACTTGGTGGAAAGAACCTCTCAACATTGTCAGTTTTCTATTTTGCTTTGCCAGTGGTGGGAGCACAATAACAGGTGTTGGGAAAAACCTGAATTCAGTTAGTGTCCCGAGAATGGTCATAAATGTGCATGAAGCAGGAAGGAACTTTAC AGTGGTAAGTCCTTTGAGCAATGGTGATATCGTCCCTGGAGGCTGATGCCCGCCGAGGTGTTGGTCTGATTCCTAGCGCGGGAAACTCGAAGGTTCTGGGGGTTGTTATCTGGTTCAGCTACTTTCCTGCAATGAGGGAACTGAGGCCTAACGAGGGCGAGGGATATC.

[0063] The sequence of the positive quality control is (SEQ ID NO.8):

[0064] .

[0065] Example 3

[0066] This embodiment provides a method for detecting MET gene amplification. Figure 1 As shown, Figure 1 To detect the flow chart, the method includes:

[0067] Collect and extract DNA samples: DNA samples were extracted using the FFPE sample DNA extraction kit (QIAGEN's QIAamp DNA FFPET issue Kit (56404) or the plasma DNA extraction kit (QIAGEN's QIAamp Circulating Nucleic Acid Kit (55114)).

[0068] Prepare PCR system: The PCR system was prepared as shown in Table 1.

[0069] Table 1

[0070]

[0071] Digital PCR amplification testing was performed using the following PCR instruments: the TD-1 digital PCR platform (including a sample preparation instrument and biochip analyzer) from Xinyi Manufacturing Technology (Beijing) Co., Ltd.; and the A300 PCR amplifier from Hangzhou Langji Scientific Instrument Co., Ltd. The PCR protocol is shown in Table 2.

[0072] Table 2

[0073]

[0074]

[0075] Interpretation of results:

[0076] Baseline determination: Based on the 2D scatter plot, appropriate FAM and VIC areas were delineated, and the fluorescence value of the negative droplet was used as the baseline.

[0077] Positive threshold: FAM channel copy number / VIC channel copy number>1.10 is positive.

[0078] Negative threshold: FAM channel copy number / VIC channel copy number ≤ 1.10 is considered negative.

[0079] Example 4

[0080] This example uses a digital PCR kit for detecting MET gene amplification for sample detection.

[0081] The detection steps were similar to those in Example 3. The sample was a MET amplification positive standard (40 copies, 5 ng / μL) mixed with a MET negative standard (2 copies, 5 ng / μL) at a ratio of 1:379. A 2.1 copy reference was prepared (based on preliminary exploration, 2.1 was determined to be the minimum detection limit), and 1 μL was taken for ddPCR amplification.

[0082] (1) Repeatability test results such as Figure 2 and as shown in Table 3; Figure 2 is a graph of the repeatability test results, and Table 3 is a statistical table of the repeatability test results.

[0083] Table 3

[0084]

[0085]

[0086] As shown in Table 3, the 2.1 copy reference product was tested 32 times, and all the results were positive; the detection sensitivity of the kit can reach 2.1 copies.

[0087] (2) The linearity test results of low-ratio reference products are as follows Figure 3 and as shown in Table 4; Figure 3Table 4 is a linear test result table for the low-proportion reference product.

[0088] Table 4

[0089] Reference Copy number (FAM) Copy number (VIC) FAM / VIC actual value FAM / VIC theoretical value 1-1 1308 1263 1.04 1 1-2 1179 1120 1.05 1 1.1-1 1443 1097 1.32 1.1 1.1-2 1418 1104 1.28 1.1 1.1-3 1468 1160 1.27 1.1 1.15-1 1544 1109 1.39 1.15 1.15-2 1462 1089 1.34 1.15 1.15-3 1436 1100 1.31 1.15 1.25-1 1664 1123 1.48 1.25 1.25-2 1815 1207 1.50 1.25 1.5-1 2015 1127 1.79 1.5 1.5-2 2017 1098 1.84 1.5 2-1 2975 1129 2.64 2 2-2 2812 1048 2.68 2

[0090] From Table 4 above, it can be seen that the theoretical values ​​and actual values ​​have a good linear relationship when testing different low-ratio reference products.

[0091] (3) The linearity test results of high-ratio reference products are as follows Figure 4 and as shown in Table 5; Figure 4 Table 5 is a linear test result table of high-proportion reference products.

[0092] Table 5

[0093] Reference Copy number (FAM) Copy number (VIC) FAM / VIC actual value FAM / VIC theoretical value 1-1 1566.5 1556.4 1.01 1 1-2 1126.5 1108.1 1.02 1 1-3 1253.7 1251 1.00 1 2-1 2397.1 907.7 2.64 2 2-2 2611.4 1004 2.60 2 2-3 2503 1001.6 2.50 2 4-1 4848.3 1009.7 4.80 4 4-2 4937.3 1027 4.81 4 4-3 4993.9 1048.8 4.76 4 8-1 12975.9 1435.9 9.04 8 8-2 11100.1 1229.6 9.03 8 8-3 11454 1253.6 9.14 8 16-1 23850.2 1538 15.51 16 16-2 22073.4 1459.6 15.12 16 16-3 22961.7 1443.6 15.91 16

[0094] From Table 5 above, it can be seen that the theoretical values ​​and actual values ​​have a good linear relationship when testing different high-ratio reference products.

[0095] Comparative Example 1

[0096] In this comparative example, different upstream and downstream primers and probes for amplifying the MET gene and the internal reference gene were designed, and the primers and probes in the comparative example and Example 1 were compared to evaluate the detection effects of different primers and probes.

[0097] MET Primer 2:

[0098] Upstream primer: AGTTGGAAATAAGAGCTGTGAGAA (SEQ ID NO. 9)

[0099] Downstream primer: GTTCAATTTCAGCAGGTCATTGG (SEQ ID NO.10)

[0100] Probe: TTCTGAAGCCGTTTTATGCACGGT (SEQ ID NO. 11).

[0101] MET Primer 3:

[0102] Upstream primer: CAAGCAATTTCTTCAACCGTCCT (SEQ ID NO. 12).

[0103] Downstream primer: ATTGAGACAACACCAGCAATCAA (SEQ ID NO. 13).

[0104] Probe: AGTTCAACCAGATCAGAATTTCACAGGA (SEQ ID NO. 14).

[0105] REF Primer 2:

[0106] Upstream primer: CAGGGCAAAAGCTAAATGAGAAA (SEQ ID NO. 15).

[0107] Downstream primer: TAGCAACAAGGGATGTTTCTTGA (SEQ ID NO. 16).

[0108] Probe: TGGTAAGTTTGGAGCCAACTCGGA (SEQ ID NO. 17).

[0109] REF Primer 3:

[0110] Upstream primer: GTGAGCATCAGCAAATTCTTCG (SEQ ID NO. 18).

[0111] Downstream primer: GCACTCACATGGGGTAATTGAG (SEQ ID NO. 19).

[0112] Probe: ATGATCCTATGTTGCTGGAACTTGC (SEQ ID NO. 20).

[0113] The results of the investigation are as follows: Figure 5 This is the linear plot of primer 2 combination. Figure 6 This is the linear graph of primer 3. From the results, it can be seen that the primer probe in Example 1 has a better detection effect.

[0114] Example 5

[0115] In this example, a digital PCR kit for detecting MET gene amplification and an NGS method were used to test clinical samples to examine the consistency of the test results.

[0116] The NGS method was performed with reference to the patent “A method for preparing SNP backbone probes based on probe hybridization capture high-throughput sequencing technology and its application” (Publication No.: CN117025725A).

[0117] The test results of clinical samples are shown in Table 6 and Figure 7 As shown, Figure 7 This is the consistency chart between ddPCR and NGS results. Numbers starting with "P" indicate plasma samples, and numbers starting with "T" indicate tissue samples. The samples were obtained from hospitals.

[0118] Table 6

[0119]

[0120]

[0121]

[0122] As can be seen from Table 6, the clinical sample test results are highly consistent with the NGS results, and the method of the present invention has high accuracy.

[0123] In summary, the present invention provides a method for detecting MET gene amplification using droplet digital PCR (ddPCR) technology. The MET gene copy number is detected using DNA extracted from tissues and plasma. The detection cycle is short, the number of reactions is small, the operation is simple, and the detection results are more sensitive.

[0124] The applicant declares that the above is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the scope of protection and disclosure of the present invention.

Claims

1. A digital PCR primer-probe combination for detecting MET gene amplification, characterized in that: The primer-probe combination includes: upstream and downstream primers for amplifying the MET gene, and a probe for specifically detecting the MET gene; The upstream primer includes that shown in SEQ ID NO.1; the downstream primer includes that shown in SEQ ID NO.2; and the probe includes that shown in SEQ ID NO.

3.

2. The digital PCR primer-probe combination for detecting MET gene amplification according to claim 1, characterized in that: The primer-probe combination also includes: upstream and downstream primers for amplifying the REF gene, and a probe for specifically detecting the REF gene; The upstream primer includes that shown in SEQ ID NO.4; the downstream primer includes that shown in SEQ ID NO.5; and the probe includes that shown in SEQ ID NO.

6.

3. The digital PCR primer-probe combination for detecting MET gene amplification according to claim 1 or 2, characterized in that: The 5' end of the probe is modified with a fluorescent dye, and the 3' end of the probe is modified with a quencher; Preferably, the fluorescent dye is selected from: FAM or VIC; Preferably, the quencher is selected from: MGB or BHQ1.

4. A digital PCR kit for detecting MET gene amplification, characterized in that: The kit comprises the digital PCR primer-probe combination for detecting MET gene amplification according to any one of claims 1 to 3.

5. The digital PCR kit for detecting MET gene amplification according to claim 4, characterized in that: The kit includes a premix and a quality control product; Preferably, the premix comprises a buffer, a DNA polymerase and dNTPs.

6. The digital PCR kit for detecting MET gene amplification according to claim 4 or 5, characterized in that: The quality control products include negative quality control and positive quality control; Preferably, the negative control is a plasmid with a ratio of MET to internal reference of 1:1; the sequence of the negative control includes that shown in SEQ ID NO.7; Preferably, the positive quality control is a plasmid with a ratio of MET to internal reference of 2:1; the sequence of the positive quality control includes that shown in SEQ ID NO.

8.

7. A method for detecting MET gene amplification for the purpose of non-disease diagnosis and / or treatment, characterized in that: The method comprises: collecting and extracting a DNA sample, performing digital PCR amplification detection using the digital PCR primer-probe combination for detecting MET gene amplification described in any one of claims 1-3 or the digital PCR kit for detecting MET gene amplification described in any one of claims 4-6, and obtaining a detection result.

8. The method for detecting MET gene amplification according to claim 7, characterized in that: The digital PCR amplification procedure includes: pre-denaturation: 94-95°C, 9-10 min; denaturation: 94-95°C, 25-30 seconds; annealing extension: 55-56°C, 1-1.5 min; instrument cooling: 4-12°C, 4-5 min.

9. The method for detecting MET gene amplification according to claim 7 or 8, characterized in that: The judgment criteria of the detection results include: demarcating the FAM and VIC areas according to the 2D scatter plot, taking the concentrated fluorescence value of the negative droplets as the baseline; positive threshold: FAM channel copy number / VIC channel copy number>1.10 is positive; negative threshold: FAM channel copy number / VIC channel copy number≤1.10 is negative.

10. Use of the digital PCR primer-probe combination for detecting MET gene amplification according to any one of claims 1 to 3 or the digital PCR kit for detecting MET gene amplification according to any one of claims 4 to 6 in detecting MET gene amplification for purposes other than disease diagnosis and / or treatment.

Images