Primer probe combination and kit for fungus PCR (Polymerase Chain Reaction) detection and application of primer probe combination and kit

Abstract

The invention relates to the technical field of in-vitro diagnosis, in particular to a primer probe combination for fungus PCR (polymerase chain reaction) detection. According to the invention, aiming at several detection targets of aspergillus, mucor, penicillium, blue marneffei and pneumocystis yarrowii, 18S rRNA, 5.8 S rRNA, 18S rRNA, ITS2 and a mitochondrial small subunit are respectively adopted as detection target regions for detection primer probe design, and different reaction systems are given for matching to complete automatic amplification. According to the primer probe combination and the kit for fungus PCR detection, the specificity for detecting different species of fungi is high, the detection system is stable, the detection limit is as low as 2 bacteria / mL, the joint detection design is beneficial to targeted coverage of fungal pathogens, and missing detection or mixed detection is effectively prevented.

Description

Technical Field

[0001] The present invention relates to the technical field of in vitro diagnosis, and in particular to a primer-probe combination, a kit and applications thereof for fungal PCR detection. Background Art

[0002] The main reasons for the increase in fungal infections worldwide include the increase in high-risk populations such as tuberculosis, chronic obstructive pulmonary disease, tumors and organ transplantation, and glucocorticoid treatment. The global situation of new and emerging pathogenic fungal infections and antifungal resistance is worrying.

[0003] Risk factors for invasive fungal diseases are also emerging, such as viral infections complicated by / secondary to invasive fungal infections, including invasive pulmonary aspergillosis and candidiasis, which deserve clinical attention.

[0004] Invasive pulmonary aspergillosis mainly occurs in hosts with severely impaired immune function. The growth of Aspergillus in lung tissue can cause tissue destruction, vascular involvement and even hematogenous dissemination. The susceptible populations for invasive pulmonary aspergillosis mainly include: patients with chronic granulomatous disease, prolonged agranulocytosis, hematopoietic stem cell transplantation and solid organ transplantation, patients with long-term and large-scale use of glucocorticoids, chronic obstructive pulmonary disease, liver failure, cirrhosis, etc. In recent years, the risk factors have changed. For example, patients with hematological tumors receiving treatment with small molecule kinase inhibitors, ICU patients recovering from bacterial sepsis, patients receiving antigen receptor T cell therapy due to cytokine storm, and patients with severe influenza or viral infection admitted to the ICU are new high-risk factors for invasive pulmonary aspergillosis.

[0005] Mucorosis in immunocompromised individuals is often caused by respiratory inhalation infection. Patients with agranulocytosis often present with pulmonary mucorosis, and patients with diabetes often present with rhinocerebral mucorosis. Patients with normal immune function often present with skin and soft tissue infections. Malignant tumors, solid organ transplantation, and hematopoietic stem cell transplantation are also important risk factors for mucorosis. Common pathogens of mucorosis are mainly Rhizopus, Mucor, and Rhizoctonia. The mortality rate of mucorosis is 40% to 80%. Early diagnosis and timely treatment are very important for improving the prognosis of patients.

[0006] In short, invasive fungal diseases are harmful and have a high mortality rate, which deserves attention. At the same time, the epidemiological characteristics of invasive fungal diseases have changed in recent years, and the risk factors have been constantly changing. Attention should be paid to monitoring different high-risk groups; accurate diagnosis is the prerequisite for obtaining accurate epidemiological data, and optimizing laboratory diagnostic methods for fungal infections is the key; the natural insensitivity or acquired resistance of pathogenic fungi to antifungal drugs has increased, bringing challenges to clinical practice; the establishment of a multi-center collaborative fungal disease monitoring system will lay the foundation for the epidemiology and drug resistance monitoring of fungal infections.

[0007] Pulmonary fungal infection is a bronchopulmonary disease caused by fungal infection, including primary and secondary pulmonary fungal infection. Fungal spores are inhaled into the human lungs and cause disease, which is called primary pulmonary fungal infection; while fungal infection in other parts of the body is transmitted to the lungs through lymph or blood and causes disease, which is called secondary pulmonary fungal infection.

[0008] Invasive fungal infections are often seen in the following manifestations: 1. Pneumonia or bronchitis is the most common, and it is difficult to distinguish it from general bacterial pneumonia. There may be respiratory symptoms such as fever, cough, coughing up white sticky sputum or purulent sputum, coughing up blood, chest tightness, and asthma. Dry and wet rales can be heard in the lungs, and there may be a small to moderate amount of pleural effusion. 2. Tuberculosis-like manifestations The clinical manifestations of histoplasmosis and dermatitis blastomycosis are sometimes similar to pulmonary tuberculosis, and there may be dry cough, hemoptysis, chest pain and other respiratory symptoms, as well as "tuberculosis poisoning symptoms" such as low fever in the afternoon and night sweats. 3. Lung abscess and empyema. It often has an acute onset, and there may be chills, high fever (mostly remittent fever), cough, mucopurulent sputum, sometimes with a distinct odor in the sputum, and hemoptysis is often blood in the sputum. 4. Tumor-like manifestations. Such as pulmonary cryptococcoma, histoplasmoma, coccidioidomycosis, etc., which are similar to peripheral lung cancer. Blastomycosis and Aspergillus infection can damage the ribs and vertebrae, similar to bone destruction caused by metastatic cancer. 5. Pulmonary embolism and pulmonary infarction. For example, angiotropic Mucor easily invades blood vessels, and pulmonary infection often leads to pulmonary embolism or even pulmonary infarction, similar to pulmonary thromboembolism. 6. Others. It can cause diffuse interstitial lung lesions or similar manifestations of sarcoidosis.

[0009] At present, invasive fungal infections are common in ICU patients and immunocompromised patients. For the detection of fungal infection samples such as sputum and bronchoalveolar lavage fluid in clinical practice, commonly used methods include pathogen culture, identification, and drug sensitivity, which are the "gold standard" for fungal detection. In addition, there are immunological detection methods, which use the detection of antigens in the blood to detect Aspergillus, Candida, Cryptococcus, etc. Immunological methods can only detect genera or orders, not specific species. Molecular biology methods are newly developed pathogen detection methods with high detection sensitivity and fast detection speed. They can be applied to the detection of almost all fungal species. However, due to the high detection cost and high technical requirements of professionals, they are still in the stage of improvement and development. In the future, they will also be one of the development trends of fungal pathogen detection.

[0010] At present, in the field of fungal nucleic acid detection, international manufacturers have registered commercial detection products in China. Common fungal detection manufacturers in the world mainly focus on Candida and Aspergillus detection, and the main method used is PCR fluorescent probe method. Common manufacturers include Qiagen in Germany and T2 in the United States. Domestic manufacturers have registered commercial products such as Dilan Biotechnology and Zhuocheng Huisheng. The detection targets are mainly typical strains such as Candida albicans and Aspergillus fumigatus, Aspergillus flavus and Aspergillus niger. There are currently no relevant detection reagents in China for the detection of other fungal species. There is an urgent need for the detection of fungal infections in clinical practice, especially the rapid diagnosis of infections in ICU patients.

[0011] For the molecular biological detection of fungi, invasive lung infections are still the main focus, mainly detecting Aspergillus, Candida, Cryptococcus, etc., while the detection of Penicillium, Mucor, and Pneumocystis is blank. Commonly used nucleic acid target regions for fungal detection include ITS, 18S rRNA, 28S rRNA, and mitochondrial nucleic acid regions. Considering that the conservatism of fungal nucleic acids is much higher than that of bacteria and viruses, when identifying fungal species, the specificity of the selected target region should be paid special attention to, and the cross-species interference should be fully verified. On July 3, 2020, the Chinese invention patent "Sequences, kits, methods and applications for rapid detection of Aspergillus fumigatus" disclosed a sequence for rapid detection of Aspergillus fumigatus, which includes an Aspergillus fumigatus-crRNA sequence and a corresponding RPA amplification primer sequence with a T7 promoter, which can easily, quickly, highly specifically, and sensitively detect Aspergillus fumigatus in the sample to be tested. The existing invention mainly performs targeted detection on a few common clinical Candida or Aspergillus species, and can be used for the detection of fungi in routine samples, but cannot cover the detection of other species, especially invasive fungal lung infections in ICU patients, which involve many species such as Aspergillus or Mucor, and need to be covered by the detection. Summary of the invention

[0012] In view of this, the present invention provides a primer probe combination, a kit and its application for fungal PCR detection. The amplification detection section of the primer probe of the present invention has good detection tolerance and specificity, and the reaction solution has stable performance and can be stored for a long time under non-freezing conditions.

[0013] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0014] The present invention provides a primer-probe combination for fungal PCR detection, including one or more of a primer-probe combination 1 for detecting Aspergillus, a primer-probe combination 2 for detecting Penicillium, a primer-probe combination 3 for detecting Blue-shaped fungi of Marneffei, a primer-probe combination 4 for detecting Mucorales, or a primer-probe combination 5 for detecting Pneumocystis jiroveci;

[0015] (I), the primer-probe combination 1 comprises a primer pair having a nucleotide sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 4, and a specific probe having a nucleotide sequence as shown in SEQ ID NO: 2;

[0016] The primer-probe combination 2 includes a primer pair having nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 4, and a specific probe having a nucleotide sequence as shown in SEQ ID NO: 3;

[0017] The primer-probe combination 3 includes a primer pair having nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 7, and a specific probe having a nucleotide sequence as shown in SEQ ID NO: 6;

[0018] The primer-probe combination 4 includes a primer pair having nucleotide sequences as shown in SEQ ID NO: 11 and SEQ ID NO: 13, and a specific probe having a nucleotide sequence as shown in SEQ ID NO: 12;

[0019] The primer-probe combination 5 comprises a primer pair having a nucleotide sequence as shown in SEQ ID NO: 14 and SEQ ID NO: 16, and a specific probe having a nucleotide sequence as shown in SEQ ID NO: 15; or

[0020] (II) a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I) but is different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0021] (III) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar function as the nucleotide sequence shown in (I) or (II); or

[0022] (IV) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of (I), (II) or (III).

[0023] In some specific embodiments of the present invention, the primer-probe combination further comprises a primer-probe combination for detecting an internal standard in a human sample.

[0024] In some specific embodiments of the present invention, the human sample internal standard includes rpp30; the primer probe combination for detecting the human sample internal standard includes:

[0025] (I), a primer pair having the nucleotide sequence shown in SEQ ID NO: 9 and SEQ ID NO: 10, and a specific probe having the nucleotide sequence shown in SEQ ID NO: 8; or

[0026] (II) a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I) but is different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or

[0027] (III) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar function as the nucleotide sequence shown in (I) or (II); or

[0028] (IV) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of (I), (II) or (III).

[0029] In some specific embodiments of the present invention, the 5' end of the specific probe is modified with a fluorescent group, and the 3' end is modified with a quenching group.

[0030] In some specific embodiments of the present invention, the fluorescent group includes FAM, HEX, ROX, CY5, VIC or JOE; the quenching group includes BHQ1, BHQ2, BHQ3, MB, SQ1 or SQ2.

[0031] The present invention also provides the use of the primer-probe combination in any of the following items:

[0032] (I), preparing a reagent or kit for detecting Aspergillus; and / or

[0033] (II), preparing reagents or kits for detecting Mucorales; and / or

[0034] (III), preparing a reagent or a kit for detecting Penicillium; and / or

[0035] (IV), preparing a reagent or a kit for detecting Bacillus marneffei; and / or

[0036] (V) preparing a reagent or a kit for detecting Pneumocystis jirovecii; and / or

[0037] (VI) preparing a reagent or a kit for identifying Aspergillus, Penicillium and Blue Fungus marneffei; and / or

[0038] (VII), preparing a reagent or kit for identifying Mucorales and Pneumocystis jiroveci; and / or

[0039] (VIII) Prepare a reagent or kit for identifying Aspergillus, Mucorales, Penicillium, Blue-Shaped Fungus of Marneffei and Pneumocystis jiroveci.

[0040] The invention also provides a fungus detection reagent, comprising the primer-probe combination.

[0041] The present invention also provides the use of any of the following items in the preparation of fungus detection products:

[0042] (I), the primer-probe combination; and / or

[0043] (II), the fungus detection reagent.

[0044] In some specific embodiments of the present invention, the product comprises a test strip, a kit or a biosensor.

[0045] The present invention also provides a fungus detection kit, comprising any of the following items:

[0046] (I), the primer-probe combination; and / or

[0047] (II), the fungus detection reagent.

[0048] In some specific embodiments of the present invention, the final concentrations of the primers in the primer pair are 0.1 to 2.0 mM respectively; and the final concentration of the specific probe is 0.1 to 2.0 mM.

[0049] In some specific embodiments of the present invention, the final concentration of primers having nucleotide sequences as shown in SEQ ID NO.5, SEQ ID NO.7, SEQ ID NO.9, and SEQ ID NO.10 includes 0.25mM; the final concentration of primers having nucleotide sequences as shown in SEQ ID NO.1, SEQ ID NO.4, SEQ ID NO.10S, SEQ ID NO.11, SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.16 includes 0.3mM; and the final concentration of the specific probe includes 0.2mM.

[0050] In some specific embodiments of the present invention, the kit includes MIX 1 reaction solution and MIX 2 reaction solution; the MIX 1 reaction solution includes: 10-100 mM Tris-HCl (pH 7.5), preferably 25 mM Tris-HCl (pH 7.5); 0-0.3% (v / v) Tween 20, preferably 0.05% (v / v) Tween 20; 0.5-4% (v / v) glycerol, preferably 2% (v / v) glycerol; 0-10% (v / v) DMSO, preferably 3.5% (v / v) DMSO; 0.1-1.0 mM dNTP, preferably 0.45 mM dNTP; 0-0.1% PEG2000, preferably 0.04% PEG2000; 0.1-3 mM EDTA, preferably 0.45 mM EDTA; 0.1-2.0 mM primers and probes SEQ ID NO.1 to SEQ ID NO.10, preferably 0.3mM SEQ ID NO.1, 0.3mM SEQ ID NO.4, 0.25mM SEQ ID NO.5, 0.25mM SEQ ID NO.7, 0.25mM SEQ ID NO.9, 0.3mM SEQ ID NO.10, 0.2mM probe SEQ ID NO.2, 0.2mM SEQ ID NO.3, 0.2mM SEQ ID NO.6, 0.2mM SEQ ID NO.8, 0.3mM SEQ ID NO.11, 0.3mM SEQ ID NO.13, 0.3mM SEQ ID NO.14, 0.3

[0051] mM SEQ ID NO.16, 0.2mM SEQ ID NO.12, 0.2mM SEQ ID NO.15;

[0052] The MIX 2 reaction solution comprises: 50-150 mM Tris-HCl (pH 7.5), preferably 75 mM Tris-HCl (pH 7.5); 20-200 mM KCl, preferably 95 mM KCl; 1-20 mM DTT, preferably 5.5 mM DTT; 0-10% (v / v) glycerol, preferably 2.5 (v / v)%; 0.02-0.30 U / μL rTth enzyme, preferably 0.065 U / μL rTth enzyme; 0.02-0.15 U / μL UDG enzyme, preferably 0.073 U / μL UDG enzyme; 0-0.005% BSA, preferably 0.0008% BSA; 0-5% trehalose, preferably 0.75% trehalose; 0-150 mM tetramethylammonium chloride, preferably 45 mM tetramethylammonium chloride; 0.1-2% (v / v) Triton X-100, preferably 0.45% (v / v) Triton X-100; 10-60 mM MnSO4, preferably 45 mM MnSO4.

[0053] The present invention also provides a fungus detection method for non-disease diagnosis and treatment purposes, comprising detecting a sample to be tested based on any of the following items:

[0054] (I), the primer-probe combination;

[0055] (II), the fungus detection reagent; and / or

[0056] (III), the fungus detection kit.

[0057] The present invention provides the following beneficial effects:

[0058] In order to solve the problem of nucleic acid detection of multiple genera of fungi in clinical practice, the present invention proposes a nucleic acid detection kit for Aspergillus, Mucorales, Penicillium, Marneffei blue fungus and Pneumocystis jirovecii using PCR fluorescent probe technology. For the detection targets of Aspergillus, Mucorales, Penicillium, Marneffei blue fungus and Pneumocystis jirovecii, 18S rRNA, 5.8S rRNA, 18S rRNA, ITS2, mitochondrial small subunit and other rDNA gene sequences are used as detection target areas to design detection primers and probes, wherein the detection of Aspergillus and Penicillium can detect the genus, the detection of Mucorales can detect the order, and the detection of Marneffei blue fungus and Pneumocystis jirovecii can detect the species. The product is designed to cover different species of invasive fungal infections such as Aspergillus, Mucorales, Penicillium, Marneffei and Pneumocystis jiroveci, which are common in clinical practice. It has a higher coverage of fungal species and a wider coverage range, and can meet the routine departmental detection of invasive fungal infections in the lungs. It is especially suitable for fungal sample detection in ICU infected patients, effectively improving the clinical detection rate of difficult-to-culture fungi of Aspergillus, Mucorales and Penicillium, and providing a pathogenic basis for the diagnosis and treatment of clinical fungal infections. At the same time, the reaction system can be matched with a fully automated nucleic acid detection system, and can realize automated nucleic acid extraction, system construction, nucleic acid amplification and result interpretation on the same instrument, which fully liberates manual labor and greatly reduces the risk of laboratory contamination caused by improper operation of personnel. The non-frozen long-term storage conditions reduce transportation and storage costs, realize on-demand testing of samples, shorten the reporting time of test results, and are conducive to the realization of inspection standardization. For this detection kit, since the performance of the primer and probe design is more excellent, it has high detection sensitivity (detection limit is 2 bacteria / mL of sample), strong specificity, and the cross-reaction of different bacterial species has been fully verified. It has excellent detection performance, convenient operation, safety and efficiency, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0059] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0060] Figure 1 The results of detecting Aspergillus-positive sputum samples using the detection method of Example 1 are shown;

[0061] Figure 2 The results of detecting Aspergillus-positive sputum samples using the detection method of Example 2 are shown;

[0062] Figure 3 The results of detecting Aspergillus-positive sputum samples using the detection method of Example 3 are shown;

[0063] Figure 4The sensitivity test result diagram is shown;

[0064] Figure 5 The figure shows the precision test result;

[0065] Figure 6 Example 1 shows the detection method detection specificity;

[0066] FIG7 shows the inclusiveness verification of the primer probe of Aspergillus of the present invention, wherein A shows the detection results of Aspergillus; B shows the detection results of Aspergillus fumigatus; C shows the detection results of Aspergillus flavus; D shows the detection results of Aspergillus niger; E shows the detection results of Aspergillus terreus; F shows the detection results of Aspergillus oryzae; G shows the detection results of Aspergillus blancmange; H shows the detection results of Aspergillus nidulans; I shows the detection results of Aspergillus tubingensis;

[0067] Figure 8 The results of the Aspergillus primer probe of the present invention for detecting Aspergillus candidus are shown;

[0068] Fig. 9 The inclusiveness verification of the primer probe of Aspergillus in Comparative Example 2 is shown;

[0069] Fig.10 The results of detecting Aspergillus candidus using the Aspergillus primer probe in Comparative Example 2 are shown. DETAILED DESCRIPTION

[0070] The present invention discloses primer-probe combinations, kits and applications for fungal PCR detection. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the same. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0071] In order to solve the problem of nucleic acid detection of multiple genera of fungi in clinical practice, the present invention proposes a nucleic acid detection kit for Aspergillus, Mucorales, Penicillium, Marneffei blue fungus and Pneumocystis jirovecii using PCR fluorescent probe technology. For the detection targets of Aspergillus, Mucorales, Penicillium, Marneffei blue fungus and Pneumocystis jirovecii, 18S rRNA, 5.8S rRNA, 18S rRNA, ITS2, mitochondrial small subunit and other rDNA gene sequences are used as detection target areas to design detection primers and probes, wherein the detection of Aspergillus and Penicillium can detect the genus, the detection of Mucorales can detect the order, and the detection of Marneffei blue fungus and Pneumocystis jirovecii can detect the species. The product is designed to cover different species of invasive fungal infections such as Aspergillus, Mucorales, Penicillium, Marneffei and Pneumocystis jiroveci, which are common in clinical practice. It has a higher coverage of fungal species and a wider coverage range, and can meet the routine departmental testing of invasive fungal infections in the lungs. It is especially suitable for fungal sample testing of ICU infected patients, effectively improving the clinical detection rate of difficult-to-culture fungi of Aspergillus, Mucorales and Penicillium, and providing a pathogenic basis for the diagnosis and treatment of clinical fungal infections. At the same time, the reaction system is equipped with a fully automated nucleic acid detection system, which can realize automated nucleic acid extraction, system construction, nucleic acid amplification and result interpretation on the same instrument, greatly improving the automation level of the testing laboratory, fully liberating manual labor, and facilitating the realization of testing standardization. At the same time, it greatly reduces the risk of laboratory contamination caused by improper operation of personnel. For this detection kit, since the performance of the primer and probe design is more excellent, it has high detection sensitivity (detection limit is 2 bacteria / mL of sample), strong specificity, and the cross-reaction of different bacterial species has been fully verified. It has excellent detection performance, convenient operation, safety and efficiency, etc.

[0072] The fungus detection kit involved in the present invention has two amplification reaction systems in primer and probe design, amplification reaction system 1 (target Aspergillus / Penicillium / Marneffei blue fungus / internal standard 4-fold detection system):

[0073] The nucleotide sequences shown in SEQ ID NO.1 to SEQ ID NO.10 (5'-3'):

[0074] SEQ ID NO.1:TTTGATTTCTCGTAAGGTGC

[0075] SEQ ID NO.2: HEX-TAGAAACACCGCCCGAT-MB

[0076] SEQ ID NO.3: FAM-TAGAATCCCGTCCGAT-MB

[0077] SEQ ID NO.4: ATGGTTAAGACTACGACGG

[0078] SEQ ID NO.5: ATGGGCCTCTGTCACTCG

[0079] SEQ ID NO.6: ROX-AACCCCCGCAGGTCCTTCCC-BHQ-2

[0080] SEQ ID NO.7:CCGTGGTAAATATGGTGGTGAC

[0081] SEQ ID NO.8: CY5-CTGACCTGAAGGCTCTGCG-BHQ3

[0082] SEQ ID NO.9:GTTTGCAGATTTGGACCTG

[0083] SEQ ID NO.10: CGGCTGTCTCCACAAGTC

[0084] Among them, SEQ ID NO.1 and SEQ ID NO.4 are primer pairs for fluorescent PCR detection of 18S rRNA targets of Aspergillus and Penicillium; SEQ ID NO.2 is a probe sequence for fluorescent PCR detection of Aspergillus; SEQ ID NO.3 is a probe sequence for fluorescent PCR detection of Penicillium; SEQ ID NO.5 and SEQ ID NO.7 are primer pairs for fluorescent PCR detection of ITS2 targets of T. marneffei; SEQ ID NO.6 is a probe sequence for fluorescent PCR detection of T. marneffei; SEQ ID NO.9 and SEQ ID NO.10 are primer pairs for fluorescent PCR detection of internal standard rpp30 in human samples; SEQ ID NO.8 is a probe sequence for fluorescent PCR detection of human internal standard;

[0085] Amplification reaction system 2 (target Mucorales / Pneumocystis jiroveci / internal standard triple detection system):

[0086] Nucleotide sequences shown in SEQ ID NO.8 to SEQ ID NO.16 (5'-3'):

[0087] SEQ ID NO.8: CY5-CTGACCTGAAGGCTCTGCG-BHQ3

[0088] SEQ ID NO.9:GTTTGCAGATTTGGACCTG

[0089] SEQ ID NO.10: CGGCTGTCTCCACAAGTC

[0090] SEQ ID NO.11:ATCTCTTGGTTCTCGCATC

[0091] SEQ ID NO.12: ROX-CGTAGCAAAGTGCGATAA-BHQ-2

[0092] SEQ ID NO.13:TCAAAGACTCGATGATTCAC

[0093] SEQ ID NO.14: ACCAATTCTCGTGCCAGC

[0094] SEQ ID NO.15: FAM-TCGCGGTAAGACGAGTGAGGCT-BHQ-1

[0095] SEQ ID NO.16: CCATCTACGTACCCTTTAGACC

[0096] Among them, SEQ ID NO.9 and SEQ ID NO.10 are primer pairs for fluorescent PCR detection of internal standard rpp30 in human samples; SEQ ID NO.8 is the probe sequence for fluorescent PCR detection of human internal standard; SEQ ID NO.11 and SEQ ID NO.13 are primer pairs for fluorescent PCR detection of Mucorales 5.8S rRNA target; SEQ ID NO.12 is the probe sequence for fluorescent PCR detection of Mucorales; SEQ ID NO.14 and SEQ ID NO.16 are primer pairs for fluorescent PCR detection of mitochondrial small subunit of Pneumocystis jirovecii; SEQID NO.15 is the probe sequence for fluorescent PCR detection of Pneumocystis jirovecii.

[0097] The target sequence information of the primer probe of the present invention is as follows:

[0098] Blue bacteria of Marneffei (SEQ ID NO.17):

[0099] ATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCATA TTTACCACGG

[0100] Aspergillus (SEQ ID NO.18):

[0101] TTTGATTTCTCGTAAGGTGCCGAGCGGGTCATCATAGAAACACCGCCCGATCCC TAGTCGGCATAGTTTATGGTTAAGACTACGACGG

[0102] Penicillium (SEQ ID NO. 19):

[0103] TTTGATTTCTCGTAAGGTGCCGAACGGGTCATTATAGAATCCCGTCCGATCCCT AGTCGGCATAGTTTATGGTTAAGACTACGACGG

[0104] Mucorales (SEQ ID NO.20):

[0105] ATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTG AATTGCATATTCAGTGAATCATCGAGTCTTTGA

[0106] Pneumocystis jiroveci (SEQ ID NO.21):

[0107] ACCAATTCTCGTGCAGCAGTCGCGGTAAGACGAGTGAGGCTAGCGTTATTCATAATTATTAGGTCTAAAGGGTACGTAGATGG

[0108] This kit is designed for the primer and probe sequences involved in the amplification of the corresponding detection target areas of different fungal species, and provides different reaction system packages to complete automated amplification. The components and concentrations of the MIX 1 reaction system used in the amplification reaction system 1 are as follows:

[0109] 10-100 mM Tris-HCl (pH 7.5), preferably 25 mM Tris-HCl (pH 7.5); 0-0.3% (v / v) Tween 20, preferably 0.05% (v / v) Tween 20; 0.5-4% (v / v) glycerol, preferably 2% (v / v) glycerol; 0-10% (v / v) DMSO, preferably 3.5% (v / v) DMSO; 0.1-1.0 mM dNTP, preferably 0.45 mM dNTP; 0-0.1% PEG2000, preferably 0.04% PEG2000; 0.1-3 mM EDTA, preferably 0.45 mM EDTA; 0.1-2.0 mM primers and probes SEQ ID NO.1 to SEQ ID NO.10, preferably 0.3 mM SEQ ID NO.1, 0.3 mM SEQ ID NO.4, 0.25mM SEQ ID NO.5, 0.25mM SEQ ID NO.7, 0.25mM SEQ ID NO.9, 0.3mM SEQ ID NO.10, 0.2mM probe SEQ ID NO.2, 0.2mM SEQ ID NO.3, 0.2mM SEQ ID NO.6, 0.2mM SEQ ID NO.8. Except for the different primers and probes used in the MIX 1 reaction system used in the amplification reaction system 2, the other chemical substances and concentrations are consistent with those in the amplification reaction system 1. The primers, probes and concentrations used in the amplification reaction system 2 are: 0.1-2.0 mM primers and probes SEQ ID NO.8-SEQ ID NO.16, preferably 0.25 mM SEQ ID NO.10, 0.25 mM SEQ ID NO.9, 0.3 mM SEQ ID NO.11, 0.3 mM SEQ ID NO.13, 0.3 mM SEQ ID NO.14, 0.3 mM SEQ ID NO.16, 0.2 mM probe SEQ ID NO.8, 0.2 mM SEQ ID NO.12, and 0.2 mM SEQ ID NO.15.

[0110] Amplification reaction system 1 and amplification reaction system 2 share the same tube MIX 2. The components and concentrations of MIX 2 are as follows: 50-150mM Tris-HCl (pH7.5) for the sample, preferably 75mM Tris-HCl (pH7.5); 20-200mM KCl, preferably 95mM KCl; 1-20mM DTT, preferably 5.5mM DTT; 0-10% (v / v) glycerol, preferably 2.5% (v / v) glycerol; 0.02-0.30U / μL rTth enzyme, preferably 0.065U / μL rTth enzyme; 0.02-0.15U / μLUDG enzyme, preferably 0.073U / μLUDG enzyme; 0-0.005% BSA, preferably 0.0008% BSA; 0-5% trehalose, preferably 0.75% trehalose; 0-150mM tetramethylammonium chloride (TMAC), preferably 45mM tetramethylammonium chloride; 0.1-2% (v / v) TritonX-100, preferably 0.45% (v / v) TritonX-100; 10-60mM MnSO4, preferably 45mM MnSO4.

[0111] The percentages (%) involved in the present invention, unless otherwise specified, are all mass volume percentages, i.e. g / 100mL. For example, 5% means that there are 5g of solute per 100mL of liquid.

[0112] The v / v involved in the present invention is a volume fraction, which refers to the percentage of the volume of the solute (liquid) to the total volume of the solution.

[0113] For the reaction system designed for this kit, the PCR reaction parameters are specifically set as follows: uracil glycosylase treatment: 55°C for 2 minutes; reverse transcription: 60°C for 20 minutes; pre-denaturation: 95°C for 2 minutes, amplification cycle: 94°C for 12 seconds, 58°C for 22 seconds, a total of 45 cycles. At 58°C, the FAM fluorescence channel and the HEX, ROX, and CY5 fluorescence channels are set to collect fluorescence signals respectively.

[0114] The beneficial effects provided by the present invention are as follows:

[0115] 1. This product is designed to cover different species of invasive fungal infections such as Aspergillus, Mucorales, Penicillium, Pneumocystis marneffei and Pneumocystis jiroveci. It has a higher coverage of fungal species and a wider range, which can meet the routine departmental testing of invasive fungal infections of the lungs in clinical practice. It is especially suitable for fungal sample testing of ICU infected patients, effectively improving the clinical detection rate of difficult-to-culture fungi of Aspergillus, Mucorales and Penicillium, and providing a pathogenic basis for the diagnosis and treatment of clinical fungal infections.

[0116] 2. The reaction system is equipped with a fully automated nucleic acid detector, which can realize automated sample processing, nucleic acid extraction and amplification on the same instrument, greatly improving the automation level of the testing laboratory, fully liberating manual labor, and facilitating the realization of testing standardization. At the same time, it greatly reduces the risk of laboratory contamination caused by improper operation of personnel.

[0117] 3. The primer and probe design has excellent performance, with a detection sensitivity of more than 98%, reaching the international advanced inspection level; the detection limit is as low as 2 bacteria / mL of the sample, reaching the international advanced level, effectively avoiding the occurrence of missed detection; strong specificity and stable detection system;

[0118] 4. The product design is highly innovative, and the joint inspection design is conducive to the targeted coverage of fungal pathogens, effectively preventing missed inspections or mixed inspections.

[0119] Unless otherwise specified, the primer-probe combination, the kit and the raw materials and reagents used in the application of the present invention for fungal PCR detection can be purchased from the market.

[0120] The present invention will be further described below in conjunction with embodiments:

[0121] Example 1 Detection of positive sputum samples from patients with clinical Aspergillus infection

[0122] For positive sputum samples from patients with clinical Aspergillus infection, the concentration of Penicillium was 5.8*10 4 spores / mL, Aspergillus 2.1*10 4 spores / mL, Blue-shaped bacteria of Marneffei 1.6*10 4 CFU / mL, Pneumocystis jiroveci 5.6*10 4 copies / mL, Mucorales 4.7*10 4spores / mL; firstly, the sputum was digested with 2 volumes of 4% NaOH solution for 2 minutes, then 1 volume of 10% (v / v) acetic acid solution was added for neutralization, centrifuged at 8000 rpm for 10 minutes, the supernatant was discarded, water was added to the bacteria to wash the bacteria, and glass beads were added for oscillation and grinding for 10 minutes; 200 microliters of the treated homogenized reagent was added to the sample tube, and the subsequent automated reaction process was completed using an automatic nucleic acid purification and amplification instrument (Zhengzhou Antu Bioengineering Co., Ltd., automatic nucleic acid purification and real-time fluorescence PCR analysis system AutoMolec 3000), and the reaction system used was designed as follows: Amplification reaction system 1 The components and final concentrations of the MIX 1 reaction system used were: 25mMTris-HCl (pH7.5), 0.05% (v / v) Tween 20, 2% (v / v) glycerol, 3.5% (v / v) DMSO, 0.45mM dNTP, 0.04% PEG2000, 0.45mM EDTA, 0.3mM SEQ ID NO.1, 0.3mM SEQ ID NO.4, 0.25mM SEQ ID NO.5, 0.25mM SEQ ID NO.7, 0.25mM SEQ ID NO.9, 0.3mM SEQ ID NO.10, 0.2mM probe SEQ ID NO.2, 0.2mM SEQ ID NO.3, 0.2mM SEQ ID NO.6, 0.2mM SEQ ID NO.8. The chemical substances and concentrations in the MIX 1 reaction system used in amplification reaction system 2 are consistent with those in amplification reaction system 1. The primers, probes and concentrations used in amplification reaction system 2 are: 0.25mM SEQ ID NO.10, 0.25mM SEQ ID NO.9, 0.3mM SEQ ID NO.11, 0.3mM SEQ ID NO.13, 0.3mM SEQ ID NO.14, 0.3mM SEQ ID NO.16, 0.2mM probe SEQID NO.8, 0.2mM SEQ ID NO.12, and 0.2mM SEQ ID NO.15. Amplification reaction system 1 and amplification reaction system 2 share the same tube MIX 2. The components and concentrations of MIX 2 are as follows: 75 mM Tris-HCl (pH 7.5), 95 mM KCl, 5.5 mM DTT, 2.5% (v / v) glycerol, 3.25 U rTth enzyme, 3.65 U UDG enzyme, 0.0008% BSA, 0.75% trehalose, 45 mM tetramethylammonium chloride, 0.45% (v / v) Triton X-100, 45 mM MnSO4.The specific PCR reaction parameters were set as follows: uracil glycosylase treatment: 55°C for 2 minutes; reverse transcription: 60°C for 20 minutes; pre-denaturation: 95°C for 2 minutes, amplification cycle: 94°C for 12 seconds, 58°C for 22 seconds, for a total of 45 cycles. At 58°C, the FAM fluorescence channel and HEX, ROX, and CY5 fluorescence channels were set for fluorescence signal acquisition. The reagent was used to amplify positive sputum samples of Penicillium, Aspergillus, Marneffei, Pneumocystis jiroveci, and Mucorales, and positive results were obtained, such as. Figure 1 shown.

[0123] Example 2 Detection of positive sputum samples from patients with clinical Aspergillus infection

[0124] For positive sputum samples from patients with clinical Aspergillus infection, the concentration of Penicillium was 5.8*10 4 spores / mL, Aspergillus 2.1*10 4 spores / mL, Blue-shaped bacteria of Marneffei 1.6*10 4 CFU / mL, Pneumocystis jiroveci 5.6*10 4 copies / mL, Mucorales 4.7*10 4spores / mL; firstly, the sputum was digested with 2 volumes of 4% NaOH solution for 2 minutes, then 1 volume of 10% (v / v) acetic acid solution was added for neutralization, centrifuged at 8000 rpm for 10 minutes, the supernatant was discarded, water was added to the bacteria to wash the bacteria, and glass beads were added for oscillation and grinding for 10 minutes; 200 microliters of the treated homogenized reagent was added to the sample tube, and the subsequent automated reaction process was completed using an automatic nucleic acid purification and amplification instrument (Zhengzhou Antu Biotechnology Co., Ltd., automatic nucleic acid purification and real-time fluorescence PCR analysis system AutoMolec 3000), and the reaction system used was designed as follows: Amplification reaction system 1 The components and concentrations of the MIX 1 reaction system used are as follows: 10mMTris-HCl (pH7.5), 0.5% (v / v) glycerol, 0.1mM dNTP, 0.1mM EDTA, 0.1mM SEQ ID NO.1, 0.1mM SEQ ID NO.4, 0.1mM SEQ ID NO.5, 0.1mM SEQ ID NO.7, 0.1mM SEQ ID NO.9, 0.1mM SEQ ID NO.10, 0.1mM probe SEQ ID NO.2, 0.1mM SEQ ID NO.3, 0.1mM SEQ ID NO.6, 0.1mM SEQ ID NO.8. The chemical substances and concentrations in the MIX 1 reaction system used in the amplification reaction system 2 are consistent with those in the amplification reaction system 1. The primers and probes used in the amplification reaction system 2 and their concentrations are: 0.1mM SEQ ID NO.10, 0.1mM SEQ ID NO.9, 0.1mM SEQ ID NO.11, 0.1mM SEQ ID NO.13, 0.1mM SEQ ID NO.14, 0.1mM SEQ ID NO.16, 0.1mM probe SEQ ID NO.8, 0.1mM SEQ ID NO.12, 0.1mM SEQ ID NO.15. The amplification reaction system 1 and the amplification reaction system 2 share the same tube MIX 2. The components and concentrations of MIX 2 are as follows: sample 1mM Tris-HCl (pH7.5), 20mM KCl, 1mM DTT, 1U rTth enzyme, 1U UDG enzyme, 10mM MnSO4. The specific PCR reaction parameters were set as follows: uracil glycosylase treatment: 55°C for 2 minutes; reverse transcription: 60°C for 20 minutes; pre-denaturation: 95°C for 2 minutes, amplification cycle: 94°C for 12 seconds, 58°C for 22 seconds, for a total of 45 cycles. At 58°C, the FAM fluorescence channel and HEX, ROX, and CY5 fluorescence channels were set for fluorescence signal acquisition.The reagent was used to amplify positive sputum samples of Penicillium, Aspergillus, Blue-Shaped Pseudomonas marneffei, Pneumocystis jiroveci, and Mucorales, and positive results were obtained, such as. Figure 2 shown.

[0125] Example 3 Detection of positive sputum samples from patients with clinical Aspergillus infection

[0126] For positive sputum samples from patients with clinical Aspergillus infection, the concentration of Penicillium was 5.8*10 4 spores / mL, Aspergillus 2.1*10 4 spores / mL, Blue-shaped bacteria of Marneffei 1.6*10 4 CFU / mL, Pneumocystis jiroveci 5.6*10 4 copies / mL, Mucorales 4.7*10 4spores / mL; firstly, the sputum was digested with 2 volumes of 4% NaOH solution for 2 minutes, then 1 volume of 10% (v / v) acetic acid solution was added for neutralization, centrifuged at 8000 rpm for 10 minutes, the supernatant was discarded, water was added to the bacteria to wash the bacteria, and glass beads were added for oscillation and grinding for 10 minutes; 200 microliters of the treated homogenized reagent was added to the sample tube, and the subsequent automated reaction process was completed using a fully automatic nucleic acid purification and amplification instrument (Zhengzhou Antu Biotechnology Co., Ltd., fully automatic nucleic acid purification and real-time fluorescence PCR analysis system AutoMolec 3000), and the reaction system used was designed as follows: Amplification reaction system 1 The components and concentrations of the MIX 1 reaction system used are as follows: 100mMTris-HCl (pH7.5), 0.3% (v / v) Tween 20, 4% (v / v) glycerol, 10% (v / v) DMSO, 1mM dNTP, 0.1% PEG2000, 3mM EDTA, 2mM SEQ ID NO.1, 2mM SEQ ID NO.4, 2mM SEQ ID NO.5, 2mM SEQ ID NO.7, 2mM SEQ ID NO.9, 2mM SEQ ID NO.10, 2mM probe SEQ ID NO.2, 2mM SEQ ID NO.3, 2mM SEQ ID NO.6, 2mM SEQ ID NO.8. The chemical substances and concentrations in the MIX 1 reaction system used in the amplification reaction system 2 are consistent with those in the amplification reaction system 1. The primers and probes used in the amplification reaction system 2 and their concentrations are: 2mM SEQ ID NO.10, 2mM SEQ ID NO.9, 2mM SEQ ID NO.11, 2mM SEQ ID NO.13, 2mM SEQ ID NO.14, 2mM SEQ ID NO.16, 2mM probe SEQ ID NO.8, 2mM SEQ ID NO.12, 2mM SEQ ID NO.15. Amplification reaction system 1 and amplification reaction system 2 share the same tube MIX 2, and the components and concentrations of MIX 2 are as follows: 1 sample 1mM Tris-HCl (pH7.5), 200mM KCl, 20mM DTT, 10% (v / v) glycerol, 15U rTth enzyme, 7.5U UDG enzyme, 0.005% BSA, 5% trehalose, 1 sample 1mM tetramethylammonium chloride, 2% (v / v) TritonX-100, 60mM MnSO4. The specific PCR reaction parameters are set as follows: uracil glycosylase treatment: 55°C for 2 minutes; reverse transcription: 60°C for 20 minutes; pre-denaturation: 95°C for 2 minutes, amplification cycle: 94°C for 12 seconds, 58°C for 22 seconds, a total of 45 cycles.At 58°C, the FAM fluorescence channel and the HEX, ROX, and CY5 fluorescence channels were set to collect fluorescence signals respectively. The reagent was used to amplify and detect positive sputum samples of Penicillium, Aspergillus, Marneffei, Pneumocystis jiroveci, and Mucorales, and positive results were obtained, such as. Figure 3 shown.

[0127] Example 4 Sensitivity and Precision Verification

[0128] In order to investigate the sensitivity and precision of the detection method of the present invention, the reaction system in Example 1 was used to select Aspergillus fumigatus ATCC204305, Aspergillus flavus ATCC 28539, Aspergillus niger ATCC6275, Aspergillus terreus ATCC34571, Mucor umbellata ATCC 227 sample 1, CICC40383, Mucor microsporus CICC41599, Mucor racemosus CICC40477, Penicillium chrysogenum CICC41488, Penicillium citrinum CICC40673, Penicillium griseofulvum CICC40293, Penicillium achromatum CICC40643, Penicillium marneffei (clinical isolate) and Pneumocystis jirovecii (clinical isolate) cultured on solid culture medium, and the relationship between the fixed value of the strains was established by the method of digital PCR fixed value and spread culture, and the liquefied sputum was used as the matrix to dilute different gradients of 1*10 5 bacteria / mL, 1*10 4 bacteria / mL, 1*10 3 bacteria / mL, 0.5*10 3 bacteria / mL, 0.3*10 3 bacteria / mL, 1*10 2 The sensitivity of the strains was tested using the detection method of the present invention at different concentrations such as 1000 bacteria / mL. Figure 4 As shown, it is determined that the selected strains can be detected when the sample concentration is 2 bacteria / mL. Select 1*10 3 The detection method described in the embodiment was repeated 10 times for each strain with a concentration of 1000 bacteria / mL, and the CV (%) was calculated. The results are as follows Figure 5 As shown, the detection precision CV of each strain was less than 5%, and the precision was good.

[0129] Example 5 Specificity Verification

[0130] Common clinical isolates of strains other than those included in the detection system of Example 1 of the present invention were selected as cross-strains for specific verification. Clinical isolates of Candida albicans, Candida parapsilosis, Candida tropicalis, Candida krusei, Candida glabrata, Candida guilliermondii, Cryptococcus neoformans, Cryptococcus gothi, Escherichia coli, Klebsiella pneumoniae, Streptococcus pneumoniae, Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumannii, Burkholderia cepacia, influenza A virus, influenza B virus, parainfluenza virus type I, metapneumovirus, rhinovirus and other specific cross-substances were selected, and the experimental concentration of each substance was determined to be 1*10 by culture counting and digital PCR fixed value counting. 6 copies / mL or 1*10 6 / mL, Penicillium, Aspergillus, Marneffei Blue-Shaped Fungus, Pneumocystis jiroveci, and Mucorales were used as positive results for testing. The results are as follows Figure 6 As shown in the figure, except for the positive test of Aspergillus, the other test results were negative, which proved that this kit has good specificity.

[0131] Example 6 Inclusive Verification

[0132] In the detection system of the present invention, SEQ ID NO.1 and SEQ ID NO.4 are primer pairs for fluorescent PCR detection of 18S rRNA targets of Aspergillus and Penicillium; SEQ ID NO.2 is a probe sequence for fluorescent PCR detection of Aspergillus.

[0133] The above primer pairs and probes were used to detect Aspergillus fumigatus, Aspergillus flavus, Aspergillus niger, Aspergillus terreus, Aspergillus nidulans, Aspergillus oryzae, Aspergillus sydowii, Aspergillus versicolor, Aspergillus candidus, and Aspergillus glaucus. The inclusive results are shown in Figures 7 and 8. Different species of Aspergillus can be detected, which shows that the primer pairs and probes of the present invention have strong tolerance to Aspergillus.

[0134] Example 7 Real-time stability of reagents

[0135] The reaction system in Example 1 was used, and two mixed samples containing various targets and internal standards (containing target sequences of Penicillium, Aspergillus, Pneumocystis marneffei, Pneumocystis jiroveci, Mucorales, and internal standard rpp30) of different concentrations (sample 1: 10,000 bacteria / mL; sample 2: 1,000 bacteria / mL) were used. Each sample was repeated twice and placed at 2-8° for 0 day (the newly prepared reagent was used as the real-time 0 day), 3 months, 6 months, and 12 months later, and the ct difference between each channel and the 0 day was counted.

[0136] From the results in Table 1, it can be seen that the difference between the ct of each target after one year and that of day 0 is small, indicating that the reaction system of the present invention has good stability.

[0137] Table 1 Real-time stability of reagents - tube 1

[0138]

[0139]

[0140] Table 2 Real-time stability of reagents - tube 2

[0141]

[0142] Comparative Example

[0143] The primer Asp-R2.1 sequence in CN118028522A cannot match its target gene, and has poor tolerance, and almost no Aspergillus glaucosa was detected ( Fig. 9 , Fig.10 ).

[0144] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer-probe combination for fungal PCR detection, characterized in that: The method comprises one or more of a primer probe combination 1 for detecting Aspergillus, a primer probe combination 2 for detecting Penicillium, a primer probe combination 3 for detecting Pseudomonas marneffei, a primer probe combination 4 for detecting Mucorales, or a primer probe combination 5 for detecting Pneumocystis jiroveci; (I), the primer-probe combination 1 comprises a primer pair having a nucleotide sequence as shown in SEQ ID NO: 1 and SEQ ID NO: 4, and a specific probe having a nucleotide sequence as shown in SEQ ID NO: 2; The primer-probe combination 2 includes a primer pair having nucleotide sequences as shown in SEQ ID NO: 1 and SEQ ID NO: 4, and a specific probe having a nucleotide sequence as shown in SEQ ID NO: 3; The primer-probe combination 3 includes a primer pair having nucleotide sequences as shown in SEQ ID NO: 5 and SEQ ID NO: 7, and a specific probe having a nucleotide sequence as shown in SEQ ID NO: 6; The primer-probe combination 4 includes a primer pair having nucleotide sequences as shown in SEQ ID NO: 11 and SEQ ID NO: 13, and a specific probe having a nucleotide sequence as shown in SEQ ID NO: 12; The primer-probe combination 5 comprises a primer pair having a nucleotide sequence as shown in SEQ ID NO: 14 and SEQ ID NO: 16, and a specific probe having a nucleotide sequence as shown in SEQ ID NO: 15; or (II) a nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I) but is different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or (III) a nucleotide sequence obtained by replacing, deleting or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and having the same or similar function as the nucleotide sequence shown in (I) or (II); or (IV) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence of (I), (II) or (III).

2. The primer-probe combination according to claim 1, characterized in that: Also included are primer-probe combinations for detecting internal standards in human samples.

3. The primer-probe combination according to claim 1 or 2, characterized in that: The 5' end of the specific probe is modified with a fluorescent group, and the 3' end is modified with a quenching group.

4. The primer-probe combination according to any one of claims 1 to 3, characterized in that: The fluorescent group includes FAM, HEX, ROX, CY5, VIC or JOE; the quenching group includes BHQ1, BHQ2, BHQ3, MB, SQ1 or SQ2.

5. Use of the primer-probe combination according to any one of claims 1 to 4 in any of the following items: (I), preparing a reagent or kit for detecting Aspergillus; and / or (II), preparing reagents or kits for detecting Mucorales; and / or (III), preparing a reagent or a kit for detecting Penicillium; and / or (IV), preparing a reagent or a kit for detecting Bacillus marneffei; and / or (V) preparing a reagent or a kit for detecting Pneumocystis jirovecii; and / or (VI), preparing a reagent or a kit for identifying Aspergillus, Penicillium and Blue Fungus marneffei; and / or (VII), preparing a reagent or kit for identifying Mucorales and Pneumocystis jiroveci; and / or (VIII) Prepare a reagent or kit for identifying Aspergillus, Mucorales, Penicillium, Blue-Shaped Fungus of Marneffei and Pneumocystis jiroveci.

6. A fungus detection reagent, characterized in that: The method comprises the primer-probe combination according to any one of claims 1 to 4.

7. Use of any of the following in the preparation of fungal detection products: (I) a primer-probe combination as described in any one of claims 1 to 4; and / or (II) The fungus detection reagent as described in claim 6.

8. A fungus detection kit, characterized in that: Include any of the following: (I) a primer-probe combination as described in any one of claims 1 to 4; and / or (II) The fungus detection reagent as described in claim 6.

9. The fungus detection kit according to claim 8, characterized in that The final concentrations of the primers in the primer pair are 0.1 to 2.0 mM respectively; the final concentration of the specific probe is 0.1 to 2.0 mM.

10. A method for detecting fungi for purposes other than disease diagnosis and treatment, characterized in that: Including testing samples based on any of the following: (I) A primer-probe combination according to any one of claims 1 to 4; (II), the fungus detection reagent as claimed in claim 6; and / or (III) The fungus detection kit according to claim 8 or 9.

Images