Gene associated with boll setting number of cotton and application

Abstract

The invention discloses a gene associated with the boll setting number of cotton and application. The cDNA (complementary deoxyribonucleic acid) sequence of the gene evm.model.D06.3155 associated with the cotton boll number character is as shown in SEQ ID NO. 1, and the genome sequence of the gene evm.model.D06.3155 associated with the cotton boll number character is as shown in SEQ ID NO. 2. The gene evm.model.D06.3155 is regulated and controlled by an adjacent SV site, a 300bp basic group is inserted into the SV site, and after mutation, the boll number of cotton is obviously smaller than that of a wild type. The gene has important research value and application prospect in efficient identification of cotton varieties with multiple bolls and improvement and breeding of excellent cotton varieties.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology application, and relates to genes associated with cotton boll number and applications. Background Art

[0002] Cotton is one of the world's most important cash crops and an important raw material for the textile industry. It plays an irreplaceable role in agriculture, industry and economic development. The number of bolls is one of the main components of cotton yield, and increasing the number of bolls is an effective way to increase cotton yield. Therefore, it is of great significance to breed excellent cotton varieties by exploring and utilizing excellent genetic variations related to the number of bolls.

[0003] Structural variation (SV), including insertions, deletions, inversions and translocations, is one of the main sources of genomic variation and has been shown to play an increasingly important role in plant evolution, domestication and breeding (Zhang et al., 2024). Genome-Wide Association Studies (GWAS) can link phenotypes to their underlying genetics within the genome of a population (Yasir et al., 2022). It is a powerful tool for revealing the association between genetic variation and phenotypic traits. It has been widely used to identify complex shapes and potential natural variations in crops (Gupta et al., 2014), and is often used to mine genes related to important agronomic traits such as yield, disease resistance, and stress tolerance. With the in-depth study of gene mining, molecular breeding, and the development of sequencing technology, researchers have gradually realized that there are many limitations to relying solely on SNP markers. Enhancing the application of SV will help to more comprehensively clarify the genetic basis of the target phenotype. At present, SV-based GWAS analysis has been widely used in species such as cucumber, peach, tomato, corn, and cotton. In 2015, Zhang et al. pioneered GWAS analysis of nodulation fruit and pistil traits in 115 cucumber samples using SVs with MAF>0.05, and detected a large segment duplication controlling reproductive morphological traits, providing important resources for exploring genes for key cucumber traits and promoting breeding (Zhang et al., 2015). Guo et al. (2020) mapped more than 200,000 structural variations by deep sequencing 336 peach individuals, and identified candidate genes associated with 26 agronomic traits using SV-GWAS. Among them, a 9bp insertion in the Prupe.4G186800 gene encoding the NAC transcription factor was associated with early fruit maturity, and a 487bp deletion in the PpMYB10.1 promoter was associated with the color of the flesh around the core. In addition, a 1.67Mb inversion was highly correlated with fruit shape, and the PpOFP1 gene near the inversion breakpoint regulated the formation of a flat shape. Li et al. (2023) integrated the S. galapagense linear reference genome sequence and 112 tomato genome SV information to genotype SVs in 321 tomato populations, and conducted SV-based GWAS analysis on 32 flavor-related compounds and 362 fruit metabolites, and detected significant correlation signals in 17 flavor volatiles and 249 fruit metabolites. Yang et al. (2019) identified 80,614 polymorphic pSVs in 521 different lines, of which about 22% of the variations were not detectable by traditional SNP detection methods.Then, SNP-GWAS and SV-GWAS were used to analyze the oil content and fatty acid content traits respectively. The results showed that a new significantly correlated region on chromosome 4 was discovered through SV-GWAS, and a gene Zm00015a017119 was found in this candidate region. This gene encodes enoyl-acyl carrier protein reductase (ENR), which catalyzes the last enzymatic step in the fatty acid elongation cycle. Jin et al. (2023) used the assembled genomes of 11 polyploid cottons to identify a total of 182,593 non-redundant structural variations (SVs) and constructed a pan-genome based on SV. Through SV-GWAS, some SVs related to yield and fiber quality improvement were identified, which were not identified in the SNP-based GWAS. At the same time, a 9-base insertion or deletion was found to be associated with the elimination of interspecific reproductive isolation between upland cotton and sea island cotton. The above research shows that compared with traditional SNP-GWAS, SV-GWAS can discover important genetic variation sites that have not been discovered before, which is an important supplement. It can provide richer and more valuable genetic resources for crop genetic improvement and accelerate the breeding process. Summary of the invention

[0004] The purpose of the present invention is to provide a gene associated with the number of cotton bolls and its application in view of the shortcomings of the prior art. The gene is identified by resequencing of the YM8 variety population and whole genome association analysis based on SV, and the gene contains a nucleotide binding domain (NB-ARC). The results of the whole genome association analysis based on SV show that the gene is closely associated with the number of cotton bolls.

[0005] The purpose of the present invention can be achieved through the following technical solutions:

[0006] The cDNA sequence of the cotton gene evm.model.D06.3155 in tetraploid YM8 is: SEQ ID NO.1, and the genomic sequence is: SEQ ID NO.2. The genomic sequence is forward transcribed. The gene is regulated by the adjacent SV site, and the SV site inserts 300bp bases. The number of cotton bolls after mutation is significantly less than that of the wild type.

[0007] The application of the cotton gene evm.model.D06.3155 described in the present invention in identifying upland cotton varieties with a high boll number.

[0008] Application of reagents for detecting SV loci in identifying cotton with many boll numbers. The population is divided into two haplotypes according to the SV genotype in the variety population. The SV sequence of cotton materials with many boll numbers is A; the SV of cotton materials with few boll numbers is shown in SEQ ID NO.7: ATGTAAGACAACACCTATGGAATGGA AATATGCAATTGAGATGTTGAAACAATCAACATTACCAAAAATGAAAATTGAGGTATTTCCACTTTTGAAATTCAGCTATGATAATTTGCCTAATGCAACAATGAAATGTTGCCTCCTATATTGTTGTCTCATCGAGATGATTATCGTATTCCCAGAGAAAGGAATTAGTGGAGCATTGGTTTTGTGAAGGGTTGTTGAATGAATTTGATAGATTTAGTGAGCTCAA. Therefore, the SV can be used as a marker for rapid identification of cotton varieties with many boll numbers, and the SV is located at the 1083 bp position of evm.model.D06.3155 (upland cotton genome D06: 64675001). The base at the 1083bp position of the evm.model.D06.3155 gene in the upland cotton plants was detected. The cotton plant with A at the 1083bp position was a cotton plant with a large number of bolls. Otherwise, the cotton plant with the base at the 1083bp position as shown in SEQ ID NO.7: ATGTAAGACAACACCTATGGA ATGGAAATATGCAATTGAGATGTTGAAACAATCAACATTACCAAAAATGAAAAATGAGGTATTTCCACTTTTGAAATTCAGCTATGATAATTTGCCTAATGCAACAATGAAATGTTGCCTCCTATATTGTTGTCTCATCGAGATGATTATCGTATTCCCAGAGAAAGGAATTAGTGGAGCATTGGTTTTGTGAAGGGTTGTTGAATGAATTTGATAGATTTAGTGAGCTCAA was a cotton plant with a small number of bolls.

[0009] In addition, the reagent for detecting the SV site includes a primer pair: the upstream primer is shown as SEQ ID NO.5, and the downstream primer is shown as SEQ ID NO.6.

[0010] Application of evm.model.D06.3155 gene in improving cotton boll number.

[0011] Application of evm.model.D06.3155 gene in breeding new varieties with high boll numbers through genetic engineering.

[0012] The beneficial effects of the present invention are as follows:

[0013] (1) The genome of allotetraploid cotton is relatively complex. SV-based whole-genome association analysis can more deeply reveal the association between complex genetic traits and genomic variation. Based on the high-quality upland cotton genome sequence, the present invention uses population genome resequencing and SV-based whole-genome association analysis technology to successfully identify genes closely related to cotton boll number. This technology has a relatively in-depth and extensive research foundation in crops such as corn.

[0014] (2) The gene is evm.model.D06.3155. The evm.model.D06.3155 gene of the present invention is significantly correlated with the boll number in the SV-based whole-genome association analysis.

[0015] (3) The cDNA and genomic sequences of the evm.model.D06.3155 gene were obtained by PCR technology, which has the advantages of high specificity, high sensitivity, rapidity, simplicity, and high repeatability, and can ensure the accuracy of the sequence.

[0016] (4) The present invention uses PCR technology to verify the SV genotype of the evm.model.D06.3155 gene in the populations of varieties with relatively high and low boll numbers, which is rapid, simple, accurate and reliable.

[0017] (5) According to the different SV genotypes of the evm.model.D06.3155 gene, the variety population can be divided into two categories, and there are significant differences in the number of bolls between the two groups. This result further confirms the close association between the evm.model.D06.3155 gene and the number of bolls in cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The results of the association analysis between cotton boll number and whole genome sequencing data and the sequence information of the evm.model.D06.3155 gene in Xinjiang in 2022. Among them, (A) is the result of the GWAS association analysis of cotton boll number traits. The horizontal axis represents the chromosome, and the vertical axis represents the significance of the SV locus association. -log 10 (P value) indicates that there is a significant correlation between the SV locus at chromosome D06 and the cotton boll number trait. (B) is the position of the SV locus on the chromosome, the horizontal axis indicates the position on the chromosome (Mb), and the vertical axis indicates the significance of the SV locus association, expressed as -log 10(P value) indicates. (C) indicates the sequence information of evm.model.D06.3155 gene, in which a 300 bp insertion occurs in the exon of the gene, and the SV site base changes from A to that shown in SEQ ID NO.7.

[0019] Figure 2 This is a comparative analysis of the boll number between different haplotypes of the evm.model.D06.3155 gene. The box plot represents the distribution of the number of bolls in the variety population. SV- and evm.model.D06.3155 SV+ The two haplotypes are 228 and 59. The gray box plot (left) represents the haplotype evm.model.D06.3155 SV- The trait distribution of the white box plot (right) represents the haplotype evm.model.D06.3155 SV+ The horizontal line in the box represents the median of the trait distribution. **** indicates a difference at the 0.0001 level. DETAILED DESCRIPTION

[0020] Example 1: Mining of evm.model.D06.3155 gene associated with cotton boll number and obtaining of evm.model.D06.3155 gene:

[0021] In 2022, a detailed survey of cotton boll number traits was conducted in Xinjiang for 370 modern cotton varieties or lines. At the same time, the whole genome of these 370 cotton varieties was resequenced with an average sequencing depth of 20X. These sequences were aligned to the genome sequence of the cotton upland genetic standard line TM-1 (V2.1), and the whole genome structural variation (SV) was identified using GATK software. The whole genome association analysis with the phenotype was performed using EMMAX software. By setting P < 10 -5 Screening SV-associated signal loci identified a locus (D06:64675001) that was significantly associated with cotton boll number ( Figure 1 ). The SV is located in the exon of the candidate gene evm.model.D06.3155 in the LD block region, causing gene structural variation. Its cDNA sequence and genomic sequence are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0022] Evm.model.D06.3155 was obtained from the genome sequence, and a pair of full-length primers were designed based on the two ends of its cDNA sequence (Table 1), such as the cDNA amplification upstream primer F1 shown in SEQ ID NO.3 and the cDNA amplification downstream primer R1 shown in SEQ ID NO.4, for subsequent PCR amplification. The PCR reaction procedure is as follows: 95℃ pre-denaturation for 3min; 95℃ denaturation for 15sec, 57℃ annealing for 15sec, 72℃ extension for 45sec, 34 cycles; and finally 72℃ extension for 5min. The PCR amplification product was sequenced and compared with the cDNA sequence to determine the accuracy of the sequence. Through the above steps, the evm.model.D06.3155 gene was obtained.

[0023] Table 1 PCR amplification primer sequences

[0024]

[0025] Example 2: Application of evm.model.D06.3155 gene in identifying high-boll number cotton:

[0026] The evm.model.D06.3155 sequence has SV sites with non-synonymous mutations in the population, such as Figure 1 As shown, at the 1083bp position in the genome sequence, the base changes from A to

[0027]

[0028] Based on the position of the SV site on chromosome D06 (D06:64675001), amplification primers were designed at both ends (Table 2), such as the SV detection upstream primer F2 shown in SEQ ID NO.5 and the SV detection downstream primer R2 shown in SEQ ID NO.6, for PCR amplification and sequencing. The PCR reaction procedure was as follows: pre-denaturation at 98°C for 3 min; denaturation at 95°C for 15 sec, annealing at 57°C for 15 sec, extension at 72°C for 30 sec, 34 cycles; and finally extension at 72°C for 5 min.

[0029] Table 2 PCR amplification primer sequences

[0030]

[0031] According to the base information and sequencing results of the SV locus (D06:64675001), the genotypes of each variety population at the SV locus were analyzed, and 228 materials with haplotype evm.model.D06.3155 (A) and haplotype evm.model.D06.3155 (A) were identified.

[0032]

[0033] Materials 59 ( Figure 2 and Table 3). Combining the GWAS association results and phenotypic survey data, the variety material with a high boll number haplotype was marked as evm.model.D06.3155 SV- , the variety material with few boll number haplotype is marked as evm.model.D06.3155 SV+ ( Figure 2 SV- represents the number of bolls, and SV+ represents the number of bolls.

[0034] At the same time, the correlation between the number of cotton bolls between the two haplotypes was calculated using the t-test method. Figure 2 ). The results show that compared with evm.model.D06.3155 SV- (A), haplotype evm.model.D06.3155 SV+

[0035]

[0036] The boll number was reduced by 7.09%, which was significantly negatively correlated with the boll number trait (P<0.0001).

[0037] In summary, the above results all indicate that the evm.model.D06.3155 gene has important research value in improving the number of bolls in cotton and breeding new cotton varieties. First, the development of molecular markers based on the two different haplotypes of the evm.model.D06.3155 gene can be used to accurately identify the boll number trait of cotton, which has extremely high practical value for breeding cotton varieties. Secondly, in the process of breeding cotton varieties with high boll numbers, genetic engineering methods can be used to directly introduce genes containing high boll number evm.model.D06.3155 (A) into cotton varieties to increase their boll numbers. At the same time, the haplotype evm.model.D06.3155 with low boll numbers can also be used.

[0038]

[0039] The SV loci in the strain are mutated and transformed into a haplotype with a high boll number, which helps in the breeding of new cotton varieties in two aspects.

[0040] Table 3 Distribution of haplotypes with high and low boll numbers in population varieties

[0041]

[0042]

[0043] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the present invention.

Claims

1. An application of cotton gene evm.model.D06.3155 in identifying cotton with high boll number, characterized in that: The nucleotide sequence of the cotton gene is shown in SEQ ID NO.

2.

2. Use of a reagent for detecting SV loci in identifying high-boll cotton, characterized in that: The SV site is located at the 1083 bp position of the cotton gene evm.model.D06.3155, and the nucleotide sequence of the cotton gene evm.model.D06.3155 is shown in SEQ ID NO.2; The application is specifically as follows: using a reagent for detecting SV sites to detect the nucleotide sequence at the 1083 bp position, wherein the cotton plant with a base of A at the 1083 bp position is a cotton plant with a high number of bolls, and the cotton plant with a sequence as shown in SEQ ID NO.7 at the 1083 bp position is a cotton plant with a low number of bolls.

3. The use according to claim 2, characterized in that: The reagent for detecting the SV site includes a primer pair: the upstream primer is shown as SEQ ID NO.5, and the downstream primer is shown as SEQ ID NO.6.

Images