CD47 and M2 type macrophage affinity peptide as well as preparation and application thereof

Abstract

The invention belongs to the field of biological medicines, and particularly relates to affinity peptides targeting CD47 and M2 type macrophages. The amino acid sequence of the CD47 affinity peptide is shown as SEQ ID NO: 1, and the amino acid sequence of the M2 type macrophage targeting peptide is shown as SEQ ID NO: 2. The invention also relates to preparation and application of the protein. The preparation comprises the following steps: forming a dual-targeting peptide and a transmembrane fusion protein; the molecules are expressed and synthesized by using nucleic acid molecules, and particularly a polypeptide expression and nano delivery system based on an engineered cell membrane is designed. The molecule provided by the invention can be compatible with CD47 and M2 type macrophage affinity peptide, and after a nano-carrier is designed to be combined with an STING agonist, M2 type macrophages are reprogrammed, so that the anti-tumor immune response is further enhanced.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a polypeptide targeting tumor cells and / or M2 macrophages, an expression system, and a preparation and application thereof. Technical Background

[0002] Tumor immunotherapy kills tumor cells by activating the immune system. Significant progress has been made in recent years, including strategies such as immune checkpoint inhibitors, CAR-T cell therapy, tumor vaccines, and immune enhancers. These methods have shown good results in a variety of cancers by enhancing the anti-tumor ability of the immune system.

[0003] Tumor-associated macrophages (TAMs) are an important component of the tumor microenvironment and can be divided into pro-inflammatory M1 and anti-inflammatory M2 macrophages. M1 macrophages phagocytose tumor cells by secreting antimicrobial molecules and pro-inflammatory cytokines, while M2 macrophages promote the occurrence, development, and distal metastasis of tumors through a variety of mechanisms. Among the strategies for regulating TAMs, inhibiting macrophage recruitment and promoting macrophage apoptosis can effectively inhibit tumor growth, but stopping drug administration will promote the increase in the number of M2 macrophages, tumor angiogenesis, and accelerate the death of tumor-bearing mice. Studies have shown that blocking the CD47 / SIRPα interaction and reprogramming M2 macrophages to regulate TAMs can enhance the anti-tumor effect and show good prospects.

[0004] Activating the cGAS-STING signaling pathway in tumor cells upregulates type I IFN or other inflammatory genes, thereby hindering the occurrence and development of early tumors. The anti-tumor effect of STING agonists has been confirmed, but their shortcomings such as lack of targeting, poor cell membrane permeability, low bioavailability, and high toxicity have not yet been resolved. Metal-organic frameworks (MOFs) provide an ideal platform for drug delivery research due to their ultra-high specific surface area, porosity, and flexible modifiable properties, especially for the efficient adsorption and delivery of STING agonists.

[0005] The applicant has conducted extensive research on affinity peptides targeting CD47 and M2 macrophages. It may be possible to recombinant the above-mentioned peptides and construct a drug delivery system that also carries a STING agonist to exert a synergistic anti-tumor effect. The engineered cell membrane has broad application prospects and can be used to construct a vector to deliver related drugs. However, building a reliable system requires a lot of exploration. For example, the tandem polypeptide expression system requires continuous optimization of its base sequence using recombinant DNA and gene editing technology, and it is necessary to select appropriate expression vectors and host cells to facilitate the screening of host cells containing the expression vector and the correct expression of the polypeptide. At the same time, sufficient in vitro cell experiments and in vivo animal model experiments should be conducted to study the drug delivery effect. Summary of the invention

[0006] In view of this, the applicant invented affinity peptides targeting CD47 and M2 macrophages, and provided a polypeptide expression system that can be expressed on a variety of cell membranes to prepare engineered cell membranes, while targeting CD47-positive tumor cells and M2 macrophages. The present invention optimizes the polypeptide coupling sequence by design, translates the amino acid sequence of the polypeptide into a base sequence according to the genetic codon preference, and optimizes the base sequence in a targeted manner, so that it can be expressed on the desired cell membrane through plasmid transfection; the present invention also provides a drug delivery system that carries a STING agonist.

[0007] Specifically, the present invention includes the following aspects: In the first aspect, the present invention screened affinity peptides with affinity to CD47. The previous study of the present invention screened polypeptide blockers of high-throughput phage display library for CD47, and identified affinity peptides through in vitro affinity experiments and blocking experiments.

[0008] The amino acid sequence of the CD47 affinity peptide used in the present invention is shown in SEQ ID NO: 1. The configuration of each amino acid of the CD47 peptide may be L-type or the amino acid sequence of the head fragment of the peptide is aWSATWSNYWRh, aWSATWSNYWrh, awsATWSNYwrh or aWSATWSNYwrh, for example, the peptide is aWSATWSNYwrhPLG; in the art, lowercase letters represent that the corresponding amino acid is D-type, and unless otherwise specified, the configuration of each amino acid in this patent is L-type (although glycine is not divided into D and L types, this patent also arbitrarily defines glycine as D-type or L-type to make the description of each amino acid configuration concise).

[0009] The peptides selected by the present invention can significantly improve the phagocytosis and clearance of tumor cells by macrophages, effectively inhibit tumor growth, and enhance CD8 + T cell-mediated anti-tumor response.

[0010] In a second aspect, the present invention screens targeting peptides that target M2 macrophages. Preferably, the amino acid sequence of the peptide segment used is as shown in SEQ ID NO:2.

[0011] In a third aspect, the present invention provides a dual-targeting peptide connected to the above-mentioned peptide segments, wherein the N-terminal fragment is the CD47 affinity peptide of the first aspect, and the C-terminal is fused with the M2 macrophage targeting peptide of the second aspect, that is, the CD47 affinity peptide and the M2 macrophage targeting peptide are fused, and the CD47 affinity peptide is set as the head sequence of the dual-targeting peptide. Fusion in this field means that the activity of the connected active peptide (here, the CD47 affinity peptide) is not affected.

[0012] An example of the dual targeting peptide is that the C-terminus of the CD47 affinity peptide is directly connected to the N-terminus of the M2 macrophage targeting peptide by forming a peptide bond, that is, the amino acid sequence is AWSATWSNYWRHPLGLAG YEQDPWGVKWWY (1-6 amino acids of the head fragment can be D-type). The dual targeting peptide can be cleaved by matrix metalloproteinases in tumor tissues and cut into two peptide segments, whose sequences are SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The two split derivative peptides can still play a targeting role, respectively targeting CD47 positive tumor cells (the affinity peptide of sequence 1 plays a role) and M2 macrophages (the peptide of sequence 2 plays a role).

[0013] In the fourth aspect, in order to use a biological membrane to carry the peptide described in any of the previous aspects, the present invention provides a transmembrane fusion protein formed by a membrane protein carrying the peptide described in any of the previous aspects. The membrane protein may be an extrinsic membrane protein, an intrinsic membrane protein or a lipid-anchored protein, or a functional transmembrane region and intracellular region fragment thereof, such as a transmembrane region and intracellular region fragment of the Gi24 protein. The Gi24 protein, i.e., the platelet receptor, is also known as B7-H5 and stress-induced secretory protein-1 (Sisp-1). The Gi24 transmembrane region and intracellular region fragment used in the present invention may be a transmembrane and intracellular protein composed of 36 amino acids, and the sequence may be as shown in SEQ ID NO:3. The encoded base sequence may be 108 bp in length, and the sequence may be as shown in SEQ ID NO:6. Specifically, it may be derived from the pEGFP-N1-PD1 vector of Wang Shengdian's laboratory, Institute of Biophysics, Chinese Academy of Sciences.

[0014] The membrane protein can be coupled to the peptide via a flexible linker, which in the art refers to a linker that does not affect the activity of the coupled peptide, and is usually a peptide, such as (GGGS)nC, (GGGGS)n, (GGSC)n or (GGG)n, where n=1-10.

[0015] Optionally, a His tag is provided at the tail of the transmembrane fusion protein for detecting whether the polypeptide expression system is successfully expressed, preferably 10 His amino acids, and preferably the encoding base sequence is CACCATCACCACCATCATCACCACCATCAC.

[0016] Optionally, the N segment of the peptide in any of the previous aspects of the transmembrane fusion protein is also provided with a signal peptide to guide the membrane localization of the core peptide of the present invention, and the two can be directly fused without a linker, and the signal peptide can be a Murine IL-2 signal peptide, and its amino acid sequence can be MYSMQLASCVTLTLVLLVNS, and preferably its base sequence is ATGTACAGCATGCAGCTCGCATCCTGTGTCACATTGACACTTGTGCTCCTTGTCAACAGC.

[0017] In the fifth aspect, the present invention provides a nucleic acid molecule containing a sequence encoding a molecule described in any of the previous aspects, such as SEQ ID NO: 4 encoding a CD47 affinity peptide, SEQ ID NO: 5 encoding an M2 macrophage targeting peptide, SEQ ID NO: 6 encoding the transmembrane region and intracellular region of Gi24, the gene sequence GGGGGTGGAGGCTCT encoding a linker, the gene sequence CACCATCACCACCATCATCACCACCATCAC encoding a His tag, and the gene sequence ATGTACAGCATGCAGCTCGCATCCTGTGTCACATTGACACTTGTGCTCCTTGTCAACAGC encoding a signal peptide.

[0018] In a sixth aspect, the present invention provides a plasmid vector of the above nucleic acid molecule. To construct the plasmid vector of the present invention, a KozaK sequence and a stop codon TAA can be connected in series at the 5' end of the CD47 affinity peptide encoding gene and the 3' end of the M2 macrophage targeting peptide encoding gene, respectively. For the convenience of connection, Xho I and EcoR can be connected in series at the 5' end of the CD47 affinity peptide encoding gene and the 3' end of the M2 macrophage targeting peptide encoding gene. I restriction enzyme cutting site, to obtain the base tandem sequence required for constructing the plasmid vector, specifically: CTCGAG-GCCACC-ATGTACAGCATGCAGCTCGCATCCTGTGTCACATTGACACTTGTGCTCCTTGTCAACAGC-GCCTGGTCAGCAACTTGGAGCAATTACTGGAGGCACCCCTTGGGACTCGCCGGCTACGAGCAGGACCCCTGGGGAGTCAAATGGTGGTAC-GGGGGTGGAGGCTCT-GATCCCATCAGGGCTGCAGCCCTGGCTACGGGTGCCTGCATCGTAGGAATCCTCTGCCTCCCCCTCATCCTGCTCCTGGTCTACAAGCAAAGGCAGGCAGCAGATCCACACCATCACCACCATCATCACCACCATCAC-TAA-GAATTC; the plasmid backbone can be pLVX- puro .

[0019] Preferably, the base tandem sequence and pLVX-puro The plasmid was double-digested and connected to obtain a polypeptide expression plasmid vector.

[0020] In the seventh aspect, the present invention provides a method for preparing the peptide described in any of the previous aspects, or the transmembrane fusion protein described in the fourth aspect, comprising using any of the nucleic acid molecules described in the fifth aspect or the plasmid vector or base tandem sequence described in the sixth aspect to express amino acids, and / or perform solid phase synthesis.

[0021] In an eighth aspect, the present invention provides a drug-carrying nanocarrier, comprising a biological membrane carrying the peptide described in any of the previous aspects or the transmembrane fusion protein described in the fourth aspect. If it is an engineered cell membrane, the cell membrane can be derived from M1 macrophages. As an example, the present invention transfects the plasmid into RAW264.7 cells, i.e., mouse mononuclear macrophages, through lentiviral packaging. After successful polypeptide expression is detected by confocal, flow cytometry and western blot, it is treated with 50 ng / mL IFN-γ and 100 ng / mL LPS for 24 h to induce it to become M1 macrophages. The cell membrane is extracted using a cell membrane extraction kit to obtain an engineered M1 macrophage membrane (abbreviated as PMM) expressing the dual-targeting peptide described in the present invention.

[0022] The engineered cell membrane constructed by the present invention highly expresses the dual-targeting peptide of the present invention. After entering the tumor tissue, the dual-targeting peptide is cleaved by matrix metalloproteinase 2, releasing the CD47 targeting peptide, actively targeting the highly expressed CD47 on the tumor cells and blocking the CD47 / SIRPα pathway, thereby restoring the phagocytic function of macrophages; at the same time, the M2 macrophage targeting peptide is exposed and specifically targets the M2 macrophages.

[0023] In the embodiment, the present invention constructs a nanocarrier using engineered M1 macrophage membrane.

[0024] Preferably, the drug-carrying nanocarrier of the present invention is also provided with a delivery material for a second active molecule, and a MOF metal organic framework, such as a ZrMOF metal organic framework, can be selected; the delivery material can be wrapped by a biofilm.

[0025] In a ninth aspect, the present invention provides a drug delivery system using the above-mentioned nanocarrier, which is loaded with a second active molecule STING agonist, such as 2', 3'-cGAMP, which is recorded as ZrMOF / C when loaded by the ZrMOF metal organic framework.

[0026] Preferably, the present invention constructs a nanocarrier using a metal organic framework (ZrMOF / C) loaded with a STING agonist and an engineered cell membrane (PPM), specifically involving co-extrusion of PMM and ZrMOF / C to prepare an engineered M1 macrophage membrane-wrapped nanocarrier (ZrMOF / C@PMM).

[0027] In a tenth aspect, the present invention provides a pharmaceutical composition or kit comprising the molecule described in any of the previous aspects.

[0028] In another aspect, the present invention discloses the use of the molecule for at least one of the following purposes: 1) Affinity with CD47 molecules highly expressed by tumor cells, which is an important anti-phagocytic signal molecule, thereby targeting and blocking the CD47 / Sirpα pathway; 2) Targeting CD47 molecules in vivo and in vitro to enhance the immune response induced by antigens, including combined treatment with other drugs and radiotherapy techniques; 3) Used to target M2 macrophages in tumor tissues; 4) Used for delivering various antigens in vivo and in vitro; 5) Used for in vitro and in vivo delivery of various drugs, such as the combined therapy of STING agonists demonstrated in the present invention, to exert synergistic therapeutic effects.

[0029] 6) Used for anti-tumor, including solid tumors, such as breast tumors, colorectal tumors, etc.; 7) Treatment of autoimmune diseases; Beneficial effects of the present invention: The present invention designs a polypeptide expression system, and the dual-targeting peptides expressed by the system specifically target tumor cells and M2 macrophages. The system expresses high-affinity dual-targeting peptides on engineered cell membranes, which are cut after entering the tumor tissue to obtain derivative peptides, and the derivative peptides can successfully block the CD47 / SIRPα pathway and release the signal that inhibits the phagocytic function of macrophages. At the same time, the nanocarrier is designed to combine with the STING agonist, and the phagocytosis of the nanocarrier by M2 macrophages is mediated through the targeting effect of the M2pep derivative peptide, activating the STING signaling pathway, and coordinating with the engineered M1 macrophage membrane to reprogram M2 macrophages, further enhancing the anti-tumor immune response, and can be combined with radiotherapy to produce a synergistic therapeutic effect. The present invention has high targeting, stability and biosafety, can significantly enhance the effect of tumor immunotherapy, is particularly suitable for the treatment of a variety of solid tumors, and has a wide range of clinical application potential, and is expected to provide more accurate and effective treatment options for tumor patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 is a schematic diagram of a polypeptide expression system, in which the signal peptide is the aforementioned Murine IL-2 fragment, G4S is the linker GGGGS, the transmembrane region and the intracellular region sequence are shown in SEQ ID NO: 3, and the histidine tag is 10 His amino acids; Figure 2 This is an example of the results of the in vitro CD47 targeting experiment of PMM and its encapsulated nanocarriers in the 4T1 cell line; Figure 3 This is an example of the results of the in vitro CD47 targeting experiment of PMM and its encapsulated nanocarriers in the CT26 cell line; Figure 4 An example of the in vitro experimental results of PMM and its encapsulated nanocarriers activating STING signaling in M2 macrophages (IL-6); Figure 5 An example of the in vitro experimental results of PMM and its encapsulated nanocarriers reprogramming M2 macrophages (TNF-α); Figure 6 The results of the in vivo targeting experiment of PMM-encapsulated nanocarriers are shown; Figure 7 The figure shows the anti-tumor growth results of PMM and its encapsulated nanocarriers in the CT26 transplanted tumor model; Figure 8 The figure shows the anti-tumor metastasis results of PMM and its encapsulated nanocarriers in the 4T1 orthotopic lung metastasis model; The significance analysis symbols involved in each figure, * indicates P < 0.05, ** indicates P < 0.01, *** indicates P <0.001. DETAILED DESCRIPTION

[0031] The embodiments of the present invention will be described in detail below in conjunction with examples. However, the following examples are only used to illustrate the present invention and should not be construed to limit the scope of the present invention.

[0032] Unless otherwise specified, the reagents, biological materials, culture media and solutions used below are commonly used in the art, available to the public or commercially available.

[0033] 1. Construction and expression of dual-targeting peptide expression system: a) The sequence of the designed and optimized dual-targeting peptide is AWSATWSNYWRHPLGLAG YEQDPWGVKWWY; b) Translate the amino acid sequence of the polypeptide into a base sequence according to the genetic codon preference and optimize it, and design the polypeptide expression system such as Figure 1As shown in the figure, the signal peptide, transmembrane and intracellular regions, KozaK sequence, stop codon, Xho I and EcoR I restriction enzyme sites and other regulatory elements that are necessary for membrane protein expression are connected in series with or without the linker GGGGS. The specific DNA base sequence after connection is: CTCGAG-GCCACC-ATGTACAGCATGCAGCTCGCATCCTGTGTCACATTGACACTTGTGCTCCTTGTCAACAGC-GCCTGGTCAGCAACTTGGAGCAATTACTGGAGGCACCCCTTGGGACTCGCCGGCTACGAGCAGGACCCCTGGGGAGTCAAATGGTGGTAC-GGGGGTGGAGGCTCT-GATCCCATCAGGGCTGCAGCCCTGGCTACGGGTGCCTGCATCGTAGGAATCCTCTGCCTCCCCCTCATCCTGCTCCTGGTCTACAAGCAAAGGCAGGCAGCAGATCCACACCATCACCACCATCATCACCACCATCAC-TAA-GAATTC. I and EcoR I restriction enzyme double digestion cloning pLVX-puro Plasmid, obtain the target plasmid; c) The obtained target plasmid was packaged with lentivirus. The cell line used was the human kidney epithelial cell line HEK-293-T, and the auxiliary plasmid was psPAX2 Plasmids and pMD2.G Plasmids, for plasmid transfection for auxiliary purposes; d) Transfect the target plasmid packaged by lentivirus into RAW264.7 mouse monocyte macrophage cells; e) Confocal, flow cytometry and western blot were used to detect whether the peptide system was successfully expressed.

[0034] The experimental results showed that the polypeptide expression sequence was Figure 1 As shown, the plasmid was transfected into RAW264.7 cells and His 10 Tag, flow cytometry detection results, confocal and western blot results showed that the dual-targeting peptide was successfully expressed on the cell membrane, proving that this polypeptide expression system was successfully expressed.

[0035] 2. Nanocarrier construction: a) Treated with 50 ng / mL interferon-γ (IFN-γ) and 100 ng / mL lipopolysaccharide (LPS) for 24 h to induce the RAW264.7 cell line expressing the dual-targeting peptides in Experiment 1 above to become M1 macrophages, and the cell membrane of the obtained M1 macrophages loaded with dual-targeting peptides was extracted using a cell membrane extraction kit to obtain engineered M1 macrophage membranes (PMM); b) ZrOCl2, H2TCPP and benzoic acid (BA) were simultaneously dissolved in DMF to synthesize a metal organic framework (ZrMOF for short), and STING agonist 2', 3'-cGAMP was adsorbed on ZrMOF to obtain a metal organic framework loaded with STING agonist (ZrMOF / C for short). The encapsulation efficiency and drug loading of STING agonist 2', 3'-cGAMP were measured. High performance liquid chromatography (HPLC) results showed that ZrMOF had a high encapsulation efficiency for 2', 3'-cGAMP at mass ratios of 50:1, 100:1 and 200:1. The present invention comprehensively considered the relationship between the encapsulation efficiency and the drug loading, and finally selected a mass ratio of ZrMOF: 2', 3'-cGAMP = 50:1 for the preparation of nanocarriers.

[0036] c) PMM and ZrMOF / C were co-extruded to prepare engineered M1 macrophage membrane-wrapped nanocarriers (abbreviated as ZrMOF / C@PMM).

[0037] d) In order to better detect the targeting activity of the PMM engineered cell membrane constructed by the polypeptide expression system, the present invention also constructed experimental control groups compared to ZrMOF / C@PMM: only the drug-loaded nanocarrier wrapped by the original M1 macrophage membrane that was not engineered (not transferred into the dual targeting peptide expression system) (ZrMOF / C@RAW), and the ZrMOF nanocarrier wrapped by the engineered M1 macrophage membrane that was not loaded with STING agonist (ZrMOF@PMM).

[0038] d) Characterize the potential, particle size, stability, cell membrane integrity, matrix metalloproteinase MMP2 enzyme responsiveness, and morphology of the nanocarrier to ensure successful preparation of the nanocarrier.

[0039] The experimental results show that the hydrodynamic particle sizes of ZrMOF / C and ZrMOF / C@PMM are 190.6 ± 1.87 nm and 205.5 ± 1.46 nm, respectively, and the potentials are 16.34 ± 0.88 mV and -18.4 ± 0.2 mV, respectively. ZrMOF / C contains four elements: N, O, P, and Zr, indicating that ZrMOF successfully adsorbs 2', 3'-cGAMP. The SDS-PAGE gel results show that the protein bands of the cell lysate and the nanocarrier are the same, indicating that the integrity of the cell membrane protein can be maintained during the preparation of the nanocarrier. ZrMOF / C@PMM has a good response to the matrix metalloproteinase MMP2 enzyme, and its surface dual-targeting peptide can be cut by the MMP2 enzyme into two peptide segments, SEQID NO:1 and SEQ ID NO:2 (i.e., the two affinity peptides described in the present invention). Transmission electron microscopy results show that ZrMOF / C@PMM presents an obvious core-shell structure. ZrMOF / C@PMM can be stable in PBS (phosphate buffer, pH=7.2) for 4 days, while ZrMOF / C can only be stable for 2 days, indicating that cell membrane wrapping can increase the stability of the carrier. A series of characterizations show that ZrMOF / C@PMM was successfully constructed and can be used for subsequent activity verification.

[0040] 3. In vitro CD47 affinity assay: a) Mouse bone marrow cells were obtained and the cell density was adjusted to 1×10 6 cells / mL, add 20 ng / mL mouse macrophage colony-stimulating factor M-CSF; b) After 3 days, half of the medium was replaced, non-adherent cells were discarded, and the corresponding concentrations of the above cytokines were added. After 7 days of culture, it was used for experiments; c) 4×10 5 Mouse breast cancer cell line 4T1 and mouse colon cancer cell line CT26 were co-incubated with PBS or each group of fluorescently labeled nanocarriers for 30 mins, among which the PBS phosphate buffer treatment group served as the blank control group. After the co-incubation, the cells were collected and observed by flow cytometry and confocal microscopy.

[0041] Flow cytometry and confocal microscopy results showed that the fluorescence signals of the PMM-encapsulated treatment groups (including ZrMOF / C@PMM and ZrMOF@PMM) of the two tumor cells were significantly higher than those of the other treatment groups, indicating that the engineered cell membrane PMM can target the highly expressed CD47 on the tumor cell membrane through the externally exposed CD47 affinity peptide, block the tumor cell CD47 / SIRPα immune escape pathway, and restore the phagocytic function of macrophages. At the same time, it proves that the polypeptide expression system designed by the present invention is successfully expressed. The flow cytometry results show that the 4T1 cell line Figure 2 As shown, the CT26 cell line Figure 3 shown.

[0042] 4. In vitro M2 macrophage targeting and activity experiments: a) The above-mentioned macrophages expressing PMM were first incubated with matrix metalloproteinase MMP2 at 37°C for 3 h to cut off the CD47 affinity peptide, and then the cell membrane was used for nanocarrier preparation (although the affinity peptide was partially cut, for the sake of consistency, this experiment still referred to the final membrane-coated ZrMOF experimental group as ZrMOF / C@PMM and ZrMOF@PMM, as in other experiments in this article); 5×10 5 The M2 macrophages were co-incubated with 100 μg / mL of nanocarriers in each group (PBS and 2', 3'-cGAMP control groups were also set up) to detect the activity of each group.

[0043] b) qRT-PCR was used to detect the expression levels of interferon-β (IFN-β), interleukin-6 (IL-6), chemokine ligand 10 (CXCL10), interleukin-12 (IL-12), tumor necrosis factor α (TNF-α), inducible nitric oxide synthase (iNOS), and leukocyte differentiation antigen 86 (CD86) mRNA levels, and the activation of the STING signaling pathway and the reprogramming efficiency of M2 macrophages were analyzed.

[0044] The experimental results show: The results of qRT-PCR showed that IFN-β in the ZrMOF / C@PMM treatment group was upregulated by 11.9, 12.9 and 2.4 times compared with the ZrMOF / C, ZrMOF / C@RAW and 2', 3'-cGAMP groups, respectively. CXCL10 was upregulated by 38.1, 91.9 and 71.3 times, respectively. IL-6 was upregulated by 82.7, 114.8 and 140.6 times, respectively. The results show that ZrMOF / C@PMM can effectively target M2 macrophages and efficiently activate the STING signaling pathway in M2 macrophages. The result data of IL-6 is shown in the figure below. Figure 4 In addition, ZrMOF / C@PMM significantly upregulated the expression of TNF-α, iNOS, IL-12, and CD86 mRNA levels, indicating that ZrMOF / C@PMM can effectively target M2 macrophages and reprogram M2 macrophages into M1 macrophages. The result data of TNF-α is shown in the figure below. Figure 5 The above results also effectively prove that the dual targeting peptide of the present invention can be cleaved by matrix metalloproteinase MMP2 to expose the M2 targeting peptide, and the M2 targeting peptide involved in the present invention has high targeting efficiency.

[0045] 5. In vivo targeting experiments: a) 2×10 5CT26 cells were inoculated subcutaneously in mice and the tumors were grown to 80 mm 3 about; b) Fluorescent dye (DiR)-labeled nanocarriers were injected into mice via the tail vein. c) In vivo imaging of small animals collects fluorescence signals of tumor tissue at different time points to analyze the tumor targeting ability of the nanocarrier.

[0046] The experimental results are as follows Figure 6 As shown, compared with the RAW macrophage membrane that does not express the dual targeting peptides of the present invention, ZrMOF@PMM and ZrMOF / C@PMM can efficiently target tumor cells in vivo, and except for tumor tissue, there is no obvious difference in the distribution of other organs (heart, liver, spleen, lung, and kidney) in different treatment groups, indicating that the PMM engineered cell membrane expressing the polypeptides of the present invention can significantly improve the tumor targeting of the nanocarrier.

[0047] 6. In vivo antitumor activity assay a) CT26 xenograft tumor model: 2×10 5 CT26 was inoculated subcutaneously on the back of mice and the tumor volume of the mice grew to 50-100 mm. 3 The mice were randomly divided into groups according to their tumor volume. They were treated with 200 μg of nanocarriers on the day of grouping and once every 3 days for a total of 5 times. The tumor volume and weight of the mice were recorded, and the tumor growth curve of the mice was drawn.

[0048] b) 4T1 orthotopic lung metastasis model: 5×10 4 4T1 cells were inoculated into the fourth mammary pad of mice and the tumor volume of the mice grew to 50-100 mm. 3 The mice were randomly divided into groups according to their tumor volume. They were treated with 200 μg of nanocarriers on the day of grouping and once every 3 days for a total of 8 treatments. During this period, the tumor volume and weight of the mice were recorded, and the tumor growth curve of the mice was drawn. The mice were killed on the 33rd day of tumor bearing, and their lungs were taken to count the number of lung metastases.

[0049] The tumor tissues of the above two tumor models contain matrix metalloproteinase MMP2 enzyme, which meets the in vivo experimental conditions described in the present invention. The experimental results show that in the CT26 transplanted tumor model, there is no statistical difference in the tumor volume of mice in the 2', 3'-cGAMP treatment group and the PBS group. Both ZrMOF@PMM and ZrMOF / C@PMM significantly inhibit tumor growth, among which the treatment effect of ZrMOF / C@PMM is more significant. The tumor volume in the 4T1 model also showed the same results, and the result data of CT26 is shown in the figure below. Figure 7In addition, in the 4T1 orthotopic lung metastasis model, typical photos of mouse lung tissues treated with ZrMOF / C@PMM and other controls showed that the number of lung metastasis nodules in ZrMOF@PMM and ZrMOF / C@PMM was significantly reduced, and the reduction in the ZrMOF / C@PMM group was more obvious, indicating that ZrMOF / C@PMM can effectively inhibit the metastasis of 4T1 orthotopic lung cancer. The result data is shown in the figure below. Figure 8 As shown. The above results comprehensively illustrate that the simultaneous blocking of the CD47 / Sirpα pathway and activation of the STING signaling pathway described in the present invention have a synergistic therapeutic effect. In the above two tumor models, there was no significant difference in the body weight of mice in each group, blood routine and liver function indicators were all within the normal range, and HE staining showed that there was no obvious damage to the main organs, indicating that the nanocarrier did not show obvious toxicity in mice.

Claims

1. A CD47 affinity peptide, whose amino acid sequence is shown in SEQ ID NO: 1, wherein the configuration of each amino acid of the CD47 peptide is L-type or the amino acid sequence of the peptide head fragment is aWSATWSNYWRh, aWSATWSNYWrh, awsATWSNYwrh or aWSATWSNYwrh, and lowercase letters represent that the corresponding amino acid is D-type.

2. An M2 macrophage targeting peptide, whose amino acid sequence is shown in SEQ ID NO:

2.

3. A dual targeting peptide, wherein the N-terminal fragment is the CD47 affinity peptide of claim 1, and the C-terminal fragment is fused with the M2 macrophage targeting peptide of claim 2.

4. The dual targeting peptide according to claim 1, characterized in that: The C-terminus of the CD47 affinity peptide is directly connected to the N-terminus of the M2 macrophage targeting peptide by forming a peptide bond.

5. A transmembrane fusion protein formed by a membrane protein carrying the peptide according to any preceding claim, wherein the membrane protein can be coupled to the peptide via a flexible linker, the linker can be (GGGS)nC, (GGGGS)n, (GGSC)n or (GGG)n, wherein n=1-10.

6. The transmembrane fusion protein according to the preceding claim, characterized in that The membrane protein is a transmembrane region and an intracellular region fragment of the Gi24 protein, and the preferred sequence is shown in SEQ ID NO:

3.

7. The transmembrane fusion protein according to claim 5, characterized in that: The tail of the transmembrane fusion protein is provided with a Histag, preferably 10 His amino acids.

8. A nucleic acid molecule comprising a sequence encoding a molecule as claimed in any preceding claim.

9. A nucleic acid molecule as described in the preceding claim, comprising any fragment selected from SEQ ID NOs: 4-6.

10. A method for preparing a peptide as claimed in any preceding claim, comprising using a nucleic acid molecule as claimed in any preceding claim for polypeptide expression and / or solid phase synthesis.

Images