Nucleic acid extraction-free direct amplification method for detecting target gene mutation in cell genome
By eliminating the genomic DNA extraction step, PCR amplification is performed directly in the cell lysate, solving the problems of cumbersome steps, high costs and DNA loss in the existing technology, and simplifying operations, reducing costs and improving detection reliability Effect.
Patent Information
- Application Number
- CN202411646574.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-18
- Publication Date
- 2025-02-18
AI Technical Summary
The prior art requires the extraction of genomic DNA in detecting mutations of the cellular genome, which are cumbersome, costly and prone to DNA loss and breakage.
The method of direct amplification without nucleic acid extraction is adopted. The DNA extraction step is directly carried out by adding surfactant to the cell lysate and processing under appropriate heating conditions.
It simplifies the operation process, reduces costs, avoids DNA loss and breakage, and has good specificity, reliable and low cost.
Smart Images
Figure CN119464460A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biological detection, and particularly relates to a method for detecting target gene mutations in cell genomes by direct amplification without nucleic acid extraction. Background Art
[0002] When the PCR method is currently used to detect target gene mutations in the cell genome, the cell genome DNA is usually extracted first, and then PCR amplification is performed. During or after the amplification process, various probe technologies are used for detection.
[0003] Extracting genomic DNA from cells can separate and extract pure genomic DNA samples from complex cell samples, remove cell matrix interference, and improve the specificity and sensitivity of subsequent detection. There are currently a variety of genomic DNA extraction methods and corresponding commercial kits.
[0004] Although genomic DNA extraction can obtain pure nucleic acid samples, this step is cumbersome and increases costs. It also inevitably causes problems such as loss of nucleic acid samples and breakage of genomic DNA.
[0005] If the step of extracting cell genomic DNA can be eliminated, it is expected to simplify the operation, reduce costs, and avoid genomic DNA loss and genomic DNA fragmentation. Summary of the invention
[0006] In view of this, the purpose of the present invention is to provide a method for directly amplifying and detecting target gene mutations in a cell genome without nucleic acid extraction. The present invention can eliminate the step of extracting cell genome DNA, simplify the operation, reduce costs, and avoid genomic DNA loss and genomic DNA breakage. The detection results are specific, reliable, and low-cost.
[0007] In order to achieve the above object, the present invention provides the following technical solutions:
[0008] The present invention provides a method for detecting target gene mutations in a cell genome by direct amplification without nucleic acid extraction, comprising the following steps:
[0009] 1) Collect the cell sample to be tested and prepare a cell suspension of appropriate concentration;
[0010] 2) adding a surfactant to the cell suspension prepared in step 1) to lyse the cells;
[0011] 3) heating the cell lysate obtained in step 2);
[0012] 4) preparing a PCR reaction solution, adding a forward primer and a reverse primer of the target gene, adding a probe for the target gene and the cell lysate obtained in step 3), and performing a PCR amplification reaction;
[0013] 5) Determine whether the cells to be tested contain the target mutation based on the amplification curve.
[0014] Based on the above technical solution, further, the target gene mutation includes but is not limited to EFGR T790M mutation.
[0015] Based on the above technical solution, further, the cells described in step 1) include but are not limited to human lung adenocarcinoma H1975 cells and non-small cell lung cancer A549 cells.
[0016] Based on the above technical solution, further, the concentration of the cell suspension in step 1) is 5×10 5 ~5×10 7 / ml.
[0017] Based on the above technical solution, further, the surfactant described in step 2) is a non-ionic surfactant, including but not limited to Triton X-100, Nonidet P40 (ethylphenyl polyethylene glycol), Tween20 (Tween 20) or a combination of two or more thereof; the final concentration of the surfactant is 0.1wt%-2.0wt%, preferably 0.5wt%-1.0wt%.
[0018] Based on the above technical solution, further, the heating conditions in step 3) are: heating temperature 60-100°C, heating time 2-30 minutes, the higher the heating temperature, the shorter the heating time; preferably, the heating temperature is 80°C, and the heating time is 10 minutes.
[0019] Based on the above technical solution, further, the PCR amplification reagent added to the PCR reaction solution in step 4) is a blood direct amplification PCR mix; the blood direct amplification PCR mix includes but is not limited to BloodTaq DNA Polymerase (Biolabo), MightyAmp DNA Polymerase Ver.2 (Takara), Homo Blood PCR Mix, and BloodTaq HFDNA Polymerase.
[0020] Based on the above technical solution, further, in step 4), the forward primer (5'-3') of the target gene is: CGCCTGCTGGGCATCTG, and the reverse primer (5'-3') is: GTCTTTGTGTTCCCGGACATAGT.
[0021] Based on the above technical solution, further, the probe for the target gene in step 4) includes but is not limited to a molecular beacon or a scorpion probe, etc.; molecular beacons and scorpion probes have extremely high specificity and sensitivity.
[0022] Based on the above technical solution, further, the molecular beacon probe (5'-3') described in step 4) is: CCAGACTTGGAGCTGGTGGCGTGTCTGG, the 5' end is labeled with a FAM fluorescent group, and the 3' end is labeled with a quenching group Dabcyl.
[0023] Based on the above technical solution, further, the conditions of the PCR amplification reaction described in step 4) are: 95°C for 2 min; 95°C denaturation for 30 s, 62°C annealing and extension for 30 s, collecting fluorescence signals, 40 cycles; 98°C for 10 min.
[0024] Based on the above technical solution, further, in step 5), when the cells to be tested contain a target gene mutation, an amplification curve corresponding to the probe targeting the target gene mutation can be generated. Since molecular beacons and scorpion probes have extremely high specificity, it can be indicated that the target gene mutation is contained.
[0025] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:
[0026] The present invention provides a method for directly amplifying and detecting target gene mutations in a cell genome without nucleic acid extraction. The present invention can avoid the step of extracting cell genome DNA, simplify the operation, reduce the cost, and avoid the loss and breakage of genome DNA. The detection result has good specificity, reliability and low cost. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] In order to more clearly illustrate the embodiments of the present invention, the drawings related to the embodiments are briefly introduced below.
[0028] Figure 1 The fluorescence signal generated after the cell lysate without the heating step in Comparative Example 1 of the present invention is mixed with the TaqMan probe;
[0029] Figure 2 The signal after the cell lysate undergoing the heating step in Example 1 of the present invention is mixed with the TaqMan probe;
[0030] Figure 3 2.0% agarose gel electrophoresis diagram of the amplified product obtained by the PCR reaction system prepared with Pro Taq HS Probe Premix in Comparative Example 2 of the present invention;
[0031] Figure 4 2.0% agarose gel electrophoresis diagram of the amplified product obtained by the PCR reaction system prepared with MightyAmp DNA Polymerase Ver.2 in Example 2 of the present invention;
[0032] Figure 5 This is a graph of the PCR real-time fluorescence amplification curve in Example 3 of the present invention;
[0033] Figure 6 This is a fluorescence microscope image of the PCR reaction solution after the PCR amplification in Example 3 of the present invention is completed;
[0034] Figure 7 This is a 2.0% agarose gel electrophoresis diagram of the PCR reaction solution after the PCR amplification in Example 3 of the present invention;
[0035] Figure 8 This is a fluorescence microscope image of adding TaqMan probe to the PCR reaction system in Example 4 of the present invention;
[0036] Fig. 9 This is a fluorescence microscope image of adding a molecular beacon probe to the PCR reaction system in Example 4 of the present invention;
[0037] Fig.10 The real-time fluorescence amplification curve diagram of the PCR reaction system to which H1975 cell lysate and A549 cell lysate were added respectively in Example 5 of the present invention;
[0038] Fig.11 This is a 2.0% agarose gel electrophoresis diagram after the PCR reaction system to which H1975 cell lysate and A549 cell lysate were added respectively in Example 5 of the present invention was amplified. DETAILED DESCRIPTION
[0039] The present invention is described in detail below with reference to the embodiments, but the embodiments of the present invention are not limited thereto. Obviously, the embodiments described below are only partial embodiments of the present invention. For those skilled in the art, other similar embodiments obtained without creative labor all fall within the protection scope of the present invention.
[0040] Example 1
[0041] (1) Prepare a suspension of human lung adenocarcinoma H1975 cells at a concentration of 1×10 7 / ml.
[0042] (2) Take 20 μl of the H1975 cell suspension, add Triton X-100 to a final concentration of 1.0%, let stand for 5-10 minutes, heat at 80° C. for 10 minutes after the cells are lysed, then add the TaqMan probe targeting the target gene EFGR T790M mutation, mix well, and let stand at room temperature for 10 minutes;
[0043] The probe sequence for the target gene EFGR T790M mutation is:
[0044] TaqMan probe (5'-3'): ATGAGCTGCATGATGAG (SEQ ID NO: 4), the 5' end is labeled with a FAM fluorescent group, and the 3' end is labeled with a quencher group MGB.
[0045] Comparative Example 1
[0046] (1) Prepare a suspension of human lung adenocarcinoma H1975 cells at a concentration of 1×10 7 / ml.
[0047] (2) Take 20 μl of the H1975 cell suspension, add Triton X-100 to a final concentration of 1.0%, let stand for 5-10 minutes, and directly add the TaqMan probe targeting the target gene EFGR T790M mutation after the cells are lysed, mix well, and let stand at room temperature for 10 minutes;
[0048] The probe sequence for the target gene EFGR T790M mutation is:
[0049] TaqMan probe (5'-3'): ATGAGCTGCATGATGAG, the 5' end is labeled with a FAM fluorescent group, and the 3' end is labeled with a quencher group MGB.
[0050] The cell lysate that did not undergo the heating step (Comparative Example 1) was added with a TaqMan probe targeting the target gene EFGR T790M mutation, which produced a strong fluorescent signal. The results are shown in Figure 1 , 1-1 is a PCR tube; the cell lysate (Example 1) that has undergone the heating step, is added with a TaqMan probe for the target gene EFGR T790M mutation, and the fluorescence signal is very weak or almost absent, see Figure 2 , 2-1 is a PCR tube.
[0051] The possible reason for the above phenomenon is that after cell lysis, DNase is released in the cell, which hydrolyzes the TaqMan probe and generates a fluorescent signal; heating can inactivate DNase and avoid the generation of fluorescent signals. That is, the cell lysate needs to be heated first to prevent DNase from hydrolyzing the TaqMan probe and primers, thereby interfering with the PCR amplification process and the generation of the amplification curve.
[0052] Example 2
[0053] (1) Prepare a suspension of human lung adenocarcinoma H1975 cells at a concentration of 1×10 7 / ml.
[0054] (2) Take 20 μl of the H1975 cell suspension, add Triton X-100 to a final concentration of 1.0%, let stand for 5-10 minutes to obtain a cell lysate, and heat at 80° C. for 10 minutes after the cells are lysed.
[0055] (3) Prepare PCR reaction system: 10 μl of 2×MightyAmp Ver.2 Buffer, 0.5 μl of MightyAmp DNA Polymerase, 0.5 μl of 10 μM forward primer of the target gene, 0.5 μl of 10 μM reverse primer of the target gene (the length of the PCR target amplification product is 150 bp), 4 μl of the heated cell lysate, and add double distilled water to a total volume of 20 μl;
[0056] Among them, the primer sequence for the target gene EFGR is:
[0057] Forward primer (5'-3'): CGCCTGCTGGGCATCTG (SEQ ID NO: 1)
[0058] Reverse primer (5'-3'): GTCTTTGTGTTCCCGGACATAGT (SEQ ID NO: 2)
[0059] (4) PCR reaction conditions: 95°C for 2 min; denaturation at 95°C for 30 s, annealing and extension at 56°C for 30 s, 40 cycles; 98°C for 10 min.
[0060] Comparative Example 2
[0061] The operation process of Comparative Example 2 is the same as that of Example 2, except that the reaction PCR system is prepared: 10 μl of 2×Pro Taq HSProbe Premix (Acori Biotech), 0.5 μl of 10 μM target gene forward primer, 0.5 μl of 10 μM target gene reverse primer, 4 μl of the heated cell lysate, and double distilled water is added to make the total volume 20 μl.
[0062] Agarose gel electrophoresis results showed that the PCR reaction system prepared with Pro Taq HS Probe Premix had almost no or only a small amount of target amplification product, as shown in Figure 3 ; The PCR reaction system prepared with MightyAmp DNA Polymerase Ver.2 produced an amplification product of the expected size, as shown in Figure 4 That is, only by using blood direct amplification PCR mix can the genomic DNA in the cell lysate be successfully amplified directly.
[0063] Example 3
[0064] According to the experimental results obtained in Example 1 and Example 2, PCR amplification was performed to detect the EFGR gene T790M mutation in human lung adenocarcinoma H1975 cells. The specific steps are as follows:
[0065] (1) Prepare a suspension of human lung adenocarcinoma H1975 cells at a concentration of 2×10 7 ml.
[0066] (2) Take 20 μl of the H1975 cell suspension, add Triton X-100 to a final concentration of 1.0%, let stand for 5-10 minutes, and then heat at 80° C. for 10 minutes.
[0067] (3) Prepare PCR reaction system: 10 μl of 2×MightyAmpVer.2Buffer, 0.5 μl of MightyAmp DNA Polymerase, 0.5 μl of 10 μM target gene forward primer, 0.5 μl of 10 μM target gene reverse primer, 1.0 μl of 5 μM TaqMan probe targeting target gene EFGR T790M mutation, 4 μl of the heated cell lysate, and make up the total volume to 20 μl with double distilled water.
[0068] Among them, the primer sequence for the target gene EFGR T790M mutation is:
[0069] Forward primer (5'-3'): CGCCTGCTGGGCATCTG
[0070] Reverse primer (5'-3'): GTCTTTGTGTTCCCGGACATAGT
[0071] TaqMan probe (5'-3'): ATGAGCTGCATGATGAG, the 5' end is labeled with a FAM fluorescent group, and the 3' end is labeled with a quencher group MGB.
[0072] (4) PCR reaction conditions: 95°C for 2 min; denaturation at 95°C for 30 s, annealing and extension at 56°C for 30 s, collecting fluorescence signals, 40 cycles; 98°C for 10 min.
[0073] No real-time fluorescence amplification curve was obtained, see Figure 5 ; Observe the PCR reaction solution after thermal cycling under a fluorescence microscope. The fluorescence signal is very strong. Figure 66-1 is the PCR tube. The PCR reaction solution after thermal cycling was analyzed by 2% agarose gel electrophoresis, and an amplification product with the expected size (150 bp) was found. The results are shown in Figure 7 , that is, there is an amplification product but no real-time fluorescence amplification curve.
[0074] In view of the fact that the PCR reaction solution that has completed PCR amplification has a strong fluorescent signal, it is speculated that the possible reason for the above phenomenon is that some component in the PCR mix can make the fluorescent group and the quenching group of the TaqMan probe separate in space, thereby emitting fluorescence.
[0075] Example 4
[0076] Prepare the PCR reaction system: 10 μl of 2×MightyAmpVer.2Buffer, 0.5 μl of MightyAmp DNA Polymerase, 1.0 μl of 5 μM TaqMan probe targeting the target gene EFGR T790M mutation, 1.0% Triton X-100 at a final concentration of 1.0%, and make up the total volume to 20 μl with double distilled water.
[0077] Prepare the PCR reaction system: 2×MightyAmpVer.2Buffer 10μl, MightyAmp DNA Polymerase 0.5μl, 5μM molecular beacon probe targeting the target gene EFGR T790M mutation 1.0μl, TritonX-100 with a final concentration of 1.0%, and double distilled water to make up the total volume to 20μl.
[0078] Molecular beacon probe (5'-3'):
[0079] CCAGACTTGGAGCTGGTGGCGTGTCTGG (SEQ ID NO: 3), the 5' end is labeled with a FAM fluorescent group, and the 3' end is labeled with a quencher group Dabcyl.
[0080] The fluorescence signal of the PCR reaction system was observed using a fluorescence microscope.
[0081] The PCR reaction system with TaqMan probe emits a strong fluorescent signal. Figure 8 8-1 is a PCR tube; the PCR reaction system with the addition of the molecular beacon probe has almost no fluorescent signal, the results are shown in Fig. 9 , 9-1 is a PCR tube. That is, the TaqMan probe emits fluorescence under the action of PCR mix (or combined with Triton X-100, Nonidet P40); the molecular beacon probe does not emit fluorescence signal under the action of PCR mix (or combined with Triton X-100, Nonidet P40).
[0082] Example 5
[0083] This embodiment provides a method for detecting target gene mutations in a cell genome by direct amplification without nucleic acid extraction, comprising the following steps:
[0084] (1) Prepare a suspension of human lung adenocarcinoma H1975 cells at a concentration of 2×10 7 ml.
[0085] (2) Take 20 μl of the H1975 cell suspension, add Triton X-100 to a final concentration of 1.0%, let stand for 5-10 minutes, and heat at 80° C. for 10 minutes.
[0086] (3) Prepare PCR reaction system: 10 μl of 2×MightyAmp Ver.2 Buffer, 0.5 μl of MightyAmp DNA Polymerase, 0.5 μl of 10 μM target gene forward primer, 0.5 μl of 10 μM target gene reverse primer, 1.0 μl of 5 μM molecular beacon probe targeting target gene EFGR T790M mutation, 4 μl of heat-treated H1975 human lung adenocarcinoma cell lysate, and add double distilled water to a total volume of 20 μl.
[0087] Among them, the primers and molecular beacon probe sequences for the target gene EFGR T790M mutation are:
[0088] Forward primer (5'-3'): CGCCTGCTGGGCATCTG
[0089] Reverse primer (5'-3'): GTCTTTGTGTTCCCGGACATAGT
[0090] Molecular beacon probe (5'-3'):
[0091] CCAGACTTGGAGCTGGTGGCGTGTCTGG, the 5' end is labeled with a FAM fluorescent group, and the 3' end is labeled with a quencher group Dabcyl.
[0092] (4) PCR reaction conditions: 95°C for 2 min; denaturation at 95°C for 30 s, annealing and extension at 62°C for 30 s, collecting fluorescence signals, 40 cycles; 98°C for 10 min.
[0093] Comparative Example 3
[0094] (1) Prepare a suspension of human non-small cell lung cancer A549 cells (without EFGR gene T790M mutation) at a concentration of 2×10 7 ml.
[0095] (2) Take 20 μl of the A549 cell suspension, add Triton X-100 to a final concentration of 1.0%, let stand for 5-10 minutes, and heat at 80° C. for 10 minutes.
[0096] (3) Prepare the PCR reaction system: 10 μl of 2×MightyAmp Ver.2 Buffer, 0.5 μl of MightyAmp DNA Polymerase, 0.5 μl of 10 μM target gene forward primer, 0.5 μl of 10 μM target gene reverse primer, 1.0 μl of 5 μM molecular beacon probe targeting the target gene EFGR T790M mutation, 4 μl of heated A549 cell lysate, and add double distilled water to a total volume of 20 μl.
[0097] Among them, the primers and molecular beacon probe sequences for the target gene EFGR T790M mutation are:
[0098] Forward primer (5'-3'): CGCCTGCTGGGCATCTG
[0099] Reverse primer (5'-3'): GTCTTTGTGTTCCCGGACATAGT
[0100] Molecular beacon probe (5'-3'):
[0101] CCAGACTTGGAGCTGGTGGCGTGTCTGG, the 5' end is labeled with a FAM fluorescent group, and the 3' end is labeled with a quencher group Dabcyl.
[0102] (4) PCR reaction conditions: 95°C for 2 min; denaturation at 95°C for 30 s, annealing and extension at 62°C for 30 s, collecting fluorescence signals, 40 cycles; 98°C for 10 min.
[0103] The PCR amplification system with human lung adenocarcinoma H1975 cell lysate has a normal fluorescence amplification curve, while the PCR amplification system with A549 cell lysate has no fluorescence amplification curve. Fig.10 ; Among them, 10-1 corresponds to H1975 cells, and 10-2 corresponds to A549 cells. The PCR amplification products were analyzed by 2.0% agarose gel electrophoresis. The PCR amplification system with the addition of human lung adenocarcinoma H1975 cell lysate and the PCR amplification system with the addition of A549 cell lysate both produced amplification products of the expected size. The results are shown in Fig.11 ; Among them, 11-1 corresponds to H1975 cell lysate, and 11-2 corresponds to A549 cell lysate. The above results show that the molecular beacon probe can be used to detect and analyze target gene mutations.
[0104] The above is only a preferred embodiment of the present invention, and does not limit the patent scope of the present invention. After reading the above content of the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.
Claims
1. A method for detecting target gene mutations in cell genome by direct amplification without nucleic acid extraction, characterized in that: The steps include: 1) Collect the cells to be tested and prepare a cell suspension of appropriate concentration; 2) adding a surfactant to the cell suspension prepared in step 1) to lyse the cells; 3) heating the cell lysate obtained in step 2); 4) preparing a PCR reaction solution, adding a forward primer and a reverse primer of the target gene, adding a probe for the target gene and the cell lysate obtained in step 3), and performing a PCR amplification reaction; 5) Determine whether the cells to be tested contain the target mutation based on the amplification curve.
2. The method according to claim 1, characterized in that The target gene mutation includes but is not limited to EFGRT790M mutation; the cells include but are not limited to human lung adenocarcinoma H1975 cells and non-small cell lung cancer A549 cells.
3. The method according to claim 1, characterized in that The concentration of the cell suspension in step 1) is 5×10 5 ~5×10 7 / ml.
4. The method according to claim 1, characterized in that: The surfactant described in step 2) is a non-ionic surfactant, including but not limited to Triton X-100, Nonidet P40 (ethylphenyl polyethylene glycol), Tween 20, or a combination of two or more thereof; the final concentration of the surfactant is 0.1wt%-2.0wt%, preferably 0.5wt%-1.0wt%.
5. The method according to claim 1, characterized in that The heating conditions in step 3) are: heating temperature 60-100° C., heating time 2-30 minutes, preferably, the heating temperature is 80° C., and the heating time is 10 minutes.
6. The method according to claim 1, characterized in that The PCR amplification reagent added to the PCR reaction solution in step 4) is a blood direct amplification PCR mix; the blood direct amplification PCR mix includes but is not limited to BloodTaq DNA Polymerase, MightyAmp DNA Polymerase Ver.2, Homo Blood PCR Mix, and BloodTaq HF DNA Polymerase.
7. The method according to claim 1, characterized in that The forward primer (5'-3') of the target gene in step 4) is: CGCCTGCTGGGCATCTG, and the reverse primer (5'-3') is: GTCTTTGTGTTCCCGGACATAGT.
8. The method according to claim 1, characterized in that The probe targeting the target gene in step 4) includes but is not limited to a molecular beacon probe or a scorpion probe.
9. The method according to claim 8, characterized in that The molecular beacon probe (5'-3') described in step 4) is: CCAGACTTGGAGCTGGTGGCGTGTCTGG, the 5' end is labeled with a FAM fluorescent group, and the 3' end is labeled with a quenching group Dabcyl.
10. The method according to claim 1, characterized in that The conditions of the PCR amplification reaction described in step 4) are: 95°C for 2 min; denaturation at 95°C for 30 s, annealing and extension at 62°C for 30 s, collecting fluorescence signals, 40 cycles; 98°C for 10 min.