Kit for detecting helicobacter pylori in human excrement sample and application thereof

Abstract

The invention provides a kit for detecting helicobacter pylori in a human excrement sample. The kit is used for detecting the helicobacter pylori in the human excrement sample. The kit is composed of three detection reagents: a) a detection reagent for specifically detecting the helicobacter pylori 23S RNA gene of a human excrement sample; b) a detection reagent for specifically detecting the helicobacter pylori UreB gene of the human excrement sample; and c) a detection reagent for specifically detecting the human endogenous reference gene beta-actin of the human excrement sample. The detection kit is composed of a helicobacter pylori 23S RNA gene, a helicobacter pylori UreB gene and a human endogenous reference gene beta-actin, and the unique UreB gene in the helicobacter pylori can make up the influence of homologous conserved sequence errors in the 23S RNA gene in a targeted manner; the complementary synergistic effect of the two can improve the detection accuracy of helicobacter pylori in human tissue samples such as human excrement, saliva and gastric mucosa, and helicobacter pylori infection can be diagnosed more effectively.

Description

Technical Field

[0001] The invention belongs to the field of gene diagnosis, and specifically relates to a kit for detecting Helicobacter pylori in human feces samples by using fluorescent PCR technology and application thereof. Background Art

[0002] Helicobacter pylori (H.pylori, referred to as Hp) is a Gram-negative pathogen that colonizes the human stomach and duodenum. Helicobacter pylori is the main pathogenic factor of gastritis and peptic ulcer, and is closely related to the occurrence of functional dyspepsia, gastric mucosa-associated lymphoid tissue (MALT) lymphoma and gastric cancer. The World Health Organization's International Agency for Research on Cancer has classified it as a Class I carcinogen.

[0003] The diagnostic methods of Helicobacter pylori infection are divided into two categories according to whether the sampling is invasive or not: invasive detection methods and non-invasive detection methods. The former refers to the detection methods that rely on gastroscopy sampling, including histological testing (such as HE staining, Warthin-Starry silver staining, modified Giemsa staining, toluidine blue staining, acridine orange staining, immunohistochemical staining, etc.), bacterial culture, rapid urease test (RUT) and Helicobacter pylori nucleic acid detection. The latter includes serological (antibody) testing, fecal Helicobacter pylori antigen detection or gene detection and urea breath test (UBT).

[0004] Helicobacter pylori nucleic acid detection is a sensitive and specific method for diagnosing Helicobacter pylori infection. The bacterial ribosomal RNA (rRNA) gene is a relatively conservative gene in the bacterial evolution process. Conservative sequences are often selected for gene amplification at home and abroad to compare the differences between different species and for differential diagnosis of bacteria. Common rRNA genes include 16S rRNA gene and 23S rRNA gene.

[0005] Patent document CN103276099A discloses primers and kits for detecting Helicobacter pylori by fluorescent quantitative PCR. The method uses mRNA of a sample to be extracted from human saliva, and then cDNA is synthesized using the mRNA as a template. Primers and probes for specific amplification are designed based on the cDNA sequence of Helicobacter pylori in Genebank, and the primers and probes are used to perform fluorescent quantitative PCR reaction on cDNA.

[0006] Patent document CN116219039A discloses a primer-probe combination, composition, kit and detection method for Helicobacter pylori detection. The method is to extract nucleic acid from human fecal samples, and design a primer-probe combination or composition of 16SrRNA gene, 23SrRNA gene and GyrA gene for Helicobacter pylori detection.

[0007] Currently, in clinical practice, the 23S rRNA gene is commonly used for the detection of Helicobacter pylori in human fecal samples. However, the 23S rRNA gene is a conserved gene in bacterial evolution. Because there are highly homologous conserved sequences between different bacteria, the use of the 23S rRNA gene alone may lead to detection errors. The 23S rRNA gene alone may eventually lead to misdiagnosis. In order to improve the accuracy of Helicobacter pylori detection in human fecal samples, this scheme proposes a kit for detecting Helicobacter pylori in human fecal samples using fluorescent PCR technology combined with 23S rRNA gene, UreB gene and human internal standard gene β-actin and its application. Summary of the invention

[0008] The purpose of the present invention is to provide a diagnostic technology for detecting Helicobacter pylori in human fecal samples using fluorescent PCR technology with high accuracy, easy operation and high sensitivity.

[0009] A kit for detecting Helicobacter pylori in human feces samples using fluorescent PCR technology, wherein the kit is used for detecting Helicobacter pylori in human feces samples;

[0010] The kit consists of three detection reagents:

[0011] a) a detection reagent for specifically detecting the 23S RNA gene of Helicobacter pylori in human fecal samples;

[0012] b) a detection reagent for specifically detecting the UreB gene of Helicobacter pylori in human fecal samples;

[0013] c) A detection reagent for specifically detecting the human internal standard gene β-actin in human fecal samples.

[0014] Preferably, the detection reagent for specifically detecting the Helicobacter pylori 23S RNA gene in human feces samples comprises: a primer pair and a probe targeting the Helicobacter pylori 23S RNA gene.

[0015] Preferably, the primer pair and probe for specifically detecting the Helicobacter pylori 23S RNA gene are the upstream primer HS1-F shown in the nucleotide sequence SEQ ID NO.1, the downstream primer HS1-R shown in the nucleotide sequence SEQ ID NO.2, and the probe HS1-P shown in the nucleotide sequence SEQ ID NO.3.

[0016] Preferably, the detection reagent for specifically detecting the UreB gene of Helicobacter pylori in human stool samples comprises: a primer pair and a probe targeting the UreB gene of Helicobacter pylori.

[0017] Preferably, the primer pair and probe for specifically detecting the UreB gene of Helicobacter pylori are the upstream primer HU1-F shown in the nucleotide sequence SEQ ID NO.4, the downstream primer HU1-R shown in the nucleotide sequence SEQ ID NO.5, and the probe HU1-P shown in the nucleotide sequence SEQ ID NO.6.

[0018] Preferably, the detection reagent for specifically detecting the human internal standard gene β-actin in human feces samples includes: a primer pair and a probe for the human internal standard gene β-actin.

[0019] Preferably, the primer pair and probe for specifically detecting the human internal standard gene β-actin are the upstream primer HB1-F shown in the nucleotide sequence SEQ ID NO.7, the downstream primer HB1-R shown in the nucleotide sequence SEQ ID NO.8, and the probe HB1-P shown in the nucleotide sequence SEQ ID NO.9.

[0020] Preferably, the kit further comprises probes for the Helicobacter pylori 23S RNA gene in human fecal samples, the Helicobacter pylori UreB gene in human fecal samples, and the human internal standard gene β-actin in human fecal samples;

[0021] The probe for the Helicobacter pylori 23S RNA gene in human fecal samples includes a 5'-end fluorescent group FAM and a 3'-end quenching group BHQ1; the probe for the Helicobacter pylori UreB gene in human fecal samples includes a 5'-end fluorescent group JOE and a 3'-end quenching group BHQ1; the probe for the human internal standard gene β-actin in human fecal samples includes a 5'-end fluorescent group CY5 and a 3'-end quenching group BHQ2.

[0022] Preferably, the 5'-end fluorescent group includes but is not limited to FAM, HEX, JOE, ROX, TET, CY-3, and CY-5;

[0023] Furthermore, the fluorescent groups included in the probe targeting the Helicobacter pylori 23S RNA gene, the fluorescent groups included in the probe targeting the Helicobacter pylori UreB gene, and the fluorescent groups included in the probe targeting the human internal standard gene β-actin are different fluorescent groups.

[0024] Preferably, the 3'-end quenching group includes but is not limited to BHQ1, BHQ2, BHQ3, TAMRA, and DABCYL.

[0025] The present invention also provides an application of a kit for detecting Helicobacter pylori in human feces samples using fluorescent PCR technology, wherein the kit is used for diagnosing Helicobacter pylori infection in human feces, saliva, and gastric mucosa human tissue samples.

[0026] The beneficial effects of the present invention over the prior art are as follows: the present invention provides a detection reagent combination using the Helicobacter pylori 23S RNA gene, the Helicobacter pylori UreB gene and the human internal standard gene β-actin, combining the relatively conservative 23S rRNA gene in the bacterial evolution process and the biological characteristic gene UreB gene of Helicobacter pylori, the unique UreB gene in Helicobacter pylori can specifically compensate for the influence of the homologous conservative sequence error in the 23S rRNA gene, the complementary synergistic effect of the two can improve the accuracy of Helicobacter pylori detection, and at the same time, the addition of the human internal standard gene β-actin eliminates the quality error of sample extraction, which can better and more effectively diagnose Helicobacter pylori infection, and has great application prospects in the fields of biotechnology and medicine. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of the diagnostic ROC curve for each gene locus;

[0028] Figure 2 Amplification plot for carbon respiration positive samples;

[0029] Figure 3 Amplification plot for carbon respiration negative sample detection. DETAILED DESCRIPTION

[0030] The present invention is further described below in conjunction with embodiments and drawings.

[0031] The urease genes of Helicobacter pylori include: UreA, UreB and UreC. The proteins encoded by these genes are involved in the urea metabolism process, and urease activity is considered to be one of the biological characteristics of Helicobacter pylori. The urease gene is both a colonization factor and a virulence factor of Helicobacter pylori, and is relatively conserved among various strains. Its B subunit (UreB) is the preferred protective antigen for vaccine design due to its non-toxicity. In recent years, researchers have conducted more and more research on the B subunit of Hp urease. Whether it is the preparation of its monoclonal antibodies, the screening of immune adjuvants or the construction of vaccines, it shows that the UreB protein of Helicobacter pylori has potential application value.

[0032] The unique UreB gene in Helicobacter pylori can specifically compensate for the influence of homologous conservative sequence errors in the 23S rRNA gene. Therefore, the UreB gene, 23S rRNA gene and human internal standard gene β-actin are combined for diagnosis in the kit of the present invention. The specific design, testing, diagnosis and effectiveness test methods of the kit are as follows:

[0033] Example 1 Design of primers and probes

[0034] Designing specific primers and probes can make detection more accurate. In order to complete the present invention, the inventors consulted a large number of documents and compared the full sequences of 23S RNA genes and UreB genes of different strains of Helicobacter pylori in the NCBI Gene Bank database, and selected sequences with no high homology to other pathogenic microorganisms, and designed primers and probes for detecting 23S RNA genes and UreB genes.

[0035] The primers and probes used for the test are as follows:

[0036] The detection primers and probes for the 23S RNA gene of different strains of Helicobacter pylori are:

[0037] Primer HS1-F: TAAGCAGATGGTTTCAGGTTCTATT (SEQ ID NO. 1)

[0038] Primer HS1-R: CTACTCTTTGAGCGATAGCGAACA (SEQ ID NO. 2)

[0039] Probe HS1-P: FAM-CACTCCGCTCACTGCGGTTCTTT-BHQ1 (SEQ ID NO. 3)

[0040] The detection primers and probes for the UreB gene of different strains of Helicobacter pylori are:

[0041] Primer HU1-F: GTTCCGCCACCAATCATGGTTGT (SEQ ID NO. 4)

[0042] Primer HU1-R: GCTGGTGGTATTGACACACACAT (SEQ ID NO. 5)

[0043] Probe HU1-P: JOE-ACACCGCTTGCAAAAGCTGTA-BHQ1 (SEQ ID NO. 6)

[0044] The detection primers and probes for human β-actin gene are:

[0045] Primer HB1-F: GCTGTCTGGCGGCACCACCAT (SEQ ID NO. 7)

[0046] Primer HB1-R: AGGTCAGCTCAGGCAGGAAAGA (SEQ ID NO.8)

[0047] Probe HB1-P: CY5-TACCCTGGCATTGCCGACAGGA-BHQ2 (SEQ ID NO.9)

[0048] Example 2 Determination of PCR reaction system

[0049] After a large number of comparative optimization experiments, an optimized PCR amplification reaction system and conditions were determined.

[0050] Prepare the following reaction system:

[0051] Table 1 Preparation of reaction system

[0052] Components concentration Amount per person (ul) 2×Fast Probe Reaction Mix - 10 Helicobacter pylori 23S RNA gene primer F 10uM 0.6 Helicobacter pylori 23S RNA gene primer R 10uM 0.6 Helicobacter pylori 23S RNA gene probe P 10uM 0.3 Primer F for Helicobacter pylori UreB gene 10uM 0.6 Helicobacter pylori UreB gene primer R 10uM 0.6 Helicobacter pylori UreB gene probe P 10uM 0.3 Human internal standard gene β-actin primer F 10uM 0.6 Human internal standard gene β-actin primer R 10uM 0.6 Human internal standard gene β-actin probe P 10uM 0.3 template - 5.5

[0053] The PCR reaction procedure is as follows:

[0054] Stage 1: denaturation at 94°C for 5 min, 1 cycle;

[0055] The second stage: denaturation, 94°C, 10 s; annealing, 60°C, 15 s; extension, 72°C, 20 s; 45 cycles;

[0056] The third stage: 30°C, 1 min; 1 cycle;

[0057] Signal collection: In the second stage, fluorescence signals were collected at 60°C.

[0058] Example 3 Cross-reaction test

[0059] In order to verify the influence of common pathogenic microorganisms with potential cross-reaction in human fecal samples on the detection results of this kit, a cross-reaction test was performed. The pathogenic microorganisms tested for cross-reaction include: Escherichia coli, Campylobacter jejuni, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pneumoniae, Acinetobacter baumannii, Bacteroides fragilis, Bacillus subtilis, Enterobacter cloacae, Candida albicans, Enterococcus faecium, Klebsiella pneumoniae, Clostridium perfringens, Salmonella, Fusobacterium nucleatum subsp. nucleatum, Bifidobacterium breve, Lactococcus lactis, Helicobacter heilmannii.

[0060] The test results showed that except for Helicobacter pylori, there was no amplification of other intestinal microorganisms.

[0061] Example 4 Clinical sample detection

[0062] An application of a kit for detecting Helicobacter pylori in human fecal samples using fluorescent PCR technology, characterized in that the kit is used for diagnosing Helicobacter pylori infection.

[0063] This kit is used to detect Helicobacter pylori in human stool samples; the kit consists of three detection reagents:

[0064] a) a detection reagent for specifically detecting the 23S RNA gene of Helicobacter pylori in human fecal samples;

[0065] b) a detection reagent for specifically detecting the UreB gene of Helicobacter pylori in human fecal samples;

[0066] c) A detection reagent for specifically detecting the human internal standard gene β-actin in human fecal samples.

[0067] The experimental process is as follows:

[0068] 1. Extract RNA

[0069] Fecal samples were collected using a fecal DNA sample collection and preservation tube; total DNA was extracted using QIAamp DNAMini Kit (50) produced by QIGEN, catalog number: 51304.

[0070] Amplification and detection

[0071] The detection was performed using the genomic DNA qPCR detection kit "Fast Probe qPCR SuperMix" manufactured by our company.

[0072] 3. Test results

[0073] Result judgment:

[0074] Set the baseline for 3-15 cycles;

[0075] Positive quality control products: should have FAM, JOE, and CY5 amplification signals;

[0076] Negative quality control: There should be no FAM and JOE amplification signals, but there should be CY5 amplification signals;

[0077] Sample judgment:

[0078] If the amplification curve of the CY5 fluorescence signal is a smooth 'S' shape and the CY5 signal and Ct value are <40, the sample experimental results are credible;

[0079] If there is no CY5 signal, it indicates that the extraction quality of the added DNA sample is poor and the DNA sample needs to be re-extracted;

[0080] (5) Test data

[0081] 106 clinical samples collected from a hospital (including 42 carbon respiration UTB positive samples and 64 carbon respiration UTB negative samples) were tested. The amplification diagram of carbon respiration positive samples is shown in Figure 2 , the carbon respiration negative sample detection amplification diagram is shown in Figure 3 The test results of clinical samples are shown in Table 2.

[0082] Table 2 Summary of test results of 106 samples

[0083]

[0084]

[0085] The above test results show that: Figure 2 In the amplification diagram of carbon respiration positive samples, the 23S RNA gene, UreB gene and human internal standard gene β-actin were significantly amplified. Figure 3 In the carbon respiration negative sample detection amplification diagram, the 23S RNA gene and UreB gene of Helicobacter pylori were not amplified, and the human internal standard gene β-actin was significantly amplified, indicating that the kit can effectively detect Helicobacter pylori in human fecal samples. The scheme of the present invention combines the 23S rRNA gene that is relatively conservative in the bacterial evolution process with the UreB gene, a biological characteristic gene of Helicobacter pylori, and is a sensitive and efficient method for detecting Helicobacter pylori in human fecal samples.

[0086] Example 5 Diagnostic Efficacy of the Kit

[0087] According to the data of the kit for testing 106 clinical samples (including 42 carbon respiration UTB positive samples and 64 carbon respiration UTB negative samples) in Example 4, ROC curve statistical analysis was performed using GraphPad9.5 software, where the PCR test results without amplification signals were calculated according to the maximum amplification cycle number of the kit (Ct=45). The schematic diagram of the ROC curve for diagnosis of each gene locus is shown in Figure 1 The coordinates of the diagnostic ROC curves of each gene locus are shown in Table 3, and the statistical results of the detection data software of each gene locus are shown in Table 4.

[0088] Table 3 Reference values ​​of the coordinates of the diagnostic ROC curves of each gene locus

[0089]

[0090]

[0091] Table 4 Statistical results of the software for detecting data of each gene locus

[0092]

[0093]

[0094] For the target genes 23S RNA and UreB gene for diagnosing Helicobacter pylori (Hp) infection, when the sensitivity and specificity reach the maximum critical point, that is, the Youden index (sensitivity + specificity - 1) reaches the maximum, the corresponding Ct value is the positive reference value of each site. For the human β-actin internal standard gene, when the sensitivity is 100% and the specificity is close to 0, the corresponding Ct value is the positive reference value of the site.

[0095] Therefore, according to Figure 1 The ROC curves of each target gene site in Table 3, the reference value analysis results of each target gene site in Table 4, and the statistical results of the gene site detection data software in Table 4 determined the reference values ​​of each target gene site of this kit, see Table 5, and the reference value of the kit is set as shown in Table 6.

[0096] Table 5 Positive reference values ​​for each gene locus of the kit

[0097]

[0098] Table 6 Comprehensive diagnostic reference value setting for Hp 23S RNA gene, UreB gene, and human β-actin gene

[0099]

[0100]

[0101] As can be seen from Tables 5 and 6, the results of using human fecal samples to extract nucleic acid as a template for detection and comparison with clinical diagnosis show that when the Helicobacter pylori target gene 23S RNA gene in Table 5 is diagnosed alone, the 23S RNA gene Ct value ≤ 42.59 is positive;

[0102] When UreB gene is diagnosed alone, the UreB gene Ct value is ≤41.71 to be positive, and the above single diagnosis still has a certain misdiagnosis rate. When this kit diagnoses 23S RNA gene and UreB gene together, it must meet the 23S RNA gene Ct value ≤42.59 and the UreB gene Ct value ≤41.71 to be positive. The complementary synergy of the two can improve the accuracy of Helicobacter pylori detection and can be used comprehensively to diagnose Helicobacter pylori infection.

[0103] Example 7 Kit for detecting Helicobacter pylori in human feces samples using PCR fluorescent probe method

[0104] A kit is available, which includes:

[0105] (1) PCR amplification reaction solution system: 2×Fast Probe Reaction Mix, 10ul;

[0106] (2) Primer pair and probe for Hp 23S RNA gene amplification: 10uM primer pair for Hp 23S RNA gene amplification (SEQ ID NO.1, SEQ ID NO.2), 0.6ul each; 10uM probe for Hp 23S RNA gene detection (SEQ ID NO.3), 0.3ul;

[0107] (3) Hp UreB gene amplification primer pair and probe: 10uM Hp UreB gene amplification primer pair (SEQ ID NO.4, SEQ ID NO.5), 0.6ul each; 10uM Hp UreB gene detection probe (SEQ ID NO.6), 0.3ul;

[0108] (4) Amplification primer pair and probe of human β-actin internal standard gene: 10uM β-actin gene amplification primer pair (SEQ ID NO.7, SEQ ID NO.8), 0.6ul each; 10uM β-actin gene detection probe (SEQ ID NO.9), 0.3ul;

[0109] (5) Negative control: composed of human genomic DNA, Tris, and EDTA.

[0110] (6) Positive quality control: composed of inactivated Helicobacter pylori strain, human genomic DNA, Tris, and EDTA.

[0111] In summary, the technical solution provided by the present invention provides a detection reagent combination using the Helicobacter pylori 23S RNA gene, the Helicobacter pylori UreB gene and the human β-actin internal standard gene, which combines the 23S rRNA gene that is relatively conservative in the bacterial evolution process and the UreB gene, a relatively conservative biological characteristic gene of Helicobacter pylori, for the detection of Helicobacter pylori in human tissue samples such as human feces, saliva, and gastric mucosa, and is an effective technical means for diagnosing Helicobacter pylori infection.

[0112] In the technical solution provided by the present invention, by comparing the Ct values ​​of the Hp evolutionary conservative 23S rRNA gene, the Hp evolutionary relatively conservative biological characteristic gene UreB gene and the human β-actin gene detection with the comprehensive diagnostic reference value set by the kit, the diagnosis of Helicobacter pylori infection can be achieved, which has great application prospects in the fields of biotechnology and medicine. Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Under the enlightenment of the present invention, ordinary technicians in this field can make a variety of similar expressions without violating the purpose and claims of the present invention, and such changes all fall within the scope of protection of the present invention.

Claims

1. A kit for detecting Helicobacter pylori in human fecal samples using fluorescent PCR technology, characterized in that: The kit is used to detect Helicobacter pylori in human fecal samples; The kit consists of three detection reagents: A test reagent that specifically detects the 23S RNA gene of Helicobacter pylori in human fecal samples; A test reagent that specifically detects the UreB gene of Helicobacter pylori in human fecal samples; A detection reagent that specifically detects the human internal standard gene β-actin in human fecal samples.

2. The kit for detecting Helicobacter pylori in human fecal samples using fluorescent PCR technology according to claim 1, characterized in that: The detection reagent for specifically detecting the Helicobacter pylori 23S RNA gene in human feces samples comprises: a primer pair and a probe targeting the Helicobacter pylori 23S RNA gene.

3. The kit for detecting Helicobacter pylori in human fecal samples using fluorescent PCR technology as claimed in claim 2, characterized in that: The primer pair and probe for specifically detecting the Helicobacter pylori 23S RNA gene are the upstream primer HS1-F shown in the nucleotide sequence SEQ ID NO.1, the downstream primer HS1-R shown in the nucleotide sequence SEQ ID NO.2, and the probe HS1-P shown in the nucleotide sequence SEQ ID NO.

3.

4. The kit for detecting Helicobacter pylori in human fecal samples using fluorescent PCR technology according to claim 1, characterized in that: The detection reagent for specifically detecting the UreB gene of Helicobacter pylori in human feces samples comprises: a primer pair and a probe targeting the UreB gene of Helicobacter pylori.

5. The kit for detecting Helicobacter pylori in human feces samples using fluorescent PCR technology as claimed in claim 4, characterized in that: The primer pair and probe for specifically detecting the UreB gene of Helicobacter pylori are the upstream primer HU1-F shown in the nucleotide sequence SEQ ID NO.4, the downstream primer HU1-R shown in the nucleotide sequence SEQ ID NO.5, and the probe HU1-P shown in the nucleotide sequence SEQ ID NO.

6.

6. The kit for detecting Helicobacter pylori in human fecal samples using fluorescent PCR technology according to claim 1, characterized in that: The detection reagent for specifically detecting the human internal standard gene β-actin in a human feces sample comprises: a primer pair and a probe targeting the human internal standard gene β-actin.

7. The kit for detecting Helicobacter pylori in human fecal samples using fluorescent PCR technology according to claim 6, characterized in that: The primer pair and probe for specifically detecting the human internal standard gene β-actin are the upstream primer HB1-F shown in the nucleotide sequence SEQ ID NO.7, the downstream primer HB1-R shown in the nucleotide sequence SEQ ID NO.8, and the probe HB1-P shown in the nucleotide sequence SEQ ID NO.

9.

8. The kit for detecting Helicobacter pylori in human fecal samples using fluorescent PCR technology according to claim 1, characterized in that: The kit also includes probes for the Helicobacter pylori 23SRNA gene in human feces samples, the Helicobacter pylori UreB gene in human feces samples, and the human internal standard gene β-actin in human feces samples; The probe for the Helicobacter pylori 23S RNA gene in human fecal samples includes a 5'-end fluorescent group FAM and a 3'-end quenching group BHQ1; the probe for the Helicobacter pylori UreB gene in human fecal samples includes a 5'-end fluorescent group JOE and a 3'-end quenching group BHQ1; the probe for the human internal standard gene β-actin in human fecal samples includes a 5'-end fluorescent group CY5 and a 3'-end quenching group BHQ2.

9. The kit for detecting Helicobacter pylori in human feces samples using fluorescent PCR technology according to claim 8, characterized in that: The 5'-end fluorescent group includes but is not limited to FAM, HEX, JOE, ROX, TET, CY-3, and CY-5; The 3' end quenching group includes but is not limited to BHQ1, BHQ2, BHQ3, TAMRA, DABCYL; Furthermore, the fluorescent groups included in the probe targeting the Helicobacter pylori 23S RNA gene, the fluorescent groups included in the probe targeting the Helicobacter pylori UreB gene, and the fluorescent groups included in the probe targeting the human internal standard gene β-actin are different fluorescent groups.

10. Use of a kit for detecting Helicobacter pylori in human fecal samples using fluorescent PCR technology according to any one of claims 1 to 9, characterized in that: The kit is used for diagnosing Helicobacter pylori infection in human feces, saliva, and gastric mucosa human tissue samples.

Images