SNP (Single Nucleotide Polymorphism) molecular marker combination for identification of tremella aurantialba cultivation germplasm resources as well as construction method and application

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker combination for identifying tremella aurantialba cultivation germplasm resources as well as a construction method and application thereof, and belongs to the technical field of edible mushroom breeding and molecular markers. The SNP molecular marker for identifying the tremella aurantialba germplasm resource cultivation strain is composed of eight SNP molecular markers, and each molecular marker corresponds to one SNP site. Eight pairs of SNP primers are constructed on the basis of Hyper-seq high-throughput sequencing results, and a plurality of primer combinations can identify different strains and can be used for constructing fingerprints of tremella aurantialba. The SNP molecular marker combination is applied to identification of tremella auramtialba cultivation germplasm resources, has the advantages of high accuracy, good stability, simplicity in operation and the like, can improve the identification success rate of tremella auramtialba strains, and plays a positive role in tremella auramtialba molecular auxiliary breeding and strain protection.

Description

Technical Field

[0001] The present invention belongs to the technical field of edible fungus breeding and molecular markers, and specifically relates to a SNP molecular marker combination for identifying golden fungus cultivation germplasm resources, a construction method of the molecular marker combination, a PCR amplification primer pair combination of the SNP molecular marker combination for identifying golden fungus strains, and applications. Background Art

[0002] Naematelia aurantialba belongs to the phylum Basidiomycota, class Tremellomycetes, order Tremelloles, family Naemateliaceae, genus Naematelia. The fruiting body of Naematelia aurantialba is a heterogeneous complex formed by Naematelia aurantialba and Stereum hirsutum. It has a smooth taste, rich nutrition, and is rich in amino acids, dietary fiber, β-carotene, and vitamin B2. The biological characteristics of Naematelia aurantialba are relatively special. It is composed of two species, so the entire breeding system is relatively complex and difficult. Naematelia aurantialba has a long history of cultivation. In the cultivation process of Naematelia aurantialba, the mycelium produced after the separation of the fruiting body tissue will become an "invalid strain" and cannot produce Naematelia aurantialba fruiting bodies. Therefore, the concept of "effective strain" is generated in the breeding system of Naematelia aurantialba, that is, the strain system contains Naematelia aurantialba and Stereum hirsutum, which can be called an "effective strain". Golden ear fungus and hairy leather fungus complement each other and are indispensable to the growth and development of golden ear fruiting bodies. Therefore, the key to golden ear breeding lies in the diversity of golden ear fungus and hairy leather fungus. The diversity of the two can create the diversity of golden ear fruiting bodies and enable the healthy and sustainable development of the golden ear industry.

[0003] With the continuous development and growth of the golden ear industry, the number of golden ear strains has increased, and the market is in chaos. There are phenomena of strains with the same name but different names, and the same name but different objects. In addition, the current reports on the identification of golden ear strains do not clearly describe the golden ear fruiting bodies (including two species, golden ear fungus and hairy leather fungus), golden ear fungus (a single species, golden ear fungus), and hairy leather fungus (a single species, hairy leather fungus). The objects of their identification are unknown, which is not conducive to the subsequent breeding of golden ear. In order to carry out the subsequent genetic breeding of golden ear continuously and effectively, it is necessary to develop new and accurate identification methods for the golden ear strain system.

[0004] Traditional edible fungi classification and identification methods usually classify and identify from aspects such as morphology and growth characteristics, which is cumbersome to operate and has a long identification cycle. The morphology of the yeast-like spores of Auricularia auricula is relatively special, which is difficult to identify and observe from the traditional taxonomy, and the combined cultivation cycle with Auricularia auricula is also long. Therefore, it is necessary to develop an efficient and accurate technical means for the identification of Auricularia auricula varieties, which is of great significance for the identification of excellent Auricularia auricula varieties in my country and the protection of new varieties.

[0005] Molecular markers are a new type of genetic marker that has been developed after morphological markers, cytological markers and biochemical markers. They reflect a wide variety of genetic variations, are not easily affected by the environment, and the stability of DNA sequences makes molecular markers have good repeatability. As the latest generation of molecular markers, SNP (Single nucleotide polymorphism) molecular markers have the advantages of covering the entire genome, high throughput, site-specificity, co-dominant inheritance, low false positive rate, economy, high efficiency, and short detection cycle. At the same time, they can be scaled and automatically detected, and are an effective means to solve the problem of germplasm resource identification. At present, there are relatively few reports on the development of molecular markers for Auricularia auricularia, and there have been no reports on the development and application of SNP molecular markers for Auricularia auricularia.

[0006] Related references on golden ear can be found in:

[0007] [1 ] LIU XZ, WANG QM, GÖKER M, et al. Towards an integrated phylogenetic classification of the Tremellomycetes [J]. Studies in Mycology, 2015, 81: 85-147.

[0008] [2] Yang Linlei, Li Rongchun, Cao Yao, et al. Research on the scientific name and taxonomic status of Auricularia auricula[J]. Edible and Medicinal Fungi, 2020, 28(4): 252-255.

[0009] [3] Li Xi, Deng Lan, Zhou Ya, et al. Comparison of nutritional components of golden ear, white ear and black ear[J]. Food Research and Development, 2021, 42(16): 77-82.

[0010] [4] Zheng Shufang, Liu Ping. 1983. Preliminary report on artificial cultivation of Tremella fuciformis[J]. Edible Fungi Science and Technology, (1): 15-16.

[0011] [5] Hua Rong, Li Xuesong, Sun Dafeng, et al. A SSR molecular marker and method for identifying Tremella fuciformis ZJJE001 strain[P]. Yunnan Province: CN114517238B, 2023-06-27.

[0012] [6] Li Xuesong, Hua Rong, Sun Dafeng, et al. Two new strains of Auricularia auricula and their identification by SSR molecular markers[P]. Yunnan Province: CN115261236B, 2023-06-23.

[0013] [7] Li Rongchun, Yang Linlei. A SCAR marker for identifying Auricularia auriculariae X9 strain or Auricularia auriculariae strains containing X9 strain[P]. Yunnan Province: CN112626249A, 2021-04-09.

[0014] [8] Cao Yao, Li Rongchun, Yang Aixia, et al. A strain of Auricularia auricula JSJ-J2X1001W and its application and molecular marker identification method [P]. Yunnan Province: CN202410621435.1, 2024-08-13.

[0015] [9] Cao Yao, Li Rongchun, Shen Zhenhui, et al. A strain of Auricularia auricula JSJ-J2F1001C and its application and molecular marker identification method [P]. Yunnan Province: CN202410621436.6, 2024-07-19. Summary of the invention

[0016] The purpose of the present invention is to obtain more efficient and accurate technical means for identifying Golden ear fungus varieties, and to provide a SNP molecular marker combination for identifying Golden ear fungus cultivation germplasm resources, a construction method of the SNP molecular marker combination, a PCR amplification primer pair combination of the SNP molecular marker combination for Golden ear fungus strain identification, and the application of the PCR amplification primer pair combination in identifying Golden ear fungus cultivation strains and constructing a fingerprint map for identifying Golden ear cultivation strains.

[0017] The technical solution adopted by the present invention is as follows:

[0018] The SNP molecular marker combination for the identification of Auricularia auricularia strains is composed of 8 SNP molecular markers, each of which corresponds to a SNP site:

[0019] The first SNP molecular marker corresponds to the SNP site NaSNP1: contg1_2384247;

[0020] The second SNP molecular marker corresponds to the SNP site NaSNP2: contg10_809248;

[0021] The third SNP molecular marker corresponds to the SNP site NaSNP3: contg11_130440;

[0022] The fourth SNP molecular marker corresponds to the SNP site NaSNP4: contg11_132613;

[0023] The fifth SNP molecular marker corresponds to the SNP site NaSNP5: contg4_136462;

[0024] The sixth SNP molecular marker corresponds to the SNP site NaSNP6: contg5_137575;

[0025] The seventh SNP molecular marker corresponds to the SNP site NaSNP7: contg6_151486;

[0026] The 8th SNP molecular marker corresponds to the SNP site NaSNP8: contg12_13674.

[0027] The method for constructing a SNP molecular marker combination for identifying Auricularia auricularia strains of the present invention comprises the following steps:

[0028] 1) Screening four single-spore strains of Auricularia auriculariae with different mating factors, and extracting the total DNA of the four single-spore strains of Auricularia auriculariae using a fungal genomic DNA extraction kit;

[0029] 2) After the extracted total DNA of the Auricularia auricularia strain is sequenced by Hyper-seq high-throughput sequencing, the data is aligned to the Auricularia auricularia reference genome;

[0030] 3) SNP and InDel data statistics were performed on the four monospore strains to obtain variation identification results, and the eight different variation sites with the highest diversity were selected as SNP molecular marker combinations, which were used to identify the cultivated varieties of Auricularia auricula.

[0031] The PCR amplification primer pair combination of the SNP molecular marker combination for the identification of the Auricularia auricularia strain of the present invention comprises the following 8 pairs of primers:

[0032] NaSNP1-F: TGAACTGTTGGGAGAGGAG, sequence code is SEQ ID NO: 1,

[0033] NaSNP1-R: GGTCTGGTAATGGAGGTGAG, sequence code: SEQ ID NO: 2;

[0034] NaSNP2-F: GCACAGACTGGATGCTCAAA, sequence code is SEQ ID NO: 3,

[0035] NaSNP2-R: CGATTCCTTCGGTTCATTC, sequence code: SEQ ID NO: 4;

[0036] NaSNP3-F: ATCCCACGCATACTCACTG, sequence code: SEQ ID NO: 5,

[0037] NaSNP3-R: GTGCTGGACAAACGCATT, sequence code: SEQ ID NO: 6;

[0038] NaSNP4-F: AACCTTGTCTCGTTTCCCT, sequence code: SEQ ID NO: 7,

[0039] NaSNP4-R: ATCCGCTGTTCCGTTGTA, sequence code: SEQ ID NO: 8;

[0040] NaSNP5-F: TGTCTCTACCTCTACCTCTGCG, sequence code: SEQ ID NO: 9,

[0041] NaSNP5-R: TTGGCGTGTCAGTGGAAA, sequence code: SEQ ID NO: 10;

[0042] NaSNP6-F: ACAAGAGGTGAGTAGATGGGA, sequence code: SEQ ID NO: 11,

[0043] NaSNP6-R: CGAGCAAGCCAAGATGAT, sequence code: SEQ ID NO: 12;

[0044] NaSNP7-F: GTCTTTACAGTCGCACAGTTCT, sequence code: SEQ ID NO: 13,

[0045] NaSNP7-R: AACCTCAATGTTACCAACGG, sequence code: SEQ ID NO: 14;

[0046] NaSNP8-F: TGTCAGGAACTTATCCGACC, sequence code: SEQ ID NO: 15,

[0047] NaSNP8-R: CCCGTCTTCTTTGCCTTCT, sequence code: SEQ ID NO: 16.

[0048] The application of the PCR amplification primer pair combination of the present invention in identifying Tremella fuciformis cultivated strains comprises the following steps:

[0049] 1) Extract DNA from collected Auricularia auricularia using a fungal genomic DNA extraction kit;

[0050] 2) using the extracted DNA as a template, using the 8 pairs of primers NaSNP1F / R, NaSNP2F / R, NaSNP3F / R, NaSNP4F / R, NaSNP5F / R, NaSNP6F / R, NaSNP7F / R and NaSNP8F / R to perform PCR amplification respectively;

[0051] PCR amplification PCR reaction system 30μL, PCR Mix 15.3μL, ddH 2 O 11.1μL, upstream and downstream primers 1.2μL each, DNA template 1.2μL; PCR amplification program: 95℃ pre-denaturation for 4min, 94℃ denaturation for 30s, annealing temperatures of primer pairs NaSNP1F / R, NaSNP2F / R, NaSNP3F / R, NaSNP4F / R, NaSNP5F / R, NaSNP6F / R, NaSNP7F / R and NaSNP8F / R were 55℃, 55℃, 56℃, 56℃, 54℃, 55℃, 54℃, 54℃, annealing time 50s, 72℃ extension 50s, 35 cycles, 72℃ insulation for 10min, and storage at 4℃;

[0052] 3) After amplification, electrophoresis was performed on a 1% agarose gel to obtain specific bands and then sequenced. The sequencing results of each sample were statistically analyzed to obtain different genotypes, thereby identifying the cultivated strains of Tremella fuciformis.

[0053] The application of the PCR amplification primer pair combination of the present invention in constructing a fingerprint for identifying cultivated Tremella fuciformis strains comprises the following steps:

[0054] 1) constructing a fingerprint of the Auricularia auricularia strain according to the sites amplified by the 8 pairs of SNP marker primers; wherein 0 indicates that all SNP sites are genotype I, 1 indicates that two genotypes coexist and are named genotype III, and 2 indicates that all are genotype II;

[0055] 2) Perform genotypic statistical analysis on the collected golden ear strains to find out the SNP sites that are different from other strains of golden ear strains, which are used for strain variety identification.

[0056] The present invention has the following beneficial effects:

[0057] The present invention constructs 8 pairs of SNP primers based on the results of Hyper-seq high-throughput sequencing, and multiple primer combinations can identify different strains and can be used to construct a fingerprint of golden ear fungus. The SNP molecular marker combination of the present invention is applied to the identification of golden ear cultivation germplasm resources, has the advantages of high accuracy, good stability, simple operation, etc., can improve the identification success rate of golden ear fungus strains, and plays a positive role in the molecular assisted breeding and strain protection of golden ear fungus. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 It is the physical form of golden ear fruit;

[0059] Figure 2 It is the asexual spore form of Auricularia auriculariae.

[0060] Figure 3 The results of sequencing peak plots of the variant sites of primer NaSNP1 in 14 strains of Auricularia aurea are shown in the dashed box, and the SNP genotypes read in the peak plots are marked in black fonts;

[0061] Figure 4 The results of sequencing peak plots of the variant sites of primer NaSNP2 in 14 strains of Auricularia aurea are shown in the dashed box, and the SNP genotypes read in the peak plots are marked in black fonts;

[0062] Figure 5 The results of sequencing peak plots of the variant sites of primer NaSNP3 in 14 A. aureus strains are shown in the dashed box, and the SNP genotypes read in the peak plots are marked in black fonts;

[0063] Figure 6 The results of sequencing peak plots of the variant sites of primer NaSNP4 in 14 strains of Auricularia aurea are shown in the dashed box, and the SNP genotypes read in the peak plots are marked in black fonts;

[0064] Figure 7 The results of sequencing peak plots of the variant sites of primer NaSNP5 in 14 strains of Auricularia aurea are shown in the dashed box, and the SNP genotypes read in the peak plots are marked in black fonts;

[0065] Figure 8 The results of sequencing peak plots of the variant sites of primer NaSNP6 in 14 strains of Auricularia aurea are shown in the dashed box, and the SNP genotypes read in the peak plots are marked in black fonts;

[0066] Fig. 9 The results of sequencing peak plots of the variant sites of primer NaSNP7 in 14 Auricularia auricularia strains are shown in the dashed box, and the SNP genotypes read in the peak plots are marked in black fonts;

[0067] Fig.10The results of sequencing peak plots of the variant sites of primer NaSNP8 in 14 Auricularia auricularia strains are shown in the dashed box. The SNP genotypes read in the peak plots are marked in black font. DETAILED DESCRIPTION

[0068] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. Unless otherwise specified in the following embodiments, the technical means used are conventional means well known to those skilled in the art.

[0069] Test strains: JSJ-J2F1001C strain, the main cultivated variety of golden ear fungus produced by Yunnan Junshijie Biotechnology Co., Ltd. (the strain is deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration, with the deposit number of CGMCC No.41096 and the deposit date of January 25, 2024. Chinese patent application CN118207101A discloses the golden ear fungus strain JSJ-J2F1001C and its application and molecular marker identification method) and JSJ_JEGJ_X18 strain of hairy leather fungus (the strain is deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration, with the deposit number of CGMCC No.19659, with a deposit date of June 11, 2020. The strain information is disclosed in Chinese patent CN112592835A9) and after the combination cultivation (the cultivation bag formula is: 58.9% cottonseed hulls, 25% miscellaneous sawdust, 15% soybean meal, 1% gypsum, 0.1% potassium dihydrogen phosphate, and 65% water content), the offspring monospore strain was obtained by the single spore separation method. According to the results of the previous tests, the following four monospore strains with different mating factors were screened out: D13 (mating type is A2B1), D25 (mating type is A1B1), D40 (mating type is A1B2) and D47 (mating type is A2B2). Golden ear belongs to the quadripolar mating system, containing two unlinked A and B mating type loci. Its offspring monospores A2B1 and A1B2, A1B1 and A2B2 can grow golden ear fruiting bodies after hybridization with the combination of hairy leather fungus. As genome resequencing material. JSJ-J2F1001C strain is a strain obtained by multi-generation selection and domestication cultivation in the mushroom house of Yunnan Junshijie Biotechnology Co., Ltd. The other cultivated strains were collected from areas with a certain scale of cultivation across the country. At present, the scale of cultivation of golden ear is much smaller than that of other edible fungi, and the number of strains is relatively small. The cultivated golden ear strains listed in Table 1 can basically represent the overview of golden ear germplasm resources on the market, and these strains are used for the identification of SNP molecular markers.

[0070] 1) Clean the fruiting bodies of different cultivated strains of golden ear, wipe the surface of the fruiting bodies with 75% alcohol, rinse with sterile water and place them on a clean bench to dry. Figure 1 .

[0071] 2) Take 10 fruiting body tissue blocks and place them in 250 mL of liquid culture medium (liquid culture medium: 200g potato boiled juice filtered, 20g glucose, 1000mL water); culture at a speed of 150r / min and a temperature of 23℃ for 4-5 days; after the culture is completed, transfer 0.5mL to PDA culture medium (PDA formula: 200g potato, 20g glucose, 20g agar, 5g peptone, 3g potassium dihydrogen phosphate, 1.5g magnesium sulfate and 1000ml water), and after 4-5 days of culture, separate the asexual spores in the culture medium into new PDA culture medium and continue to culture for 4-5 days, and transfer the asexual spores to the new PDA culture medium again to obtain milky white asexual spores of Auricularia aurea. Typical asexual spores of Auricularia aurea can be seen. Figure 2 , used for subsequent DNA extraction.

[0072] Table 1 Information of Auricularia auricularia strains

[0073]

[0074] Example 1

[0075] The method for constructing a SNP molecular marker combination for identifying Auricularia auricularia strains comprises the following steps:

[0076] 1) DNA extraction: The DNA of four Auricularia australis monosporus strains was extracted using a fungal genomic DNA extraction kit (Shanghai Sangon Biotechnology Co., Ltd.), and the extracted DNA was stored in a 4°C refrigerator for later use.

[0077] 2) Development of polymorphic sites: The extracted sample DNA was treated with uniform concentration, and the DNA concentration of each sample was controlled at 150-200 ng / μL. Hyper-Seq library was constructed for 4 samples. After the test was qualified, high-throughput sequencing was performed on the Illumina NobaSeq 6000 platform, and then the raw data was quality controlled to obtain clean data, which was then compared to the genome of the Auricularia auricula strain (NX-20) currently uploaded to the NCBI (National Center for Biotechnology Information) database.

[0078] The results showed that the known size of the T. aurantifolia reference genome was approximately 21 Mb, and the alignment rates of the four monosporic strains (D25, D40, D13 and D47) samples to the NX-20 strain genome were between 88.02-93.97%, with a sequencing depth of 20X.

[0079] 3) Bioinformatics software was used to perform SNP and InDel data statistics on each sample. The results showed that the four monosporic strains obtained a large number of SNP and InDel variation sites, ranging from 58073 to 64618 and 9557 to 10107, respectively (see Table 2).

[0080] Table 2 Detection of SNP and InDel sites in the genome of different monospore strains of Auricularia auricularia

[0081]

[0082] Based on the results of variant identification, the di-allelic SNP sites with maf values ​​(minor allele frequency) greater than 0.05 and genotype missing rate of 0 were retained. Finally, 8 variant sites with high diversity distributed in different contigs were selected and used for the identification of golden ear cultivars. Detailed information is shown in Table 3.

[0083] Table 3 Information of 8 SNP loci

[0084]

[0085] Example 2

[0086] Design and synthesis of PCR amplification primers for SNP sites of SNP molecular marker combination used for identification of Auricularia auricularia strains.

[0087] Primer design was performed using prime5.0 software, requiring that each pair of primers be located at least 100 bp away from the polymorphic site, and that the product length be set between 590 and 1300 bp. A total of 8 pairs of SNP primers were designed, as shown in Table 4, and synthesized by Shanghai Sangon Biotechnology Co., Ltd. Each pair of SNP primers corresponds to a SNP site in Example 1 above.

[0088] Table 4 Information of 8 pairs of SNP marker primers

[0089]

[0090] Example 3

[0091] Screening of SNP primers and product detection for identification of Tremella fuciformis strains.

[0092] 1) DNA was extracted from the 14 strains of Auricularia auricularia listed in Table 1 using a fungal genomic DNA extraction kit (Shanghai Sangon Biotechnology Co., Ltd.);

[0093] 2) Using the genomic DNA of 14 Auricularia auriculariae strains as templates, 8 pairs of primers in Table 4 were used for amplification to obtain PCR amplification products. PCR reaction system (30 μL): PCR Mix 15.3 μL, ddH 2 O 11.1μL, upstream and downstream primers 1.2μL each, DNA template 1.2μL; PCR amplification program: 95℃ pre-denaturation for 4min, 94℃ denaturation for 30s, annealing temperature of each primer is shown in Table 4, annealing time 50s, 72℃ extension 50s, 35 cycles, 72℃ insulation for 10min, 4℃ storage.

[0094] 3) After amplification, the PCR product was detected by electrophoresis using 1% agarose gel. The results showed that the primer amplification band was clear and the fragment size was consistent with the target fragment size. The PCR product of the amplified target fragment was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The sequencing results of each sample were statistically analyzed to obtain different genotypes, and then the cultivated strains of Tremella fuciformis were identified.

[0095] The results showed that among the 14 strains, the primers at the NaSNP1 locus could amplify three genotypes, namely G, A and G / A types. The marker peaks are shown in Figure 3 Among them, the SNP1 sites of strains D25, D47, NL, YL, YR, XD, JD40, D13, ZY, JB, LL and SC were of G type, strains D40, D13, ZY, BJ were of A type, and strain JSJ-J2F1001C was of G / A type, as shown in Table 5; the primers at the NaSNP2 site can amplify three genotypes, namely G, C and C / G types, and the marker peak diagram is shown in Figure 4 Among them, the SNP2 loci of D13, D40, ZY and BJ strains are C type, JSJ-J2F1001C is C / G type, and other strains are G type, see Table 5; NaSNP3 locus primers can amplify three genotypes, namely T, A and T / A types, the marker peak diagram is shown in Figure 5 Among them, the SNP3 sites of D25, D47, ZY and BJ strains are T type, JSJ-J2F1001C is T / A type, and other strains are A type, see Table 5; NaSNP4 site primers can amplify three genotypes, namely C, T and C / T types, and the marker peak diagram is shown in Figure 6 Among them, the SNP4 loci of D25, D47, ZY and BJ strains are C type, JSJ-J2F1001C is C / T type, and the other strains are T type, see Table 5; the primers at the NaSNP5 locus can amplify three genotypes, namely G, A and G / A types, and the marker peak diagram is shown in Figure 7The SNP5 sites of D25, BJ and NL strains were of G type, JSJ-J2F1001C was of G / A type, and the other strains were of A type, as shown in Table 5; the primers at the NaSNP6 site could amplify two genotypes, namely T and G types, as shown in the marker peak diagram Figure 8 The SNP6 locus of strains D25, D47, ZY, BJ and JSJ-J2F1001C was T type, and the other strains were G type, see Table 5; the primers at the NaSNP7 locus could amplify three genotypes, namely A, C and A / C types, and the marker peak diagram is shown in Fig. 9 The SNP7 sites of D25, D47, ZY and BJ strains were of type A, JSJ-J2F1001C was of type A / C, and the other strains were of type C, as shown in Table 5; the primers at the NaSNP8 site could amplify three genotypes, namely C, T and C / T types, as shown in the marker peak diagram Fig.10 Among them, the SNP8 loci of D25, D47, ZY and BJ strains were of C type, JSJ-J2F1001C was of C / T type, and the other strains were of T type, see Table 5.

[0096] Table 5 Detection results of variant sites of 8 pairs of SNP marker primer amplification products

[0097]

[0098] Example 4

[0099] Construction of the fingerprint of Auricularia auricularia.

[0100] According to the sites amplified by 8 pairs of SNP marker primers, the fingerprints of 14 Auricularia auriculariae strains were constructed, as shown in Table 6. Among them, 0 means that all SNP sites are genotype I, and 1 means that two genotypes coexist (in Figure 3~Figure 10 genotype III is named in the peak graph of 2, and 2 indicates that all are genotype II. As can be seen from Table 6, except for the SNP6 site that is the same as other strains, the SNP markers at the remaining sites of the JSJ-J2F1001C strain can be distinguished from other strains and can be used for variety identification of the strain; YL, YR, XD, JB, LL and SC strains showed the same results in the 8 SNP sites, indicating that the golden ear strains in these areas may be derived from the same original strain, and there is a phenomenon of synonyms; ZY and BJ strains have high similarity, but there are still suitable sites for differentiation, which can be distinguished by SNP5 site; among the 4 monospore strains, D25 and D47 strains can be distinguished from other strains, and the fingerprints of D40 and D13 monospore strains are consistent, but can still be distinguished from other strains. In summary, in the analysis of the fingerprint map of 8 SNP sites, 14 strain samples can be identified as 8 different types of fingerprint maps, indicating that the screened SNP sites have good polymorphism and can be used for the identification of golden ear cultivation germplasm resources.

[0101] Table 6 Fingerprints of 14 Auricularia auricularia strains

[0102]

Claims

1. A SNP molecular marker combination for the identification of Auricularia auricularia strains, characterized in that: The SNP molecular marker consists of 8 SNP molecular markers, each of which corresponds to a SNP site: The first SNP molecular marker corresponds to the SNP site NaSNP1: contg1_2384247; The second SNP molecular marker corresponds to the SNP site NaSNP2: contg10_809248; The third SNP molecular marker corresponds to the SNP site NaSNP3: contg11_130440; The fourth SNP molecular marker corresponds to the SNP site NaSNP4: contg11_132613; The fifth SNP molecular marker corresponds to the SNP site NaSNP5: contg4_136462; The sixth SNP molecular marker corresponds to the SNP site NaSNP6: contg5_137575; The seventh SNP molecular marker corresponds to the SNP site NaSNP7: contg6_151486; The 8th SNP molecular marker corresponds to the SNP site NaSNP8: contg12_13674.

2. The method for constructing a combination of SNP molecular markers for identifying Auricularia auricularia strains according to claim 1, characterized in that: The following steps are involved: 1) Four single-spore strains of Auricularia auriculariae with different mating factors were screened, and the total DNA of the four single-spore strains was extracted using a fungal genomic DNA extraction kit; 2) After the extracted total DNA of the Auricularia auricularia strain is sequenced by Hyper-seq high-throughput sequencing, the data is aligned to the Auricularia auricularia reference genome; 3) SNP and InDel data statistics were performed on the four monospore strains to obtain variation identification results, and the eight different variation sites with the highest diversity were selected as SNP molecular marker combinations, which were used to identify the cultivated varieties of Auricularia auricula.

3. The PCR amplification primer pair combination of the SNP molecular marker combination for identifying the Auricularia auricularia strain according to claim 1, characterized in that: The PCR amplification primer pair combination includes the following 8 pairs of primers: NaSNP1-F: TGAACTGTTGGGAGAGGAG, sequence code is SEQ ID NO: 1, NaSNP1-R: GGTCTGGTAATGGAGGTGAG, sequence code: SEQ ID NO: 2; NaSNP2-F: GCACAGACTGGATGCTCAAA, sequence code is SEQ ID NO: 3, NaSNP2-R: CGATTCCTTCGGTTCATTC, sequence code: SEQ ID NO: 4; NaSNP3-F: ATCCCACGCATACTCACTG, sequence code: SEQ ID NO: 5, NaSNP3-R: GTGCTGGACAAACGCATT, sequence code: SEQ ID NO: 6; NaSNP4-F: AACCTTGTCTCGTTTCCCT, sequence code: SEQ ID NO: 7, NaSNP4-R: ATCCGCTGTTCCGTTGTA, sequence code: SEQ ID NO: 8; NaSNP5-F: TGTCTCTACCTCTACCTCTGCG, sequence code: SEQ ID NO: 9, NaSNP5-R: TTGGCGTGTCAGTGGAAA, sequence code: SEQ ID NO: 10; NaSNP6-F: ACAAGAGGTGAGTAGATGGGA, sequence code: SEQ ID NO: 11, NaSNP6-R: CGAGCAAGCCAAGATGAT, sequence code: SEQ ID NO: 12; NaSNP7-F: GTCTTTACAGTCGCACAGTTCT, sequence code: SEQ ID NO: 13, NaSNP7-R: AACCTCAATGTTACCAACGG, sequence code: SEQ ID NO: 14; NaSNP8-F: TGTCAGGAACTTATCCGACC, sequence code: SEQ ID NO: 15, NaSNP8-R: CCCGTCTTCTTTGCCTTCT, sequence code: SEQ ID NO:

16.

4. The use of the PCR amplification primer pair combination described in claim 3 in identifying Tremella fuciformis cultivated strains, characterized in that: The following steps are involved: 1) Extract DNA from collected Auricularia auricularia using a fungal genomic DNA extraction kit; 2) using the extracted DNA as a template, using the 8 pairs of primers NaSNP1F / R, NaSNP2F / R, NaSNP3F / R, NaSNP4F / R, NaSNP5F / R, NaSNP6F / R, NaSNP7F / R and NaSNP8F / R to perform PCR amplification respectively; PCR reaction system for PCR amplification: 30 μL, PCR Mix 15.3 μL, ddH2O 11.1 μL, upstream and downstream primers 1.2 μL each, DNA template 1.2 μL; The PCR amplification program was as follows: pre-denaturation at 95°C for 4 min, denaturation at 94°C for 30 s, annealing temperatures of primer pairs NaSNP1F / R, NaSNP2F / R, NaSNP3F / R, NaSNP4F / R, NaSNP5F / R, NaSNP6F / R, NaSNP7F / R, and NaSNP8F / R were 55°C, 55°C, 56°C, 56°C, 54°C, 55°C, 54°C, and 54°C, respectively, annealing time was 50 s, extension at 72°C for 50 s, 35 cycles, incubation at 72°C for 10 min, and storage at 4°C; 3) After amplification, electrophoresis was performed on a 1% agarose gel to obtain specific bands and then sequenced. The sequencing results of each sample were statistically analyzed to obtain different genotypes, thereby identifying the cultivated strains of Tremella fuciformis.

5. The use of the PCR amplification primer pair combination described in claim 3 in constructing a fingerprint for identifying Tremella fuciformis cultivated strains, characterized in that: The following steps are involved: 1) constructing a fingerprint of the Auricularia auricularia strain according to the sites amplified by the 8 pairs of SNP marker primers; wherein 0 indicates that all SNP sites are genotype I, 1 indicates that two genotypes coexist and are named genotype III, and 2 indicates that all are genotype II; 2) Perform genotypic statistical analysis on the collected golden ear strains and find out the SNP sites that are different from other golden ear strains, which are used for strain variety identification.

Images