Alternaria alternata strain and application thereof in preparation for resisting vibrio parahaemolyticus

Abstract

The invention provides an alternaria alternata strain I-Y6-1 and an application of the alternaria alternata strain I-Y6-1 in a preparation for resisting vibrio parahaemolyticus. The strain is preserved in China General Microbiological Culture Collection Center on July 24, 2024, and the preservation number is CGMCC NO.41473. The invention further provides a preparation method of the alternaria alternata strain I-Y6-1. The alternaria alternata provided by the invention has a relatively strong antagonistic effect on vibrio parahaemolyticus, has huge application potential on prevention and treatment of diseases caused by vibrio parahaemolyticus, especially prevention and treatment of aquaculture diseases, and provides a thought for biological prevention and treatment of aquatic vibrio diseases.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a microbial preparation for resisting Vibrio parahaemolyticus based on fermentation products of Alternaria alternata. Background Art

[0002] Aquaculture has always been a traditional pillar industry in my country's coastal areas. In recent years, the frequent occurrence of aquaculture diseases has caused huge economic losses to my country's aquaculture industry, seriously affecting the green and healthy development of coastal economy and marine industry. According to the national aquaculture disease detection report, the direct economic losses caused by aquaculture diseases in my country are more than 10 billion yuan each year. Diseases caused by bacteria account for nearly 50%, and Vibrio disease caused by Vibrio bacteria is the most important bacterial disease causing fish, shrimp and shellfish farming diseases in my country. In the process of aquaculture disease prevention and control, the excessive use and abuse of antibiotics will lead to the production of a large number of drug-resistant pathogens, and their drug-resistant genes will also be transmitted to other marine organisms through the food chain, causing serious impacts on the marine ecological environment and ecological balance. In addition, the residues of antibiotics in aquatic products will eventually pose a huge potential threat to food safety and human health.

[0003] In recent years, scientists at home and abroad have achieved the effect of disease prevention and control by using the interactions between different microorganisms in the same ecosystem, such as nutritional competition, secretion of antibiotics or hyperparasitism, and other microecological control methods to inhibit or kill ice microorganisms. Therefore, finding marine microorganisms that have antagonistic effects on Vibrio from marine ecosystems and using them in the research and development of new microbial preparations is an effective way to solve the problem of aquaculture diseases. Summary of the invention

[0004] The first aspect of the present invention aims to provide a strain of Alternaria alternata.

[0005] The second aspect of the present invention aims to provide a method for preparing a fermentation product of an Alternaria strain.

[0006] The third aspect of the present invention aims to provide a use of an Alternaria strain in the preparation of an anti-Vibrio parahaemolyticus preparation.

[0007] To achieve the above object, the present invention is implemented through the following technical solutions:

[0008] According to the first aspect of the present invention, a fungal strain is provided, which is identified as Alternaria alternata, numbered I-Y6-1, and is obtained from a sponge sample collected from a marine aquaculture area; the Alternaria alternata I-Y6-1 was deposited in the General Microbiology Center of the China Culture Collection Administration on July 24, 2024, with a deposit number of CGMCCNO.41473.

[0009] In some embodiments of the present invention, the Alternaria alternata is present in the form of a fermentation product.

[0010] In some embodiments of the present invention, the fermentation product includes one or more of a fermentation broth, a fermentation broth extract, a bacterial suspension, a concentrate, an extract, various polar components, and compound monomers obtained after purification of the fermentation product.

[0011] The second aspect of the present invention aims to provide a method for preparing a fermentation product of Alternaria strains, wherein the method comprises inoculating Alternaria strain I-Y6-1 into a fungal culture medium, expanding the fermentation culture for 30 days, removing the mycelium, and obtaining the fermentation product.

[0012] In some embodiments of the present invention, the culture temperature of the culture medium is 28°C.

[0013] In some embodiments of the present invention, the fermentation product can be obtained by directly collecting the fermentation broth or vacuum freeze-drying to obtain a lyophilized powder.

[0014] In some embodiments of the present invention, the culture medium is PDB culture medium. Specifically, 200 g of potato juice is boiled, filtered through gauze, and the filtrate is taken, and 20 g of glucose, 6 g of mannitol, 6 g of sucrose, 3 g of monosodium glutamate, 5 g of peptone, and 5 g of yeast powder are added, and the volume is adjusted to 1 L with purified water. The pH value is adjusted to between 8.0 and 8.5, and sterilized by high-pressure steam at 121° C. for 20 min.

[0015] The third aspect of the present invention aims to provide an application of an Alternaria strain in the preparation of an anti-Vibrio preparation, especially an anti-Vibrio parahaemolyticus preparation, and to provide an application of an Alternaria strain in the preparation of a drug for treating or preventing diseases caused by anti-Vibrio, especially anti-Vibrio parahaemolyticus.

[0016] In some embodiments of the present invention, the Alternaria strain provided by the present invention is used for the prevention and treatment of aquatic Vibrio diseases caused by Vibrio parahaemolyticus and Vibrio anguillarum, Vibrio splendidus, Vibrio harveyi, Vibrio vulnificus, and Vibrio cholerae.

[0017] Advantages and antibacterial effects of the present invention:

[0018] The invention relates to an Alternaria strain, which is used for preventing and treating diseases caused by Vibrio parahaemolyticus. The strain is derived from marine organisms, is environmentally friendly, and does not cause harm to the marine environment. In addition, the preparation method is simple, the raw materials are easily obtained, and it is not restricted and limited by resources, regions, and production conditions.

[0019] According to the analysis of experimental data, the fermentation products of this Alternaria strain have a strong antagonistic effect on Vibrio parahaemolyticus, indicating that this bacterium has great application potential in the prevention and control of diseases caused by Vibrio parahaemolyticus, especially in the prevention and control of aquaculture diseases, and provides ideas for the biological control of aquatic Vibrio diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Colony diagram of Alternaria alternata I-Y6-1 provided by the present invention

[0021] Figure 2 The inhibitory effect of the fermentation broth extract of Alternaria alternata I-Y6-1 provided by the present invention on Vibrio parahaemolyticus

[0022] Figure 3 Comparison of the inhibitory effects of the fermentation broth extract of Alternaria alternata I-Y6-1 (left bacterial circle) and the positive control chloramphenicol (right bacterial circle) on Vibrio parahaemolyticus provided by the present invention

[0023] Specific implementation (embodiment)

[0024] In order to enable those skilled in the art to better understand the solution of the present application, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present application.

[0025] It should be noted that the terms "including" and "having" and any variations thereof in the specification and claims of the present application and the above-mentioned drawings are intended to cover non-exclusive inclusions. For example, a process, method, system, product or apparatus comprising a series of steps or units is not necessarily limited to those steps or units clearly listed, but may include other steps or units that are not clearly listed or inherent to these processes, methods, products or apparatuses.

[0026] In the present invention, "PBD medium", also known as potato dextrose broth medium, is used for the detection, separation and cultivation of yeast and mold. It is a PBD medium without agar and is suitable for liquid culture of fungi and the like.

[0027] In the present invention, "Alternaria" is a dark-colored fungus widely distributed in nature. It is a common saprophyte in soil, plants, food, and industrial materials, and is also a common contaminant in laboratories. The genus Alternaria belongs to the kingdom Fungi, phylum Ascomycota, subphylum Ascomycota, class Socomycetes, order Latrocoelales, family Coelomycetes. There are more than 50 species in the genus, the most common of which is Alternaria alternifolia.

[0028] In the present invention, "Vibrio" is a Gram-negative bacterium with a short, curved body and a flagellum at the tail [1]. Such as Vibrio cholerae. The genus Vibrio is widely distributed in seawater and marine animals in estuaries, bays, and coastal waters. There are 91 species of Vibrio. The main fish and shellfish pathogens are: Vibrio alginolyticus, Vibrio anguillarum, Vibrio parahaemolyticus, Vibrio vulnificus, etc.; some Vibrio can also cause human diseases, such as: Vibrio alginolyticus, Vibrio vulnificus, etc.

[0029] In the present invention, "fermentation" refers to the process in which people use the life activities of microorganisms under aerobic or anaerobic conditions to prepare microbial cells themselves, or direct metabolites or secondary metabolites. Fermentation is sometimes also written as fermentation, and its definition varies depending on the use occasion. Fermentation usually refers to a certain decomposition process of organic matter by organisms.

[0030] In the present invention, "culture medium" refers to a nutrient matrix composed of different nutrients for the growth and reproduction of microorganisms, plants or animals (or tissues). It generally contains several major types of substances such as carbohydrates, nitrogen-containing substances, inorganic salts (including trace elements), vitamins and water. Culture medium is not only a basic substance that provides cell nutrition and promotes cell proliferation, but also a living environment for cell growth and reproduction.

[0031] The present invention is further analyzed below in conjunction with specific examples.

[0032] Example 1: Acquisition of Alternaria alternata I-Y6-1

[0033] 1. Isolation of strains

[0034] The collected fresh sponge samples were first disinfected with 75% alcohol in a clean bench to kill surface bacteria, then rinsed with sterile water three times, chopped or ground, evenly placed or spread on a PDA culture medium plate, and cultured at 28°C for 3-5 days to observe the fungal colonies. According to the different morphological characteristics of the colonies on the plate, the colonies were picked and purified by plate streaking culture to obtain strain I-Y6-1.

[0035] 2. Identification of bacterial species

[0036] Morphological characteristics

[0037] The mycelium of strain I-Y6-1 grew rapidly on the PDA medium plate. It was initially white, and turned gray after 5-8 days. As the culture time increased, the color of the mycelium gradually deepened and finally turned dark brown. It was preliminarily identified as a fungus of the genus Alternaria. Figure 1 shown.

[0038] 2.2. ITS rDNA sequence homology analysis

[0039] The ribosomal rDNA gene transcription spacer sequence of the strain was extracted and cloned for gene sequencing, and the gene sequence obtained was as follows:

[0040] SEQ ID NO.1: ITS sequence of I-Y6-1

[0041] ATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTC

[0042] ACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTA

[0043] GGACAAACATAAACTTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAAT

[0044] AATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACG

[0045] CAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAA

[0046] TCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCG

[0047] AGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTA

[0048] GCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTC

[0049] GGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATT

[0050] AAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAA

[0051] CTTAA

[0052] After testing and comparison, strain I-Y6-1 was identified as Alternaria altrnata.

[0053] The Alternaria alternata I-Y6-1 strain was deposited on July 24, 2024 at the General Microbiology Center of the China Microorganism Culture Collection Administration, address: Institute of Microbiology, Chinese Academy of Sciences, with the deposit number CGMCC NO.41473, the split name is Alternaria alternata, and the strain number is I-Y6-1.

[0054] Example 2: Preparation of Alternaria alternata I-Y6-1 fermentation product

[0055] 1. Activation of seed strains

[0056] The Alternaria strain I-Y6-1 stored in 30% glycerol in a -80°C refrigerator was streaked onto a PDA medium plate and activated in a 28°C constant temperature incubator for 5-7 days. When the mycelium covered the plate, it was used as the seed strain for fermentation culture.

[0057] 2. Preparation of fermentation medium

[0058] The fermentation medium used was modified PDB medium: 200 g potato (boiled juice), 20 g glucose, 6 g mannitol, 6 g sucrose, 3 g MSG, 5 g peptone, 5 g yeast powder, diluted to 1 L with purified water, adjusted to pH between 8.0 and 8.5, sterilized with high-pressure steam at 121°C for 20 min, and set aside.

[0059] 3. Preparation of Fermentation Products

[0060] The seed strain is inoculated into a sterilized fermentation medium, and cultured at 28°C for 30 days. Mycelium is removed by centrifugation or filtration, and the fermentation liquid is collected or freeze-dried to obtain a dry powder fermentation product.

[0061] Example 3: Determination of the anti-Vibrio parahaemolyticus activity of Alternaria alternata I-Y6-1 fermentation product

[0062] Antibacterial activity determination: Vibrio parahaemolyticus was inoculated into a 2216E medium plate by a filter paper agar diffusion method, cultured at 37°C for 24 hours, then the surface of the medium was washed with a 0.85% NaCl solution, and the bacterial suspension was aspirated, the bacterial solution was diluted to 1.0×106CUF / mL by turbidimetry, 200 μL of the prepared bacterial suspension was aspirated with a pipette, inoculated into a 2216E medium plate, evenly coated with an applicator, and a 6 mm diameter sterile filter paper was attached to the surface of the plate. The ethyl acetate extract of the fermentation broth or the dry powdered fermentation product obtained in the above example was used as a sample to be tested, dissolved in dimethyl sulfoxide (DMSO), and prepared into a sample solution with a concentration of 40 mg / mL. Use a pipette to draw 5 μL of sample onto a filter paper with a diameter of 6 mm, and use a filter paper with the same volume of DMSO solvent as a negative control and a chloramphenicol with a concentration of 20 μg / piece as a positive control. Set up three parallels for each group. Finally, place the plate in a 37°C constant temperature incubator and culture it for 24 hours. Use the cross method to determine the diameter of the inhibition zone.

[0063] Experimental results: Figure 2 On the culture medium plate shown, the ethyl acetate extract of the fermentation broth of Alternaria alternata I-Y6-1 (sample concentration 200 μg / plate) showed an obvious inhibition zone, indicating that the fermentation product of this strain has a strong inhibitory effect on Vibrio parahaemolyticus. Figure 3 The left bacterial circle shows that the size of the inhibition zone of the fermentation product against Vibrio parahaemolyticus is 21.0±1.0mm, and the right bacterial circle is the positive control chloramphenicol inhibition zone size of 31.5±0.5mm (chloramphenicol concentration is 20μg / tablet). Its dry powder fermentation product has a similar antibacterial effect. It can be seen that the fermentation product of Alternaria I-Y6-1 has a strong inhibitory effect on Vibrio parahaemolyticus.

[0064] The above description is only a preferred embodiment of the present invention. It should be pointed out that for relevant technical personnel in the field, several improvements and modifications made without departing from the principle of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. A strain of Alternaria alternata, characterized in that: It was named Alternaria alternata I-Y6-1 and deposited in the General Microbiology Center of China Culture Collection Administration on July 24, 2024, with the deposit number CGMCC NO.41473.

2. The Alternaria strain according to claim 1, characterized in that: The Alternaria alternata is present in the form of a fermentation product.

3. The Alternaria strain according to claim 2, characterized in that: The fermentation product includes one or more of fermentation broth, fermentation broth extract, bacterial suspension, concentrate, extract, various polar components and compound monomers obtained after purification of the fermentation product.

4. A method for preparing a fermentation product of an Alternaria strain, characterized in that: Alternaria alternata I-Y6-1 was inoculated into a fungal culture medium and fermented for 30 days, and the mycelium was removed to obtain a fermentation product.

5. The method for preparing the fermentation product of Alternaria strain according to claim 4, characterized in that: The culture medium is PDB culture medium.

6. Use of the Alternaria strain according to any one of claims 1 to 3 in the preparation of an anti-Vibrio parahaemolyticus preparation.

7. Use of the Alternaria strain according to any one of claims 1 to 3 in the preparation of a medicament for treating or preventing a disease caused by Vibrio parahaemolyticus.

Images