Method for treating arthritis by using mesenchymal stem cells subjected to in-vitro limited induction and application

Abstract

The invention provides a method for treating arthritis by using mesenchymal stem cells subjected to limited induction in vitro. Osteoarthritis is a common joint degenerative disease and is mainly characterized by cartilage injury and inflammatory response. The traditional treatment method is difficult to realize cartilage regeneration, but mesenchymal stem cells (MSC) show a prospect in joint repair due to multidirectional differentiation potential and immunomodulatory effect. According to the invention, bergenin (KGN) is utilized in vitro to induce MSC to differentiate into chondrocytes, so that the chondrogenic ability of the cells is enhanced. The inducible MSC is injected into a rat gonitis model, cartilage repair is remarkably promoted, and inflammation is reduced. Experimental results show that the method can effectively relieve arthrocele, improve the motion function and reduce the pain sensitivity. The invention not only improves the treatment effect of MSC, but also provides a safe and effective new approach for treating arthritis, and has important clinical application value.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a method and application of limited in vitro induced mesenchymal stem cells for treating arthritis. Background Art

[0002] Osteoarthritis, as an autoimmune disease with persistent and recurrent synovial inflammation and irreversible cartilage tissue damage, is characterized by immune imbalance, excessive accumulation of inflammatory factors, and joint bone erosion, which seriously affects the patient's motor function and quality of life. The main symptoms are joint pain, swelling and stiffness, which affect the ability of people to move freely. Its pathological characteristics include degeneration and destruction of articular cartilage, synovitis, subchondral bone sclerosis, bone hyperplasia at the joint edge and osteophyte formation. According to literature reports, there are currently more than 300 million OA patients in the world, and the overall prevalence of primary OA in people over 40 years old in my country has reached 46.3%. Moreover, with the continuous aging of the population in my country, the prevalence of OA has a tendency to gradually increase. Therefore, standardized OA diagnosis and treatment are of great significance to clinical work and social development. The treatment of OA includes early non-surgical treatment and later joint replacement. Non-surgical treatments include weight control, exercise therapy, physical therapy, and drug therapy, which can relieve symptoms in the short term, but the treatment effect is limited and cannot prevent the progression of the disease, which will eventually lead to joint pain, dysfunction, and even disability.

[0003] Due to the special environment of chondrocytes and cartilage matrix, the self-repair ability of chondrocytes and matrix is ​​poor, which leads to the difficulty in inhibiting the degradation of cartilage matrix in inflammatory environment and promoting chondrocyte regeneration during treatment. Mesenchymal stem cells, due to their multi-lineage differentiation ability and immunomodulatory function, have shown new therapeutic prospects in the field of arthritis treatment. However, there are still some problems in the treatment of arthritis with allogeneic mesenchymal stem cells. For example, only a very small number of cells can successfully differentiate into chondrocytes after stem cell transplantation. At present, there is still a lack of effective means to intervene in the occurrence of OA or prevent the progression of OA.

[0004] For example, in the prior art, in order to improve the chondrogenic efficiency of MSC, researchers developed Kartogenin (KGN) as a chondrogenic induction agent. KGN shows potential in cartilage regeneration by activating Sm cell differentiation. Patent document US20130243716A1 details the application of KGN in cartilage repair and regeneration, proving that KGN can significantly improve the chondrogenic differentiation efficiency of MSC. US20130243716A1]. In addition, Johnson et al. also verified the effectiveness of KGN in inducing MSC differentiation through in vitro experiments. However, existing research and patents mainly focus on direct in vivo application, which results in MSC still unable to achieve the best cartilage regeneration effect in a highly inflammatory environment.

[0005] In addition, current stem cells lack effective in vitro induction methods and cannot fully utilize the chondrogenic potential of MSCs. Patent document JP2012514164A describes a method for repairing cartilage using MSCs, but this method is not combined with in vitro induction differentiation treatment, the differentiation efficiency of MSCs is still not ideal, and the effect is limited in various degenerative lesions.

[0006] In summary, the existing technology applies MSC to osteoarthritis. By inducing MSC with KGN in vitro to increase its cartilage-forming ability, it will provide a new way for the treatment of osteoarthritis.

[0007] Kartogenin (KGN) is an activator of the Smad4 / Smad5 pathway and a potent inducer of multipotent mesenchymal stem cells to differentiate into chondrocytes. KGN can effectively induce MSCs to differentiate into chondrocytes in a dose-dependent manner. In mouse pre-bone mesenchymal cells, KGN stimulates the formation of cartilage nodules and synovial joints, while upregulating the expression level of transforming growth factor β1 (TGFβ1), so that TGFβ1 stimulates the formation of cartilage nodules. The present invention changes the in vitro culture conditions and uses kartogenin to induce stem cells in vitro to induce them to differentiate into specific chondrocytes, so as to achieve a more effective treatment purpose. The induced cells can greatly enhance the repair ability of cartilage in vivo and play a role in protecting cartilage. Summary of the invention

[0008] The purpose of the present invention is to provide a new method for treating arthritis by inducing mesenchymal stem cells (MSC) based on bergenin (KGN). The method uses KGN to induce MSC to differentiate into chondrocytes in vitro, improve the differentiation efficiency of stem cells and the cartilage repair ability, and thus improve the pathological condition of osteoarthritis (OA). Through this method, the inflammatory response can be effectively reduced, and cartilage regeneration and repair can be promoted, thereby providing a safe and effective OA treatment plan.

[0009] The present invention mainly solves the following problems:

[0010] First, improve the efficiency of MSC (mesenchymal stem cells) in cartilage differentiation in the treatment of arthritis

[0011] The current MSC treatment has a low efficiency in differentiating into chondrocytes after being injected into the joint cavity, which affects the cartilage regeneration effect. This invention uses bergenin (KGN) to induce MSCs in vitro, so that the cells have a tendency to become cartilage before injection, so as to repair cartilage more effectively in vivo.

[0012] Second, solve the problem of low MSC differentiation efficiency in a highly inflammatory environment

[0013] Induced stem cells can more effectively improve the inflammatory microenvironment in the joint cavity, which is conducive to the differentiation of MSC into chondrocytes. The invention is that MSCs are pre-induced before injection to have the characteristics of differentiation into cartilage, thereby improving the differentiation efficiency and enhancing the repair effect.

[0014] Third, provide a treatment method that replaces or supplements existing joint replacement surgery

[0015] Although current joint replacement surgery can improve symptoms in patients with advanced OA, it is risky, costly, and cannot restore the natural function of the joint. This improved MSC treatment method provides a non-surgical means of cartilage repair, which may become a powerful treatment option, especially for patients with early and mid-stage OA.

[0016] Fourth, solve the source and ethical issues of MSC and provide a stable and safe source of cells

[0017] This invention uses umbilical cord-derived MSCs, which not only solves the ethical dilemma of cell sources, but also avoids problems such as donor matching and immune rejection, providing a low-ethical-risk and sufficient source of MSCs for the treatment of osteoarthritis.

[0018] This invention aims to provide a more effective and safe treatment option for osteoarthritis by optimizing the chondrogenic induction process of MSCs and improving the efficiency of cartilage repair in vivo.

[0019] In order to solve the above problems and achieve the solutions required to solve the above problems, the invention adopts the following technical solutions:

[0020] A method for treating arthritis by limited in vitro induction of mesenchymal stem cells, comprising the following steps:

[0021] S1. Isolate and obtain umbilical cord mesenchymal stem cells from the umbilical cords of normal-delivered fetuses without infectious diseases;

[0022] S2. Cultivate and cryopreserve the isolated umbilical cord mesenchymal stem cells, and passage them to the fifth generation after recovery to ensure cell quality;

[0023] S3, using 100 nM bergenin to induce chondrogenesis in mesenchymal stem cells, and collecting samples at different induction times of 3 days, 7 days, 10 days, and 14 days in order to obtain the best chondrogenic time conditions;

[0024] S4. The gene expression levels of cartilage markers COL2A1, SOX9, and ACAN were detected by qPCR to evaluate the effect of chondrogenic differentiation, and cell samples before the appearance of differentiation markers were selected for subsequent treatment.

[0025] Furthermore, the umbilical cord mesenchymal stem cells were isolated, cultured and cryopreserved using the adherence method, and surface markers were detected using immunofluorescence and flow cytometry during the cell culture process to verify the pluripotency of the stem cells.

[0026] Furthermore, bergenin is used to promote the differentiation of mesenchymal stem cells into chondrocytes by activating the Smad4 / Smad5 pathway and upregulating the expression of transforming growth factor β1 (TGFβ1), thereby stimulating the formation of cartilage nodules and synovial joints.

[0027] Furthermore, an arthritis model was established on the surface of the rat knee joint to test the therapeutic effect of bergenin-induced umbilical cord mesenchymal stem cells, comprising the following steps:

[0028] S1. Physically injure the surface of the rat knee joint using acupuncture, specifically, insert a 1.5 mm needle into the knee joint cavity and apply uniform force to produce scratches on the joint surface;

[0029] S2. Using the aluminum hydroxide adjuvant method, 20 mg of aluminum hydroxide was mixed with 1 mL of complete Freund's adjuvant to form a milky white solution, and 100 μL was injected into the rat knee joint cavity to induce knee joint inflammation.

[0030] Furthermore, the success rate of modeling and inflammatory response were evaluated by measuring the swelling of the knee, ankle and toes and detecting the levels of inflammatory factors by qPCR, SDS electrophoresis and ELISA.

[0031] Furthermore, in the constructed arthritis rat model, treatment was performed by injecting bergenin-induced umbilical cord mesenchymal stem cells into the knee joint cavity, comprising the following steps:

[0032] S1. Screen the qualified rats and divide them into complete control group, modeling group and treatment group, with 10 rats in each group;

[0033] S2, the complete control group did not undergo modeling, but underwent sham surgery and injected with normal saline;

[0034] S3, modeling group only received modeling treatment and then injected with normal saline;

[0035] S4, the treatment group was modeled and started treatment one week after modeling. Each time, 100 μL of cell injection solution with a concentration of 3×10^6 cells / ml was injected into the knee joint cavity. The treatment was once a week for a total of two treatments.

[0036] S5. One week after the second treatment, the effect was evaluated, including comprehensive testing of joint morphology, behavior, pain and pathological changes, to verify the effect of bergenin-induced mesenchymal stem cells in the treatment of arthritis.

[0037] Furthermore, the therapeutic effect is comprehensively evaluated by the following detection methods:

[0038] The swelling of the rats' knees, ankles, and toes was measured using a tape measure and vernier caliper;

[0039] The rats' motor ability and total moving distance were tested by behavioral testing equipment;

[0040] The thermal pain threshold analgesia was used to evaluate the changes in the thermal pain threshold of rats;

[0041] Mechanical pain threshold testing was performed using vonFrey fibers;

[0042] The frozen sections of rat knee cartilage were stained, and the integrity of cartilage structure and pathological changes were observed under a microscope.

[0043] qPCR was used to detect the changes in gene expression of inflammatory factors in the synovium and cartilage of rat knee joints to evaluate the inhibitory effect of inflammation.

[0044] Furthermore, by utilizing the function of inducing stem cells to differentiate into chondrocytes in vitro, the repair of articular cartilage and inhibition of inflammation can be achieved through injection into the knee joint cavity, which is suitable for the clinical treatment of arthritis.

[0045] Furthermore, the use of umbilical cord-derived mesenchymal stem cells does not involve ethical issues and has the advantages of sufficient cell sources and safe and simple extraction and culture operations.

[0046] Beneficial Effects

[0047] 1. The present invention obtains mesenchymal stem cells from the umbilical cord, thereby reducing unsafe factors such as poor donor acceptance and infection. The extraction of umbilical cord mesenchymal stem cells does not involve moral and ethical issues, thereby reducing the difficulty of obtaining cells in the later stage. The treatment method of inducing mesenchymal stem cells in vitro by injection into the joint cavity affects the differentiation bias of mesenchymal stem cells, enhances their proliferation ability and joint specificity, and can form cartilage and repair tissues to change the culture microenvironment, regulate the microenvironment of the injured site, improve inflammation and other ways to improve local cell regeneration, thereby promoting tissue regeneration and repair.

[0048] 2. The method of the present invention affects the differentiation bias of mesenchymal stem cells by treating stem cells cultured in vitro for a specific period of time, and induces them to become stem cells with a cartilage differentiation direction. After injection into the body, their ability to differentiate into cartilage and proliferation rate are increased, which can greatly enhance the repair ability of cartilage in the body and protect cartilage. The method of the present invention can further reduce the treatment time in the body by inducing allogeneic mesenchymal stem cells to a limited extent, still maintaining the characteristics of stem cells and avoiding immune rejection, inhibiting the degradation of cartilage matrix in an inflammatory environment, and promoting chondrocyte regeneration. It has carried out pioneering extension work on the application of umbilical cord-derived mesenchymal stem cells, providing a new method for the prevention and treatment of arthritis, and has important translational medical significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings in the following description are only for the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0050] Figure 1 This is a schematic diagram of a method for treating arthritis by limited induction of mesenchymal stem cells in vitro according to an embodiment of the present invention;

[0051] Figure 2 A schematic diagram of cell morphology under an optical microscope according to an embodiment of the present invention;

[0052] Figure 3 This is a schematic diagram of osteoblast staining according to an embodiment of the present invention;

[0053] Figure 4 This is a schematic diagram of cartilage staining according to an embodiment of the present invention;

[0054] Figure 5 This is a schematic diagram of adipogenesis staining according to an embodiment of the present invention;

[0055] Figure 6 This is a schematic diagram of the induction of chondrocytes detected by qRT-PCR in an embodiment of the present invention;

[0056] Figure 7 It is a schematic diagram of the modeling effect of the knee arthritis animal model according to the morphological observation of an embodiment of the present invention;

[0057] Figure 8 This is a schematic diagram of detecting inflammation around the knee joint by qRT-PCR according to an embodiment of the present invention;

[0058] Fig. 9 A schematic diagram of body weight according to an embodiment of the present invention;

[0059] Fig.10 This is a schematic diagram of measuring the degree of node swelling according to an embodiment of the present invention;

[0060] Fig.11 A schematic diagram of the statistical movement distance of rats according to an embodiment of the present invention;

[0061] Fig.12 A schematic diagram of the change trend of the thermal pain threshold (PWT) of rats according to an embodiment of the present invention;

[0062] Fig.13 This is a schematic diagram of the change trend of the mechanical stimulation pain threshold (50% PWT) of rats according to an embodiment of the present invention;

[0063] Fig.14 Schematic diagram of HE staining and safranin fast green staining of rat cartilage tissue sections according to an embodiment of the present invention;

[0064] Fig.15 This is a schematic diagram of the qPCR detection of TNF-α, IL-1β, and IFN-γ levels in rat articular cartilage according to an embodiment of the present invention. DETAILED DESCRIPTION

[0065] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. At the same time, it is explained here that in order to make the embodiments more detailed, the following embodiments are the best and preferred embodiments, and those skilled in the art may also adopt other alternatives to implement some known technologies; and the accompanying drawings are only for more specific description of the embodiments, and are not intended to specifically limit the present invention.

[0066] It should be noted that the references to "one embodiment", "an embodiment", "an exemplary embodiment", "some embodiments" and the like in the specification indicate that the embodiments described may include specific features, structures or characteristics, but not every embodiment may include the specific features, structures or characteristics. In addition, when a specific feature, structure or characteristic is described in conjunction with an embodiment, it should be within the knowledge of a person skilled in the art to implement such feature, structure or characteristic in conjunction with other embodiments (whether or not explicitly described).

[0067] In general, a term can be understood, at least in part, from its use in context. For example, depending, at least in part, on the context, the term "one or more" as used herein can be used to describe any feature, structure, or characteristic in the singular sense, or can be used to describe a combination of features, structures, or characteristics in the plural sense. Additionally, the term "based on" can be understood as not necessarily intended to convey an exclusive set of factors, but can instead, depending, at least in part, on the context, allow for the presence of other factors that are not necessarily explicitly described.

[0068] The purpose of the present invention is to provide a method and application for limited induction of mesenchymal stem cells in vitro, which can enhance the effect of stem cells in treating arthritis after injection, that is, a method for appropriately inducing mesenchymal stem cells in vitro using bergenin, affecting their differentiation bias, and enhancing the efficiency of stem cell differentiation.

[0069] Combined with reference Figures 1 to 15 Shown

[0070] In order to achieve the above object, the specific implementation methods adopted by the present invention are as follows:

[0071] 1. Effect of Bergenin on Chondrogenic Differentiation of Umbilical Cord Mesenchymal Stem Cells

[0072] (1) With the approval of the hospital ethics committee and the informed consent signed by the pregnant women, the umbilical cords of normal fetuses without infectious diseases were collected under sterile conditions. The umbilical cord mesenchymal stem cells were then isolated by the adherence method, cultured, and frozen for subsequent use. The frozen umbilical cord mesenchymal stem cells were revived and passaged to the fifth generation for detection of stem cell surface markers by immunofluorescence and flow cytometry, and differentiation omnipotence was verified to ensure the quality of the stem cells. After the quality of the mesenchymal stem cells was verified, 5×10^5 mesenchymal stem cells / well were induced to differentiate into chondrocytes by 100nM bergenin. The cells were collected after induction for 3, 7, 10, and 14 days, and the total RNA was extracted and reverse transcribed. qPCR primers were designed, and the expression of chondrogenic markers COL2A1, SOX9, and ACAN and the internal reference gene GAPDH was detected by qPCR to evaluate the time conditions for inducing mesenchymal stem cells to form chondrocytes. Cell samples were collected before the appearance of differentiation markers for drug preparation. (Primer design is as follows):

[0073] Col2a1-F:GCTCCCAGAACATCACCTACCA

[0074] Col2a1-R:ACAGTTCTTGCCCCACTTACCG

[0075] SOX9-F:GGCGGAGGAAGTCGGTGAAGAA

[0076] SOX9-R:GCTCATGCCGGAGGAGGAGTGT

[0077] ACAN-F:ACTTCCGCTGGTCAGATGGA

[0078] ACAN-R:TCTCGTGCCAGATCATCACC

[0079] 2. Establishing rat arthritis model using acupuncture and aluminum hydroxide adjuvant

[0080] A 1.5mm needle was inserted into the rat knee joint cavity for 1mm and a fixed length scratch was made with uniform force to cause physical damage to the surface of the rat knee cartilage. After that, the rat was taken to open the joint cavity and the cartilage surface damage was observed under a dissecting microscope. Compared with the traditional ACLT method, this modeling method causes less damage and the effect of microscopic observation is intuitive. After the model is successfully established, it is used to compare the repair effect of drugs on knee cartilage damage. After 20mg aluminum hydroxide and 1mL complete Freund's adjuvant are fully mixed until milky white, 100μL is injected into each knee joint cavity of the rat to model knee arthritis. After one week of modeling, the swelling of the knee, ankle and toes was measured with a tape measure and a vernier caliper to evaluate whether the model was successful. The modeling effect was evaluated by qPCR, SDS electrophoresis, and ELISA. This modeling method produces lesions faster. After the model is successfully established, it is used to detect the changes in inflammatory biochemical indicators and immune levels in rats after drug treatment.

[0081] 3. Induced umbilical cord mesenchymal stem cell drug treatment of knee arthritis in rats

[0082] Thirty healthy rats with uniform body weight were selected for the experiment and randomly divided into complete control group, modeling group and treatment group, with 10 rats in each group. The complete control group was modeled by sham surgery and injected with equal doses of saline during medication; the modeling group was modeled by acupuncture and aluminum hydroxide adjuvant injection, and medication was started one week after modeling, with equal doses of saline injected; the treatment group was modeled by the same method, and medication was started one week after modeling, with 100 μL of cell injection solution with a concentration of 3×10^6 cells / ml injected each time, once a week for a total of two treatments. The therapeutic effect of knee arthritis in rats was evaluated one week after the second treatment. The effectiveness of drug treatment for knee arthritis in rats was determined through a variety of tests, including (1) studying the changes in body shape and joint morphology of rats with knee arthritis after induced stem cell therapy; (2) studying the changes in pain sensation of rats with knee arthritis after induced stem cell therapy; (3) studying the pathological changes in knee cartilage of rats with knee arthritis after induced stem cell therapy; and (4) studying the changes in biochemical indicators of rats with knee arthritis after induced stem cell therapy.

[0083] Example 1

[0084] Study on the induction conditions of bergenin on chondrogenic differentiation of umbilical cord mesenchymal stem cells

[0085] 1. Umbilical cord mesenchymal stem cell culture and differentiation induction

[0086] (1) Isolation of umbilical cord mesenchymal stem cells

[0087] The umbilical cord was placed in a culture dish, and the periphery of the umbilical cord and the umbilical cord blood vessels were repeatedly rinsed with PBS for 3 to 5 times to remove the residual umbilical cord blood and ensure that the umbilical cord was always immersed in PBS. Clamp one end of the umbilical cord with one tweezer and one end of one of the arteries with the other tweezer. Gently peel off the arterial blood vessels from the umbilical cord along the spiral of the umbilical cord, and peel off another arterial blood vessel and vein blood vessel in the same way. The treated umbilical cord mesenchymal tissue was carefully cut and digested and cultured with type I collagenase at a concentration of 1.0 mg / mL. During this process, the volume ratio of type I collagenase to umbilical cord mesenchyme was strictly set to 1:1 to ensure digestion efficiency. Subsequently, the mixture was placed in a cell culture incubator containing 5% CO2 and set to 37°C. After 3 to 7 hours of digestion, a uniform cell suspension was obtained. The above cell suspension was inoculated in a cell culture dish with a diameter of 10 cm and cultured for three consecutive generations. During the culture process, the cells showed a typical long spindle-shaped and polygonal adherent growth pattern, showing good proliferation ability, and no obvious differentiation phenomenon was observed.

[0088] Combined with reference Figure 2 As shown:

[0089] 2. Umbilical cord mesenchymal stem cell detection

[0090] The morphological observation of umbilical cord mesenchymal stem cells was performed using an inverted microscope, and the results showed that the cells exhibited a typical long spindle-shaped and polygonal adherent growth pattern, and this morphological feature met the monitoring criteria for umbilical cord mesenchymal stem cells.

[0091] Combined with reference Figure 3 As shown:

[0092] 3. Verification of the omnipotence of umbilical cord mesenchymal stem cells

[0093] (1) Osteogenic differentiation of umbilical cord mesenchymal stem cells

[0094] Add all serum and additives to the cell basal culture medium. Add 0.5 mL of 0.1% gelatin to the 24-well plate and shake it well to evenly cover the bottom of each well. Place the 24-well plate with 0.1% gelatin in a clean bench or CO2 incubator for at least 30 minutes. Incubate the human umbilical cord mesenchymal stem cells to be induced at 2×10^4 cells / cm 2The cells were inoculated in a 24-well plate at a density of 1 mL of normal complete medium per well. The cells were cultured in a CO2 incubator at 37°C, 5% CO2, and saturated humidity. When the cell confluence reached 70%, the medium in the well was aspirated, and 1 mL of umbilical cord mesenchymal stem cell osteogenic differentiation medium was added to the 24-well plate. Fresh umbilical cord mesenchymal stem cell osteogenic differentiation medium was replaced every 3 days. After 5 weeks of induction, the osteogenic differentiation complete medium in the 24-well plate was aspirated and gently washed 3 times with 1×PBS. 1 mL of 4% paraformaldehyde solution was added to each well and fixed at room temperature for 30 minutes. The fixative was aspirated, and the cells were gently washed 3 times with 1×PBS. 1 mL of Alizarin Red working solution was added to each well and stained at room temperature for 5 minutes. The Alizarin Red staining solution was aspirated and gently washed 3 times with 1×PBS. 1 mL of 1×PBS was added to each well, and the culture plate was placed under a microscope to observe the osteogenic staining effect. The results showed that there was calcium salt deposition outside the hUC-MSCs cells, which was orange-red and had osteogenic differentiation ability.

[0095] Combined with reference Figure 4 As shown:

[0096] (2) Umbilical cord mesenchymal stem cells differentiate into cartilage

[0097] Add all of the additive I to the basal medium. Transfer 4×10^5 cells to be induced to a 15mL centrifuge tube and centrifuge at 20℃, 250g for 4min. Aspirate the supernatant. Add 0.5mL of premixed solution, resuspend the pellet obtained from the previous centrifugation, centrifuge at 20℃, 150g for 5min, and repeat once. Add 10μL of additive II to 1mL of chondrogenic differentiation premix, draw the required dose of additive II, add it to the corresponding volume of premixed solution to prepare chondrogenic differentiation complete medium, and mix gently by pipetting. Resuspend the obtained cell pellet with 0.5mL of complete medium, centrifuge at 20℃, 150g for 5min. Loosen the cap of the centrifuge tube and place it upright in a CO2 incubator at 37℃, 5% CO2, and saturated humidity for culture. When the cell clusters appear to clump, flick the bottom of the centrifuge tube to detach the chondrocytes from the bottom of the tube and suspend them in the liquid. Starting from the inoculation, the cells were replaced with fresh complete chondrogenic differentiation medium every 2 to 3 days, about 0.5 mL per tube, and the induction was continued until a chondrocyte with a diameter of 1.5 to 2 mm was formed in the tube. The chondrocytes were embedded in OCT, the slice thickness was about 5 μm, and alicin blue was added to the dried slices and stained at 37°C for 30 minutes. Rinse the slides with tap water for 5 minutes, dry them, and observe the alicin blue staining effect under a microscope. Alcian blue staining showed that more chondrocytes were generated, and the results showed that they had the potential for chondrogenic differentiation.

[0098] Combined with reference Figure 5 As shown:

[0099] (3) Adipogenic differentiation of umbilical cord mesenchymal stem cells

[0100] Preheat the basal medium to 37°C, add serum, additives AI, and additives A-II to the basal medium. Add serum and additives B to the basal medium. Add 0.5 mL of 0.1% gelatin to the 24-well plate and shake well to evenly cover the bottom of each well. Place the 24-well plate with 0.1% gelatin in a CO2 incubator for 30 minutes. Remove the gelatin and place the human umbilical cord mesenchymal stem cells to be induced at a concentration of 2×10^4 cells / cm 2 The cells were inoculated in a 24-well plate at a density of 100%, and 1 mL of normal complete medium was added to each well. The cells were cultured in a CO2 incubator at 37°C, 5% CO2, and saturated humidity. When the cell confluence reached 100%, the complete medium in the well was aspirated, and 1 mL of umbilical cord mesenchymal stem cell adipogenic differentiation medium A was added to the 24-well plate. After 3 days of induction, the A solution in the 6-well plate was aspirated, and 1 mL of umbilical cord mesenchymal stem cell adipogenic differentiation medium B solution was added. After 1 day of maintenance, the B solution was aspirated and replaced with the A solution for induction, and the A solution and the B solution were used alternately. Repeat the induction and maintenance process until sufficient lipid droplets of appropriate size appear, and then staining can be prepared. After the adipogenic differentiation is completed, the adipogenic differentiation complete medium in the 24-well plate is aspirated and gently washed 3 times with 1×PBS. 1 mL of 4% paraformaldehyde solution (or 10% formalin) was added to each well and fixed at room temperature for 30 minutes. Prepare the working solution according to the ratio of Oil Red O storage solution to distilled water = 3:2. After mixing, centrifuge at 250g for 4 minutes and use the supernatant. Aspirate the fixative, wash gently with 1×PBS 3 times, add 1mL of Oil Red O dye working solution to each well, and stain at room temperature for 30 minutes. Aspirate the Oil Red O staining solution, wash gently with 1×PBS 3 times, add 1mL1×PBS to each well, and place the culture plate under a microscope to observe the adipogenic staining effect. Add adipogenic induction solution to induce adipocytes for 3 weeks, and the cells gradually become hypertrophic. The results of Oil Red O staining showed that lipid droplets were formed in the cytoplasm of hUC-MSCs, which were dark red, indicating that hUC-MSCs have differentiation potential.

[0101] Combined with reference Figure 6 As shown:

[0102] 4. Bergenin induces mesenchymal stem cells to differentiate into cartilage

[0103] Kartogenin was used to induce chondrocytes, and 5×10^5 mesenchymal stem cells / well were seeded in a 6-well plate. After the cells adhered to the wall, 100nM bergenin was used for induction for 3, 7, 10 and 14 days. After the cells were digested, the gene expression levels of COL2A1, SOX9, ACAN and the reference gene GAPDH were determined by qPCR. The results showed that the expression of chondrocyte-related genes increased with time, proving that bergenin has the function of inducing stem cells to differentiate into chondrocytes. According to the experimental data, cells induced for 72 hours were selected for the experiment.

[0104] Example 2

[0105] Effects of acupuncture and aluminum hydroxide adjuvant on physical damage to the surface cartilage of the knee joint and inflammation in the joint

[0106] 1. Experimental Animals

[0107] SPF grade SD rats, male, 6-8 weeks old, 250g-300g. This experiment involves animal experiments and will strictly comply with the relevant laws and regulations on the use and management of experimental animals and the relevant regulations of the Experimental Animal Ethics Committee. The experimental rats were quarantined for 5 days, during which they were checked once a day, and healthy rats were selected for the experiment. 2 rats / box, the breeding temperature is 20-26℃, the humidity is 40-70%, and the lighting is intermittent for 12 hours during the day and 12 hours at night to keep the conditions in the breeding room stable. After the experiment, the animals were euthanized by carbon dioxide lethality. After euthanasia, the animals were used for subsequent experiments. The carcasses of the animals after the experiment were temporarily stored in the carcass freezer and uniformly disposed of harmlessly.

[0108] 2. Establishment of animal model of knee arthritis

[0109] (1) Aluminum hydroxide adjuvant induced modeling

[0110] Anesthetize and fix rats in the same way. Mix 20 mg of aluminum hydroxide with 1 mL of Freund's complete adjuvant until it becomes milky white, and draw 200 μL of the solution with a 1 mL syringe. After disinfection with alcohol, insert the needle from below the knee joint at a 45° angle and inject into the knee joint. Inject 100 μL of the solution into each of the left and right knee joints of the rat. After removing the needle, press with a cotton ball for 20 seconds to prevent the solution from flowing out.

[0111] 3. Evaluation of the effect of knee arthritis animal model

[0112] Combined with reference Figure 7 As shown:

[0113] (1) Determination of joint swelling

[0114] A tape measure was used to measure the swelling of the rats' knee and ankle joints, and a vernier caliper was used to measure the swelling of the rats' toes. The swelling of the knee and ankle joints of the modeled rats could be clearly observed, proving that the modeling was successful.

[0115] (2) Detection of inflammation around the knee joint

[0116] qPCR detection, combined with reference Figure 8 As shown:

[0117] After the modeling rats were euthanized, the affected limbs were removed, the knee joints were exposed, and the cartilage and synovium at the knee joints were taken to extract RNA, which was reversely transcribed into cDNA as a template to detect inflammatory factors such as TNF-α, IL-1β, IFN-γ and the expression of the internal reference gene GADPH. From the results, it can be seen that the levels of related factors such as TNF-α, IL-1β, IFN-γ increased significantly, proving that the modeling was successful.

[0118] Example 3

[0119] Study on the treatment of knee arthritis in rats with induced umbilical cord mesenchymal stem cells

[0120] 1. Experimental Grouping

[0121] Qualified rats were screened out from the purchased rats and weighed, and 30 rats with similar weights were selected for the experiment. According to the experimental requirements, all rats were randomly divided into a complete control group, a modeling group, and a treatment group, with 10 rats in each group.

[0122] The rats were divided into the following groups:

[0123] 2. Experimental rat modeling

[0124] According to the above experimental methods, rats in the modeling group and treatment group were modeled by acupuncture and aluminum hydroxide adjuvant injection.

[0125] 3. Model rats were injected with induced mesenchymal stem cells for treatment

[0126] The drug was injected into the knee joint cavity. After anesthesia and disinfection, the needle was inserted into the knee joint cavity at a 45° angle from below the knee joint. 100 μL of cell injection solution with a concentration of 3×10^6 cells / ml was injected into each knee joint cavity of the rats in the treatment group, and 100 μL of normal saline was injected into each knee joint cavity of the rats in the complete control group and the modeling group. Treatment began in the second week after modeling, and treatment was performed once a week for a total of two treatments. One week after the last treatment, the treatment effect evaluation began.

[0127] Example 4

[0128] 4. Evaluate the therapeutic effect of induced mesenchymal stem cell drugs on rats with knee arthritis

[0129] Combined with reference Fig. 9 As shown:

[0130] (1) Body mass measurement

[0131] The rats' body weight was measured before the start of treatment, 2 days after modeling, 2 days after each treatment, and at the end of the experiment. The data were statistically analyzed using SPSS, which showed that the injection of induced mesenchymal stem cell drugs did not affect the rats' body weight and did not cause serious immune exclusion.

[0132] Combined with reference Fig.10 As shown:

[0133] (2) Determination of joint swelling

[0134] Before the start of treatment, 2 days after modeling, 2 days after each treatment and at the end of the experiment, a tape measure was used to measure the swelling of the rat's knee and ankle joints, and a vernier caliper was used to measure the swelling of the rat's toes. After the end of the experiment, SPSS was used to perform statistical analysis on the data. From the experimental results, it can be seen that all measurement data in the treatment group have been significantly improved. Limited induced stem cells have a good effect in treating knee arthritis and will not cause serious immune exclusion.

[0135] Combined with reference Fig.11 As shown:

[0136] (3) Behavioral testing

[0137] Under controlled lighting conditions in a relatively dim environment, an open field experimental device with a size of 80cm×80cm×60cm was set up. At the beginning of the experiment, the experimental rats were placed in the central area of ​​the open field and allowed to freely explore and adapt to the environment for 5 minutes. Subsequently, the spontaneous activity behavior of the rats was continuously recorded using automatic photography technology to ensure the integrity and continuity of the data. The data obtained were subjected to detailed statistical analysis using dedicated software to quantitatively evaluate the total moving distance of the rats during the entire autonomous movement process. From the experimental results, it can be seen that the treatment group can improve the movement of the rats.

[0138] Combined with reference Fig.12 As shown:

[0139] (4) Determination of thermal pain threshold

[0140] The thermal pain threshold of rats was systematically evaluated using a plantar thermal radiation analgesia. The experiment was carried out 6 hours after each mechanical pain threshold measurement to ensure the stability and consistency of the experimental conditions. During the experiment, the rats were placed on the glass plate of the plantar thermal radiation analgesia and confined in a transparent plexiglass box to maintain the relative closedness of the experimental environment. The room temperature was precisely controlled at (25±2)°C to ensure the standardization of the experimental conditions. After the rats showed a quiet state, that is, stopped grooming and exploratory behavior, which took about 15 minutes, the "cross" positioning mark on the tester was then aligned with the center of the sole of the rat's hind foot, and the foot pad area was deliberately avoided to reduce experimental errors. After the instrument heating program was started, the timer automatically stopped until the rat lifted its foot due to thermal stimulation. The time recorded at this time was used as the measurement value of the thermal pain threshold. To obtain a more accurate average value, each foot of each rat was measured three times independently, with an interval of 5 to 6 minutes between each measurement to allow the rat to recover and reduce potential cumulative effects. Finally, the arithmetic mean of all measured values ​​was determined as the thermal pain threshold (TWL) of the rat. From the data, it can be seen that the thermal pain threshold of the rats in the saline group showed a relatively stable trend, accompanied by slight fluctuations, and no obvious pain response was observed, indicating that the pain sensitivity of the rats in this group was at a baseline level. The thermal pain threshold of the rats after modeling decreased significantly and continued to remain at a low level. In the treatment group, the thermal pain threshold was also lower than that of the saline group, but significantly higher than that of the model group. This result shows that induced stem cell therapy can improve pain to a certain extent.

[0141] Combined with reference Fig.13 As shown:

[0142] (5) Mechanical pain threshold test

[0143] During the experiment, the experimental rats were placed in a transparent plastic box on an elevated wire mesh, and then covered with a transparent plexiglass cover. They were allowed to adapt to this environment for about 30 minutes until the rats were completely still (stopped self-grooming and exploratory movement). Subsequently, a standardized von Frey fiber was used to gently touch the central area of ​​the sole of the rat's hind limb, carefully avoiding the foot pad during the operation, until the fiber was bent into an S shape and maintained for 5 seconds to observe and record whether the rat showed foot withdrawal or foot licking behavior. If the rat showed foot withdrawal or foot licking during the stimulation, it was considered a positive reaction (marked as X); conversely, if there was no such reaction, it was considered a negative reaction (marked as O). The test started with a von Frey fiber with a force of 4.0g. If this force failed to induce a positive reaction (i.e., the rat did not show escape behavior), the force was increased to the next higher force fiber for stimulation; conversely, if a positive reaction occurred, the force was decreased to the next lower force fiber. This process was repeated until the intersection of positive and negative (or negative and positive) reactions appeared for the first time, and then four consecutive tests were performed around this point. After the first OX or XO pattern appeared, 4 additional tests were performed to form a complete reaction sequence. To eliminate the mutual influence between consecutive stimulations, at least 1 minute was allowed between two tests. A special formula was then used to calculate 50% of the PWT and perform statistical analysis. The mechanical stimulation pain threshold in the treatment group was lower than that in the saline group and higher than that in the model group. This result shows that induced stem cell therapy can improve pain to a certain extent.

[0144] Combined with reference Fig.14 As shown:

[0145] (6) Observation of the pathological status of rat knee cartilage by frozen section staining

[0146] The experimental rat knee cartilage was separated and decalcified for 14 days using a rapid decalcification kit. After decalcification, the tissue was embedded in OCT under dry ice, and the embedded tissue was sliced ​​to about 5 μm and attached to a slide, and then placed on a metal bath surface at 50°C for 3 minutes. The tissue on the slide was completely immersed in 4% tissue fixative and fixed at room temperature for 30 minutes. The fixed slide was stained and observed under a microscope.

[0147] HE staining: hematoxylin staining for 2 minutes, washed with water and wiped dry; then hydrochloric acid ethanol acidification for 30 seconds, washed with water and wiped dry; blueing solution treatment for 1 minute, washed with water and wiped dry; finally eosin staining for 1 minute, washed with water and wiped dry. After staining, the integrity of the cartilage structure, the smoothness of the cartilage surface, the width of the joint cavity and the arrangement of trabeculae were observed under a microscope. The results of HE staining of pathological tissue sections showed that the articular surface cartilage structure was intact, the articular surface was smooth, the joint cavity tended to be normal, and the trabeculae were arranged regularly. The above results suggest that it has a repairing effect on the articular surface cartilage of rats.

[0148] Combined with reference Fig.15 As shown:

[0149] (7) Detection of changes in biochemical indicators in rats

[0150] qPCR detection: The cartilage and synovium of the experimental rat knee joint were taken, and the total RNA was extracted after TRIzon treatment. The cDNA was synthesized using a reverse transcription kit. qPCR primers were designed, and the synthesized cDNA was used as a template for qPCR to detect the gene expression of inflammatory factors such as TNF-α, IL-1β, IFN-γ and the internal reference gene GAPDH in the cartilage and synovium of the rat knee joint. The data after the test were used 2 -ΔΔct Methods: GraphPad 8.0 software was used to statistically analyze the processed data. Compared with those in the treatment group, the levels of TNF-α, IL-1β, and IFN-γ in the synovial fluid of the rats in the model group were significantly increased. Administration of medication can significantly reduce the elevated levels of TNF-α, IL-1β, and IFN-γ in the synovial fluid of OA rats.

[0151] The present invention covers any substitution, modification, equivalent method and scheme made on the essence and scope of the present invention. In order to make the public have a thorough understanding of the present invention, specific details are described in detail in the following preferred embodiments of the present invention, but those skilled in the art can fully understand the present invention without the description of these details. In addition, in order to avoid unnecessary confusion about the essence of the present invention, well-known methods, processes, procedures, components and circuits are not described in detail.

[0152] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for treating arthritis by limited in vitro induction of mesenchymal stem cells, characterized in that: The following steps are involved: S1. Isolate and obtain umbilical cord mesenchymal stem cells from the umbilical cords of normal-delivered fetuses without infectious diseases; S2. Cultivate and cryopreserve the isolated umbilical cord mesenchymal stem cells, and passage them to the fifth generation after recovery to ensure cell quality; S3, using 100 nM bergenin to induce chondrogenesis in mesenchymal stem cells, and collecting samples at different induction times of 3 days, 7 days, 10 days, and 14 days in order to obtain the best chondrogenic time conditions; S4. The gene expression levels of cartilage markers COL2A1, SOX9, and ACAN were detected by qPCR to evaluate the effect of chondrogenic differentiation, and cell samples before the appearance of differentiation markers were selected for subsequent treatment.

2. The method for treating arthritis by limited in vitro induction of mesenchymal stem cells according to claim 1, characterized in that: Umbilical cord mesenchymal stem cells were isolated, cultured and cryopreserved using the adherence method. Surface markers were detected using immunofluorescence and flow cytometry during the cell culture process to verify the pluripotency of stem cells.

3. The method for treating arthritis by limited in vitro induction of mesenchymal stem cells according to claim 1, characterized in that: The bergenin is used to promote the differentiation of mesenchymal stem cells into chondrocytes by activating the Smad4 / Smad5 pathway and upregulating the expression of transforming growth factor β1 (TGFβ1), thereby stimulating the formation of cartilage nodules and synovial joints.

4. The method for treating arthritis by limited in vitro induction of mesenchymal stem cells according to claim 1, characterized in that: An arthritis model was established on the surface of rat knee joints to test the therapeutic effect of bergenin-induced umbilical cord mesenchymal stem cells, including the following steps: S1. Physically injure the surface of the rat knee joint using acupuncture, specifically, insert a 1.5 mm needle into the knee joint cavity and apply uniform force to produce scratches on the joint surface; S2. Using the aluminum hydroxide adjuvant method, 20 mg of aluminum hydroxide was mixed with 1 mL of complete Freund's adjuvant to form a milky white solution, and 100 μL was injected into the rat knee joint cavity to induce knee joint inflammation.

5. The method for treating arthritis by limited in vitro induction of mesenchymal stem cells according to claim 4, characterized in that: The success rate of modeling and inflammatory response were evaluated by measuring the swelling of the knee, ankle and toes and detecting the levels of inflammatory factors by qPCR, SDS electrophoresis and ELISA.

6. The method for treating arthritis by limited in vitro induction of mesenchymal stem cells according to claim 1, characterized in that: In the established arthritis rat model, treatment was performed by injecting bergenin-induced umbilical cord mesenchymal stem cells into the knee joint cavity, including the following steps: S1. Screen the qualified rats and divide them into complete control group, modeling group and treatment group, with 10 rats in each group; S2, the complete control group did not undergo modeling, but underwent sham surgery and injected with normal saline; S3, modeling group only received modeling treatment and then injected with normal saline; S4, the treatment group was modeled and started treatment one week after modeling. Each time, 100 μL of cell injection solution with a concentration of 3×10^6 cells / ml was injected into the knee joint cavity. The treatment was once a week for a total of two treatments. S5. One week after the second treatment, the effect was evaluated, including comprehensive testing of joint morphology, behavior, pain and pathological changes, to verify the effect of bergenin-induced mesenchymal stem cells in the treatment of arthritis.

7. The method for treating arthritis by limited in vitro induction of mesenchymal stem cells according to claim 6, characterized in that: The therapeutic effect is comprehensively evaluated by the following detection methods: The swelling of the rats' knees, ankles, and toes was measured using a tape measure and vernier caliper; The rats' motor ability and total moving distance were tested by behavioral testing equipment; The thermal pain threshold analgesia was used to evaluate the changes in the thermal pain threshold of rats; Mechanical pain threshold testing was performed using vonFrey fibers; The frozen sections of rat knee cartilage were stained, and the integrity of cartilage structure and pathological changes were observed under a microscope. qPCR was used to detect the changes in gene expression of inflammatory factors in the synovium and cartilage of rat knee joints to evaluate the inhibitory effect of inflammation.

8. A use of bergenin-induced umbilical cord mesenchymal stem cells for treating arthritis, characterized in that: By utilizing the function of inducing stem cells to differentiate into chondrocytes in vitro, the repair of articular cartilage and inhibition of inflammation are achieved through injection into the knee joint cavity, which is suitable for the clinical treatment of arthritis.

9. The use according to claim 8, characterized in that The use of umbilical cord-derived mesenchymal stem cells does not involve ethical issues and has the advantages of sufficient cell sources and safe and simple extraction and culture operations.

Images