Virus-attenuated bovine nodular skin disease virus LSDV-DQ and application thereof

Abstract

The invention discloses a virulence-attenuated bovine nodular skin disease virus LSDV DQ and application thereof, and belongs to the technical field of attenuated strains. The invention aims to provide a bovine nodular skin disease virus vaccine strain which is sufficient in attenuation and good in immune effect. The invention provides a virulence-attenuated bovine nodular skin disease virus strain, which is named as sheep pox virus LSDV-DQ, has the preservation number of CCTCC NO: V2024113, and is preserved in the China Center for Type Culture Collection on December 2, 2024. The vaccine strain provided by the invention can be used as a vaccine candidate strain for safely and effectively preventing and controlling bovine nodular dermatosis.

Description

Technical Field

[0001] The invention belongs to the technical field of attenuated virus strains, and in particular relates to a virulence-attenuated bovine lumpy skin disease virus LSDV-DQ and an application thereof. Background Art

[0002] Lumpy skin disease (LSD) is an important infectious disease of cattle. The disease is caused by Lumpy skin disease virus (LSDV), which belongs to the Poxviridae family and is part of the Capripoxvirus genus along with Sheeppox virus (SPPV) and Goatpox virus (GTPV). 5 virus). Currently, there is no commercialized vaccine for this disease, and most research is focused on inactivated vaccines. However, inactivated vaccines are expensive and have poor immune effects, and require human intervention for inactivation. Therefore, it is necessary to provide a vaccine strain with a good immune effect. Summary of the invention

[0003] The purpose of the present invention is to provide a bovine nodular dermatosis virus vaccine strain with sufficient attenuation and good immune effect.

[0004] The present invention provides a attenuated bovine lumpy skin disease virus strain (Lumpy skin disease virus) LSDV-DQ, named as sheep pox virus LSDV-DQ, with a preservation number of CCTCC NO: V2024113, deposited in the China Center for Type Culture Collection, and the preservation date is December 2, 2024.

[0005] The present invention provides an attenuated vaccine of bovine nodular dermatitis virus, which comprises the bovine nodular dermatitis virus strain.

[0006] It is further defined that the vaccine is a monovalent or a multivalent vaccine.

[0007] It is further defined that the vaccine further comprises a pharmaceutically acceptable excipient.

[0008] It is further specified that the vaccine is in the form of an injection.

[0009] It is further defined that the content of bovine nodular skin disease virus is 10 3 TCID 50 -10 6 TCID 50 .

[0010] The present invention provides an application of the bovine nodular dermatitis virus strain in preparing a vaccine for preventing or treating bovine nodular dermatitis.

[0011] It is further defined that the content of the bovine nodular skin disease virus is 10 3 TCID 50 -10 6 TCID 50 .

[0012] Beneficial effect: A safe and attenuated bovine nodular skin disease virus strain LSDV-DQ was obtained; immunization with bovine nodular skin disease virus LSDV-DQ (10 5 TCID 50 ) cattle did not get sick and the nucleic acid and antibody of the cohabiting cattle were negative, indicating that there was no horizontal transmission phenomenon and it was a fully attenuated vaccine strain; the challenge experiment showed that the bovine nodular skin disease virus LSDV-DQ could be effective against 10 6 TCID 50 The strong strain provides 100% immune protection and can be used as a safe and effective vaccine for the prevention and control of bovine nodular dermatitis.

[0013] [Biological Deposit Information]: A weakly virulent bovine lumpy skin disease virus strain (Lumpy skin disease virus), named sheep pox virus LSDV-DQ, with the deposit number of CCTCC NO: V2024113, deposited in the China Center for Type Culture Collection, the deposit date is December 2, 2024, and the deposit address is Wuhan University, Wuhan, China. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 These are the results of inoculating different cells with bovine nodular skin disease virus; Figure A is the result of inoculating BT bovine testicular cells with bovine nodular skin disease virus for 96 hours, Figure B is the result of inoculating LT sheep testicular cells with bovine nodular skin disease virus for 48 hours, and Figure C is the result of inoculating Vero-E6 cells with bovine nodular skin disease virus for 96 hours; Figure 2 This is the result of PCR identification of bovine lumpy skin disease virus after inoculation of cells; Figure 3 The graph is the growth curve result of bovine lumpy skin disease virus; XJ is the bovine lumpy skin disease virus strain LSDV-XJ; DQ is the bovine lumpy skin disease virus strain LSDV-DQ; Figure 4 This is a comparison of the plaque formation results of the newly isolated strain DQ and the strong strain XJ; XJ is the bovine lumpy skin disease virus strain LSDV-XJ; DQ is the bovine lumpy skin disease virus strain LSDV-DQ; Figure 5The figure is the result of body temperature change after inoculation of bovine lumpy skin disease virus; XJ is the bovine lumpy skin disease virus strain LSDV-XJ; DQ is the bovine lumpy skin disease virus strain LSDV-DQ; Figure 6 This is the result of blood detoxification test; XJ is the bovine lumpy skin disease virus strain LSDV-XJ; DQ is the bovine lumpy skin disease virus strain LSDV-DQ; Figure 7 This is the result of detoxification in the eyes; XJ is the bovine nodular skin disease virus strain LSDV-XJ; DQ is the bovine nodular skin disease virus strain LSDV-DQ; Figure 8 This is the result of detoxification in the nose; XJ is the bovine nodular skin disease virus strain LSDV-XJ; DQ is the bovine nodular skin disease virus strain LSDV-DQ; Fig. 9 This is the result of oral detoxification test; XJ is the bovine nodular skin disease virus strain LSDV-XJ; DQ is the bovine nodular skin disease virus strain LSDV-DQ; Fig.10 This is a graph showing the results of neutralizing antibody production after immunization; Fig.11 Results of clinical detoxification after virus attack. DETAILED DESCRIPTION

[0015] LSDV-XJ is recorded in the article "The first isolation and identification of bovine lumpy skin disease virus in my country", Zhang Minmin, 2020, which is the LSDV / China / Xinjiang / 2019 strain (Xinjiang / 2019).

[0016] LSDV-DQ is also called DQ in this application, and LSDV-XJ is also called XJ in this application.

[0017] Example 1. Isolation of bovine lumpy dermatosis virus strain LSDV-DQ 1. Virus isolation: The nodules and scabs of sick cattle are fully ground with a tissue grinder, and the ground supernatant is inoculated into susceptible cells (sheep testicular cells) to isolate the suspected bovine nodular dermatitis virus.

[0018] 2. Identification The suspected bovine nodular skin disease virus obtained in step 1 was inoculated into sheep testicular cells (LT), Vero-E6, and BT bovine testicular cells (BT) for 48 and 96 hours, respectively. The cells showed obvious cytopathic effects ( Figure 1), and then the infected cells were monitored by PCR, the primers were 5'atgagccatccattttccaactc3' (SEQ ID NO.1), 5'tcagtttatcatataagttcc3' (SEQ ID NO.2), the results showed that the cells with cytopathic effects after inoculation could amplify the expected fragment ( Figure 2 ). These results all proved that the isolated virus was LSDV, which was named bovine lumpy skin disease virus strain LSDV-DQ.

[0019] Study on biological characteristics of isolated strains: The bovine nodular skin disease virus strain LSDV-DQ was compared with the LSDV-XJ isolated strain that had been isolated in our laboratory (the first isolation and identification of bovine nodular skin disease virus in my country, Zhang Minmin, 2020). The two strains were infected at 0.5 MOI, and samples were collected and measured at different time points. Finally, the growth curves of the bovine nodular skin disease virus strains LSDV-DQ and LSDV-XJ were consistent, and the highest titers were also close, 10 5.83 TCID 50 / 0.1ml and 10 5.75 TCID 50 / 0.1ml, the bovine nodular skin disease virus strains LSDV-DQ and LSDV-XJ have similar growth trends. Figure 3 In addition, the plaque-forming ability of the two virus strains was compared. The results showed that the bovine nodular skin disease virus strain LSDV-DQ formed smaller plaques, which were 280 microns and 440 microns respectively ( Figure 4 ).

[0020] Example 2. Application of bovine nodular dermatosis virus strain LSDV-DQ 1. Detoxification experiment: The bovine nodular dermatosis virus strain LSDV-DQ (LSDV-DQ group) of Example 1 was injected with a high dose of 10 5 TCID 50 The inoculated cattle (n=4) were compared with the virulent strain LSDV-XJ (LSDV-XJ group) (n=5), and the condition (mentality and diet) of the experimental cattle were observed and the body temperature was measured every day.

[0021] The results showed that after inoculation with the bovine nodular dermatosis virus strain LSDV-DQ, two cows developed fever, and the fever was only at the critical value of 39.5°C; while all cows in the LSDV-XJ group developed fever, and some had fevers higher than 40°C, such as Figure 5 The detoxification process is shown in Figure 6-Figure 9 As shown, the viral load in each type of samples in the LSDV-DQ group was lower than that in the LSDV-XJ group.

[0022] 2. Immunization experiment: 10 experimental cattle were divided into two groups, one was a PBS control group and the other was a LSDV-DQ group. Each cattle was inoculated subcutaneously with 10 3 TCID 50 .

[0023] One immunization with the bovine nodular dermatitis virus strain LSDV-DQ can produce an ideal level of neutralizing antibodies. In the second week after immunization, all experimental cows produced neutralizing antibodies. By the fourth week after immunization, the highest antibody titer could reach 1:28 ( Fig.10 ).

[0024] 3. Challenge experiment: In the fourth week after immunization, the challenge was carried out subcutaneously, with a challenge dose of 10 6 TCID 50 After the challenge, the clinical status of the experimental cattle was observed, and anticoagulated blood was collected for quantitative PCR testing. The results showed that after the challenge, the cattle in the immune group ate normally, showed no symptoms of depression, and no nodules; while the PBS group showed typical LSD symptoms. For the anticoagulation test, the results are as follows Fig.11 As shown, the highest viral load in the LSDV-DQ group was only 56 copies, which was significantly lower than the 15,511 copies in the PBS unimmunized group.

[0025] Example 3. Preparation of live vaccines Live vaccine: The bovine nodular dermatitis virus strain LSDV-DQ was used as a live vaccine, and LT cells were infected with 0.5 MOI to reproduce the virus, and a large number of vaccine strains were obtained, all of which were bovine nodular dermatitis virus strains.

[0026] Example 4. Preparation of freeze-dried virus vaccine strains The bovine nodular dermatitis virus strain LSDV-DQ was used to infect LT cells with an MOI of 0.5 for virus propagation. The virus was collected after 5-7 days, and the cells were repeatedly frozen and thawed three times at -70°C. Then, the cells were centrifuged at 5000 rpm to remove the cell debris. The remaining supernatant was mixed with a lyophilizing protective agent in a ratio of 1:1, divided into penicillin bottles, first placed at -20°C for 6 hours, at -80°C for 4 hours, and then placed in a freeze dryer (-40°C) for 24 hours to obtain the freeze-dried virus vaccine strain.

Claims

1. A strain of attenuated bovine lumpy skin disease virus, characterized in that: It is named as sheeppox virus LSDV-DQ, the deposit number is CCTCC NO: V2024113, and it is deposited in the China Center for Type Culture Collection, and the deposit date is December 2, 2024.

2. A bovine nodular dermatosis virus attenuated vaccine, characterized in that: The vaccine comprises the bovine nodular dermatitis virus strain of claim 1.

3. The vaccine according to claim 2, characterized in that The vaccine also includes pharmaceutically acceptable excipients.

4. The vaccine according to claim 2, characterized in that The vaccine is in the form of an injection.

5. The vaccine according to claim 2, characterized in that The content of bovine lumpy skin disease virus is 10 3 TCID 50 -10 6 TCID 50 .

6. Use of the bovine nodular dermatitis virus strain according to claim 1 in the preparation of a vaccine for preventing or treating bovine nodular dermatitis.

7. The use according to claim 6, characterized in that: The content of the bovine nodular skin disease virus is 10 3 TCID 50 -10 6 TCID 50 .

Images