SgRNA for pedigree tracing by targeting Rosa26 gene and application of sgRNA

Abstract

The invention belongs to the technical field of gene engineering, and discloses sgRNA for pedigree tracing of a targeted Rosa26 gene, the sgRNA comprises sgRNA1, sgRNA2, sgRNA5, sgRNA6 and sgRNA7, and the nucleotide sequences of corresponding DNA double strands of the sgRNA1, the sgRNA2, the sgRNA5, the sgRNA6 and the sgRNA7 are sequentially shown as SEQ ID NO: 1-2, SEQ ID NO: 3-4, SEQ ID NO: 5-6, SEQ ID NO: 7-8 and SEQ ID NO: 9-10. The sgRNA can target a mouse Rosa26 gene, is combined with a CRISPR / Cas9 targeting vector, and can cut different sites of the Rosa26 gene to generate different bar codes, the diversity of the obtained bar codes can be used for reconstructing a cell lineage and tracing the cell lineage, meanwhile, the transcription of the Rosa26 gene is not influenced after cutting, and the cell lineage relationship can be comprehensively tracked in a complex cell system.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to an sgRNA targeting the Rosa26 gene for lineage tracing and an application thereof. Background Art

[0002] Lineage tracing is a technology that can track the fate of a single cell and reveal all its descendants. When a cell is labeled, the label can be passed on to all its descendants and form a series of clones. Lineage tracing can provide biological characteristics of the descendants of the labeled cell, such as cell expression profile characteristics, differentiation status, and other information, providing a powerful means for studying tissue development, homeostasis, disease, and especially the map of cell fate determination. Understanding the fate map of cells during the life of an organism is one of the basic problems in biology and the core of developmental biology. The mapping of cell fate maps originated from the early visual tracking of cells during embryonic development and mapping cells to different stages of embryonic development. In recent years, the development of CRISPR / Cas9 gene editing technology and single-cell technology, including single-cell lineage tracing and single-cell transcriptome sequencing, has greatly promoted people's understanding of cell-fate-lineage and solved many biological problems that could not be answered before. Single-cell lineage tracing simulates the lineage of cells through bioinformatics analysis, while barcode-based lineage tracing technology directly uses barcodes to track real cell lineage information. Combined with single-cell transcriptome information, it can more accurately analyze the lineage and molecular characteristics of cells in multiple dimensions, and is an effective tool for analyzing the mechanism of cell heterogeneity. The reported CRISPR / Cas9-based dynamic lineage tracing technologies all rely on targeted cutting of exogenous gene sequences of transgenes, but randomly inserted barcodes are prone to cell abnormalities, and exogenous barcode editing sites will be silenced, affecting single-cell sequencing readout and losing lineage information. In 2019, a study used base editors to edit endogenous genes to reconstruct cell lineages, but unstable editing efficiency, scattered editing, and sequencing length all limited its application. Existing methods all require the use of constitutively expressed Cas9 and the use of multiple target barcode arrays to generate diversity, which requires each embryo operation to produce different mouse strains. Moreover, random insertion requires transgenes, and if the number of transgenes is very high, the resulting mice cannot reproduce. The limitations of these models make further use in adults and cell lineage tracing difficult. Summary of the invention

[0003] The purpose of the present invention is to provide an endogenous barcode tracing system based on specific sgRNA, which can be applied to single mouse cells for lineage tracing.

[0004] The above-mentioned purpose is achieved by the following technical solutions.

[0005] In a first aspect, the present invention provides an sgRNA targeting the Rosa26 gene for lineage tracing, wherein the sgRNA includes sgRNA1, sgRNA2, sgRNA5, sgRNA6 and sgRNA7, and the nucleotide sequences of the corresponding DNA double strands are shown in SEQ ID NO: 1-2, SEQ ID NO: 3-4, SEQ ID NO: 5-6, SEQ ID NO: 7-8, and SEQ ID NO: 9-10, respectively.

[0006] The second aspect of the present invention provides a recombinant plasmid containing a double-stranded DNA corresponding to the sgRNA targeting the Rosa26 gene for lineage tracing as described above.

[0007] In some embodiments, the connection order of the sgRNA in the recombinant plasmid is sgRNA1, sgRNA2, sgRNA5, sgRNA6, and sgRNA7.

[0008] A third aspect of the present invention provides a use of the sgRNA as described above or the recombinant plasmid as described above in cell lineage tracing.

[0009] A fourth aspect of the present invention provides a mouse embryonic stem cell line into which a double-stranded DNA corresponding to the sgRNA as described above is inserted.

[0010] A fifth aspect of the present invention provides a mouse embryonic stem cell line into which a double-stranded DNA corresponding to the sgRNA as described above and a CRISPR / Cas9 targeting vector are inserted.

[0011] In some embodiments, the CRISPR / Cas9 targeting vector is a pPGK-Puro-pCAG-rtTA-pTRE-Cas9-3×FLAG plasmid.

[0012] A sixth aspect of the present invention provides a use of the mouse embryonic stem cell line as described above in cell lineage tracing.

[0013] A seventh aspect of the present invention provides a method for constructing a mouse embryonic stem cell line, comprising the following steps:

[0014] Design and synthesize the DNA double-stranded sequence corresponding to the sgRNA for the Rosa26 gene, and construct the sgRNA recombinant plasmid; wherein the sgRNA includes sgRNA1, sgRNA2, sgRNA5, sgRNA6 and sgRNA7, and the nucleotide sequences of the corresponding DNA double-strands are shown in SEQ ID NO: 1-2, SEQ ID NO: 3-4, SEQ ID NO: 5-6, SEQ ID NO: 7-8, and SEQ ID NO: 9-10 respectively;

[0015] Transform the sgRNA recombinant plasmid into mouse embryonic stem cell lines.

[0016] In some embodiments, in the double-stranded DNA corresponding to the sgRNA, a caccg sequence is added to the 5′ end of the sense strand, and a gtggc sequence is added to the 3′ end of the complementary strand.

[0017] In the present invention, by constructing 5 sgRNAs with specific sequences, and constructing the DNA sequences corresponding to the 5 sgRNAs into a tandem structure through a vector and transferring them into a cell line, the sgRNA can target the mouse Rosa26 gene. Combined with the CRISPR / Cas9 targeting vector, different sites of the Rosa26 gene can be cut to generate different barcodes, and different cutting efficiencies can be achieved, thereby effectively avoiding the deletion of large gene fragments and greatly increasing the barcode diversity. The obtained barcode diversity can be used to reconstruct cell lineages and for cell lineage tracing. At the same time, the cutting will not affect the transcription of the Rosa26 gene, and the cell lineage relationship can be fully tracked in a complex cell system. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 A is the expression of Rosa26 loci in mouse basal bodies. Figure 1 B is to design sgRNA upstream of the 3' end of NR_027008.1 and NR_027009.1.

[0019] Figure 2 A is a single sgRNA activity analysis experimental scheme; Figure 2 B is the library construction process of PCR amplification of the cutting site; Figure 2 C is a graph showing the changes in the cutting ratio of different editing sites as Dox treatment time increases;

[0020] Figure 2 D is the effect of induced cleavage and tailing signals; Figure 2 E is a graph showing the change in the proportion of cells cut as Dox treatment time increases; Figure 2 F is a graph showing the changes in barcode diversity as Dox treatment time increases.

[0021] Figure 3 A is a diagram of promoter pCAG and inducible promoter pTRE expressing rtTA and Cas9 respectively; Figure 3 B is to connect the five sgRNAs obtained by screening in series and construct them into the pGGA vector together with pPGK-Blast; Figure 3 The upper figure in C is a schematic diagram of endogenous barcode generation, and the lower figure is the experimental process of generating endogenous barcodes for pedigree analysis; Figure 3 D is the barcode generation status after Dox induced barcode editing for 16 days. Figure 3 E is the expression of the Rosa26 locus gene under different barcode induction times.

[0022] Figure 4 A is a lineage tree of the cell division process drawn by bioinformatics analysis (left: lineage relationship of barcodes, nodes represent the generation of a new lineage branch. Right: barcode cutting type); Figure 4 B is a schematic diagram of lineage reconstruction, in which the lineage reconstruction is performed through the accumulation process of barcodes generated by the CRISPR / Cas9 system, and all barcodes are accumulations of starting barcodes; Figure 4 C is the barcode that can be tracked during the entire experiment. As the Dox treatment time increases, the number of barcodes that can be dynamically tracked increases.

[0023] Figure 5 A shows different types of editing results at the Rosa26 site after 16 days of Dox treatment; Figure 5 B is that different targeted sites in the Rosa26 gene region present different editing states; Figure 5 C is a chord diagram of the barcode gene editing results of Rosa26 locus before Dox induction and 4 days, 12 days, and 16 days after induction. The barcode diversity increases with the extension of treatment time; Figure 5 D is the distribution diagram of Rosa26 mutation frequency as Dox treatment time increases.

[0024] Figure 6 A is a lineage tree using highly diverse barcodes to map the cell division process; Figure 6 B is a schematic diagram of lineage reconstruction. The barcode of the CRISPR / Cas9 target site is gradually edited during many cell divisions. In order to reconstruct the lineage tree, the edited barcode sequences are related to each other based on shared mutations.

[0025] Figure 7 This is the PB-5×U6-sgRNA-PGK-BSD plasmid map. DETAILED DESCRIPTION

[0026] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0027] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0028] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0029] The following specific embodiments are used to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0030] Example 1

[0031] 1. Cell Culture

[0032] The cells used in this example are mouse embryonic stem cells (mESCs). The culture medium of mESCs cells is DMEM culture medium containing 15% fetal bovine serum (Gibco), 1% non-essential amino acids (Gibco), 1% L-glutamine (Gibco), 1% sodium pyruvate (Gibco), β-mercaptoethanol (0.1mM, Gibco), LIF (1000units / mL) and 2i (3μM CHIR99021, 1μM PD0325901). The cells were cultured in a cell culture incubator at 37°C and 5% CO2.

[0033] 2. Construction of inducible CRISPR / Cas9 system and PB-5×U6-sgRNA vector

[0034] 2.1 Construct a single-plasmid inducible CRISPR / Cas9 system targeting vector pPGK-Puro-pCAG-rtTA-pTRE-Cas9-3×FLAG according to conventional methods.

[0035] 2.2 Construction of PB-5×U6-sgRNA-PGK-BSD plasmid:

[0036] Based on the results of previous bioinformatics analysis, the inventors used the Rosa26 gene as a candidate gene for endogenous barcode generation sites, and screened the cleavage sites according to the expression level of each site of the Rosa26 gene, such as Figure 1 As shown in A, the Rosa26 locus in the mouse matrix is ​​widely expressed, among which NR_027008.1 and NR_027009.1 are expressed at relatively high levels, and their 3' end sequences are identical. Therefore, five sgRNA cleavage sites were screened within 350 bp upstream of the 3' ends of the Rosa26 loci NR_027008.1 and NR_027009.1, and five sgRNAs were designed based on the five cleavage sites, as shown in FIG. Figure 1 As shown in B, sgRNAs were designed upstream of the 3' end of NR_027008.1 and NR_027009.1: 1#, 2#, 5#, 6#, 7# (among which 6# was subjected to point mutation to reduce activity and prevent it from affecting the tailing signal; 7# had no PAM region and was used as a blank control. Since there were 5 U6-sgRNA repeat structures with different cleavage activities, according to the NEB Golden gate assembly The multiple fragment ligation design website (https: / / goldengate.neb.com / ) provided by the kit (BsaI-HFv2) (NEB#E1601L) was used to amplify each fragment and introduce the ligation site. The ligation reaction was carried out in a PCR instrument [(37℃ / 1min→16℃ / 1min)×30cycles, →60℃ / 5min], constructed into the pGGA vector provided by the kit, and then ligated to the PB transposon vector after being digested by the designed restriction site (EcoRI) to form the PB-5×U6-sgRNA-PGK-BSD plasmid (the sgRNA ligation order is sgRNA1, sgRNA2, sgRNA5, sgRNA6, sgRNA7) (PB-5×sgRNA). The plasmid map is shown below. Figure 7 shown.

[0037] The nucleotide sequences of the double-stranded DNA corresponding to the five sgRNAs are as follows, wherein the first five bases are the restriction site sequence, the first five bases at the 5′ end of the specific sense strand are the caccg sequence, the first five bases at the 3′ end of the complementary strand are the gtggc sequence, and the sequence after the restriction site is the specific nucleotide sequence of the sgRNA:

[0038]

[0039] 3. Establishment of Stable Cell Lines of Inducible Endogenous Barcoded Lineage-Tracing Mouse Embryonic Stem Cells

[0040] The constructed inducible CRISPR / Cas9 system targeting vector was electroporated into mouse embryonic stem cells (purchased from Saiye Biotech Co., Ltd.), and inserted into the mouse embryonic stem cell Hipp11 safe site by conventional gene editing technology. Positive clones were selected by Puromycin (Puro) screening. Then, Dox was added to induce Cas9 expression, and the expression of CRISPR / Cas9 system at the mRNA level was detected by RT-qPCR [95℃ / 10min→(95℃ / 10s→60℃ / 30s)×40cycles→95℃ / 15s→60℃ / 1min→50℃ / 30s]. FLAG expression was detected at the protein level by Western Blot, and the CRISPR / Cas9 insertion site was identified at the genomic level to obtain a cell line stably expressing the CRISPR / Cas9 system.

[0041] The targeting vector of the transposon PB-5×U6-sgRNA-PGK-BSD and the PB transposase (PBase) were then electroporated into a cell line stably expressing the CRISPR / Cas9 system. Under the action of PBase, PB-5×U6-sgRNA-PGK-BSD was randomly integrated into the cell genome and screened by Blasticidin (BSD). Because the PB transient plasmid would not replicate in the cell, PBase would gradually degrade during multiple subcultures as the cells proliferated, and would be basically degraded after about two generations.

[0042] Obtain the Hipp11-Cas9-PB-5×sgRNA mouse embryonic stem cell line.

[0043] Rosa26 RT-qPCR Primer:

[0044] Rosa26 F1 SEQ ID NO:11 ACTTTTGTGTTGGTGCGAGC Rosa26 R1 SEQ ID NO:12 AAACACGAACAAGTCTGCATTT Rosa26F2 SEQ ID NO:13 TGACATGTAGAAGTGTTTGTCCA Rosa26R2 SEQ ID NO:14 TGCTCGCACCAACACAAAAG Rosa26F3 SEQ ID NO:15 TGAACATTTCCCCAAAGTTCCAA Rosa26R3 SEQ ID NO:16 TGTTCTGGACAAACACTTCTACA Rosa26F4 SEQ ID NO:17 TCCATGCAATGTGTTATGCAAT Rosa26R4 SEQ ID NO:18 GGAACTTTGGGGAAATGTTCAA

[0045] 4. Single sgRNA cutting efficiency detection

[0046] The five designed sgRNAs were cloned into lentiviral vectors with inducible Cas9 and then transferred into mouse embryonic stem cells via lentivirus. Figure 2 As shown in A, five cells transformed with the inducible CRISPR / Cas9 system were treated with serum + 2i / LIF + / - Dox, passaged every two days, and 105 cells were plated each time. The genomes of cells on D2, D4, D6, D8, D10, D12, D14, and D16 were collected, and the barcode sites (Rs26-cDNA-F1, Ro26-LBgDNA-R1) were amplified by PCR for next-generation sequencing.

[0047]

[0048] Specific as Figure 2 B shows the flow chart of PCR amplification and library construction of the cutting site. First, the UMI is introduced through a single annealing PCR to distinguish the genomic template, and then the product is purified. The purified product is PCR amplified through the constant region outside the UMI to construct the library.

[0049] like Figure 2 As shown in C-2F, the cutting ratio of different editing sites increases with the extension of Dox treatment time, and there are differences in the cutting efficiency of different sites (the higher the difference in cutting efficiency, the lower the possibility of large fragment deletion, and large fragment deletion will lead to a decrease in barcode diversity), and induced cutting does not affect the tailing signal. As the Dox treatment time increases, the proportion of cells cut continues to increase, and the barcode diversity continues to increase.

[0050] The five sgRNAs finally screened can lead to different cutting efficiencies, among which sgRNA1 and sgRNA2 have high activities, while sgRNA5 has low activity.

[0051] 5. Multiple sgRNA cleavage produces mutation accumulation and lineage analysis detection

[0052] The Hipp11-Cas9-PB-5×sgRNA cell line was treated with + / -Dox, and the culture medium was serum + 2i / LIF. It was continuously passaged, with 105 cells plated at each passage. The cells were collected at D0, D4, D8, D12, and D16 to extract the genome, and the Rosa26 barcode editing site (Rs26-cDNA-F1, Ro26-LBgDNA-R1) was amplified by PCR for next-generation sequencing.

[0053] The data were screened and compared, and the phylogenetic tree was constructed using the Camin-Sokal maximum parsimony method, such as Figure 4 The results showed that the endogenous barcode generation system can associate cells at different time points for lineage development tree drawing. In order to further test the applicability of barcode application to lineage reconstruction, the generation form, editing results and diversity of barcodes were analyzed. Figure 5-Figure 6 As shown, the diversity of endogenous barcodes is sufficient to reconstruct cell lineages.

[0054] 6. Genome-level barcode detection method

[0055] Two-step PCR was used for the cleavage site of Rosa26. The first step was single-strand amplification PCR, using a high-fidelity enzyme (Vazyme, P505) for single-primer PCR (Rs26-gDNA-L-R5), in which Constantsequence (GTAGCCATGTCGTTCTG), Sample index (TTCGCACC), and Unique molecular identifiers (UMI, NNNNNNNNNN) were added to the 5' end of the PCR primer after one-step denaturation and 10 non-denaturation cycles (only annealing and extension cycles for single-strand amplification), added to the target sequence, and then purified and recovered (QIAGEN, MinElute PCR purification kit), and all purified products were used as templates for the second step PCR. The second step was conventional PCR, the upstream primer (Rosa26-LRg-F3) was the sequence on the genome, and the downstream primer (Rs26-gDNA-L-R4) used the designed introduction sequence Constant sequence, 30 cycles, the target fragment size was 367bp, and then second-generation sequencing was performed. The results are as follows Figure 3 shown.

[0056]

[0057] in Figure 3 middle, Figure 3 A shows the Hipp11 safe site in the mouse embryonic stem cell genome, where Dox-inducible CRISPR / Cas9 system elements are inserted, including pCAG-rtTA and pTRE-Cas9 ( Figure 3 A), thereby establishing a mouse embryonic stem cell line that can stably induce expression of CRISPR / Cas9. Figure 3 B shows that five tandem sgRNAs were randomly integrated into the genome of mouse embryonic stem cells using the PB transposition system, and a cell line that stably generated endogenous barcodes was obtained through screening. Figure 3 C- Figure 3 E shows that by detecting the cleavage of the Rosa26 site under Dox treatment conditions, it is proved that the designed endogenous barcode generation system can cleave the Rosa26 site to generate a barcode and will not affect the transcription of the Rosa26 site.

[0058] In summary, the endogenous barcode formed by this sgRNA can target the mouse Rosa26 gene. Combined with the CRISPR / Cas9 targeting vector, different sites of the Rosa26 gene can be cut to generate different barcodes. The diversity of the obtained barcodes can be used to reconstruct cell lineages and for cell lineage tracing. At the same time, the cutting will not affect the transcription of the Rosa26 gene, and the cell lineage relationship can be fully tracked in complex cell systems.

[0059] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0060] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A sgRNA targeting the Rosa26 gene for lineage tracing, characterized in that: The sgRNA includes sgRNA1, sgRNA2, sgRNA5, sgRNA6 and sgRNA7, and the nucleotide sequences of the corresponding DNA double strands are shown in SEQ ID NO: 1-2, SEQ ID NO: 3-4, SEQ ID NO: 5-6, SEQ ID NO: 7-8, and SEQ ID NO: 9-10, respectively.

2. A recombinant plasmid containing a double-stranded DNA corresponding to the sgRNA targeting the Rosa26 gene for lineage tracing as described in claim 1.

3. The recombinant plasmid according to claim 2, characterized in that The connection order of the sgRNAs in the recombinant plasmid is sgRNA1, sgRNA2, sgRNA5, sgRNA6, and sgRNA7.

4. Use of the sgRNA according to claim 1 or the recombinant plasmid according to claim 2 or 3 in cell lineage tracing.

5. A mouse embryonic stem cell line into which a double-stranded DNA corresponding to the sgRNA according to claim 1 is inserted.

6. A mouse embryonic stem cell line inserted with a double-stranded DNA corresponding to the sgRNA according to claim 1 and a CRISPR / Cas9 targeting vector.

7. The mouse embryonic stem cell line according to claim 6, characterized in that The CRISPR / Cas9 targeting vector is a pPGK-Puro-pCAG-rtTA-pTRE-Cas9-3×FLAG plasmid.

8. Use of the mouse embryonic stem cell line according to any one of claims 5 to 7 in cell lineage tracing.

9. A method for constructing a mouse embryonic stem cell line, characterized in that: The steps include: Design and synthesize the DNA double-stranded sequence corresponding to the sgRNA for the Rosa26 gene, and construct the sgRNA recombinant plasmid; wherein the sgRNA includes sgRNA1, sgRNA2, sgRNA5, sgRNA6 and sgRNA7, and the nucleotide sequences of the corresponding DNA double-strands are shown in SEQ ID NO: 1-2, SEQ ID NO: 3-4, SEQ ID NO: 5-6, SEQ ID NO: 7-8, and SEQ ID NO: 9-10 respectively; Transform the sgRNA recombinant plasmid into mouse embryonic stem cell lines.

10. The construction method according to claim 9, characterized in that: In the DNA double strand corresponding to the sgRNA, a caccg sequence is added to the 5′ end of the sense strand, and a gtggc sequence is added to the 3′ end of the complementary strand.

Images