SmSNR gene and application thereof in increasing content of salvianolic acid in salvia miltiorrhiza

Abstract

The invention relates to a SmSNR gene and application thereof in increasing the content of salvianolic acid in salvia miltiorrhiza. The nucleotide sequence of the SmSNR gene is shown as SEQ ID No.1. The SmSNR gene is cloned in the salvia miltiorrhiza for the first time, it is found that the SmSNR gene plays a negative regulation role in salvianolic acid biosynthesis, and the content of salvianolic acid in the salvia miltiorrhiza can be remarkably increased by knocking out the SmSNR gene in the salvia miltiorrhiza. According to the invention, a SmSNR transcription factor responding to gibberellin induction is screened through transcriptome sequencing analysis, a SmSNR gene knockout vector is constructed by using a CRISPR / Cas9 technology, and a gene knockout hairy root is obtained through transformation; expression of key enzyme genes in a salvianolic acid downstream synthesis route can be activated by knocking out the SmSNR gene in the radix salviae miltiorrhizae, so that the content of salvianolic acid in the radix salviae miltiorrhizae, especially the content of salvianolic acid B and rosmarinic acid, is effectively increased, and the SmSNR gene has high application value and research value.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular biology and genetic engineering, and in particular to a SmSNR gene and application thereof in increasing the content of salvianolic acid in salvia miltiorrhiza. Background Art

[0002] Salvia miltiorrhiza Bge. is a perennial herbaceous plant of the genus Salvia of the family Lamiaceae. It was first recorded in the "Shennong Herbal Classic" of the Han Dynasty. It tastes bitter and is slightly cold in nature. Its dried roots and rhizomes are used as medicine. As one of the most widely cultivated bulk medicinal materials in my country, Salvia miltiorrhiza has the effects of removing blood stasis and relieving pain, promoting blood circulation and dredge menstruation, and is widely used in the treatment of various cardiovascular and cerebrovascular diseases such as angina pectoris, acute cerebral infarction, and coronary heart disease, and has a wide range of clinical application prospects. Salvianolic acid substances are the main components of Salvia miltiorrhiza that play the role of promoting blood circulation and removing blood stasis. In recent years, it has also been found that it has multiple pharmacological activities such as anti-tumor, anti-inflammatory, antibacterial and antiviral, and scavenging free radicals, and has extremely high medicinal value. As an important medicinal and edible species, Salvia miltiorrhiza has been developed into a variety of health foods, such as Salvia miltiorrhiza tea, Salvia miltiorrhiza and Gastrodia capsules, Salvia miltiorrhiza aminochondroitin tablets, etc. These products have the effects of promoting blood circulation and removing blood stasis, regulating blood lipids, and increasing bone density, and have broad market value.

[0003] However, in recent years, due to the serious degradation of Salvia miltiorrhiza germplasm resources, the content of salvianolic acid in Salvia miltiorrhiza medicinal materials from different production areas is uneven and the quality varies greatly. Therefore, it is of great research significance and application prospect to stably increase the content of medicinal ingredients in Salvia miltiorrhiza. Knocking out or overexpressing transcription factors in Salvia miltiorrhiza through genetic engineering is to improve the quality of Salvia miltiorrhiza from a genetic perspective and increase the content of medicinal ingredients in Salvia miltiorrhiza. According to previous reports, MYB family transcription factors play an important role in the biosynthesis of salvianolic acid, but different transcription factors may have different effects on the synthesis of salvianolic acid. SmMYB52 can activate the key enzyme genes in the biosynthesis of salvianolic acid and positively regulate the accumulation of salvianolic acid, but SmMYB36 has the opposite function. Overexpression of SmMYB36 will inhibit the accumulation of salvianolic acid in Salvia miltiorrhiza hairy roots. Therefore, in order to actually solve the problem of low germplasm of Salvia miltiorrhiza and low content of salvianolic acid in Salvia miltiorrhiza, it is very necessary to find a new method to increase the content of medicinal ingredients in Salvia miltiorrhiza. Summary of the invention

[0004] In order to overcome at least one problem existing in the prior art, the present invention provides a SmSNR gene responsive to gibberellin stimulation and its application in increasing the content of salvianolic acid in Salvia miltiorrhiza. The present invention screens the MYB family transcription factor SmSNR of Salvia miltiorrhiza responsive to gibberellin induction by stimulating Salvia miltiorrhiza with gibberellin, and by knocking out the SmSNR gene in Salvia miltiorrhiza, the expression of key enzyme genes in the downstream synthesis pathway of salvianolic acid can be activated to significantly increase the accumulation of salvianolic acid content in Salvia miltiorrhiza. The above method well solves the problems of low germplasm of Salvia miltiorrhiza and low content of salvianolic acid in Salvia miltiorrhiza.

[0005] To achieve the above object, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention is to provide a SmSNR gene, which regulates the biosynthesis of salvianolic acid in response to gibberellin stimulation, and the nucleotide sequence of the SmSNR gene is shown in SEQ ID No.1.

[0007] Furthermore, the primer sequences used for PCR amplification of the SmSNR gene are shown in SEQ ID No.10 to SEQ ID No.11.

[0008] Furthermore, the primer sequences used for qRT-PCR detection of the SmSNR gene are shown in SEQ ID No.12 to SEQ ID No.13.

[0009] Furthermore, the primer sequences used to construct the subcellular localization vector containing the SmSNR gene sequence are shown in SEQ ID No. 14 to SEQ ID No. 15. Preferably, the subcellular localization vector is a pEAQ-SmSNR-GFP vector containing the SmSNR target sequence.

[0010] The second aspect of the present invention is to provide a protein encoded by the SmSNR gene as described in any one of the first aspects, and its amino acid sequence is shown in SEQ ID No.2.

[0011] The third aspect of the present invention is to provide a biological material related to knocking out the SmSNR gene, which includes: an sgRNA sequence of the SmSNR gene sequence, a recombinant vector containing the sgRNA sequence, a recombinant vector for knocking out the SmSNR gene sequence, and a recombinant cell for knocking out the SmSNR gene sequence.

[0012] In the above-mentioned biological material, the open reading frame region of the SmSNR gene is analyzed to find the potential sgRNA of SmSNR, and the preferred sgRNA sequence is shown in SEQ ID No.3. In the above-mentioned biological material, the vector may be a plasmid, a cosmid, a phage or a viral vector, and the vector may be transformed, transduced or transfected into a host cell, and the host cell includes a prokaryotic cell, a fungal cell, an insect cell, an animal cell, etc., such as Escherichia coli, Agrobacterium tumefaciens, etc. The above-mentioned recombinant vector and recombinant cell line can be prepared by conventional methods in the art. Preferably, the recombinant vector containing the sgRNA sequence is a CRISPR / Cas9-At intermediate vector containing the sgRNA sequence, the recombinant vector for knocking out the SmSNR gene sequence is a pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector, and the recombinant cell for knocking out the SmSNR gene sequence is an Agrobacterium tumefaciens for knocking out SmSNR.

[0013] The fourth aspect of the present invention is an application of a SmSNR gene as described in any one of the first aspects, or a biomaterial as described in any one of the third aspects, in increasing the content of salvianolic acid in Salvia miltiorrhiza, which increases the content of salvianolic acid in Salvia miltiorrhiza by targeted knockout of the SmSNR gene in Salvia miltiorrhiza.

[0014] Furthermore, the expression of key enzyme genes in the synthesis pathway of Salvia miltiorrhiza is improved by knocking out the SmSNR gene in Salvia miltiorrhiza. The key enzyme genes include SmPAL, SmTAT, SmC4H, Sm4CL, SmHPPR, SmRAS, SmCYP98A75, and SmCYP98A78. Preferably, the key enzyme genes are SmPAL and SmRAS.

[0015] Furthermore, the salvianolic acid includes salvianolic acid B and rosmarinic acid.

[0016] Furthermore, the CRISPR / Cas9 method was used to knock out the SmSNR gene in Salvia miltiorrhiza.

[0017] Furthermore, the step of knocking out the SmSNR gene in Salvia miltiorrhiza specifically includes:

[0018] Step S1, designing the sgRNA sequence according to the SmSNR gene sequence, and integrating the sgRNA sequence into the intermediate vector containing the CRISPR / Cas9 expression frame;

[0019] Step S2, performing double enzyme digestion on the intermediate vector containing the sgRNA sequence obtained in step S1, and connecting the digestion product to a plant expression vector to obtain a knockout vector;

[0020] Step S3, transforming the knockout vector obtained in step S2 into Agrobacterium tumefaciens competent cells to obtain an Agrobacterium tumefaciens strain containing the knockout vector;

[0021] Step S4, infecting sterile Salvia miltiorrhiza seedling explants with the Agrobacterium tumefaciens strain obtained by transformation in step S3 to obtain Salvia miltiorrhiza SmSNR gene knockout hairy roots.

[0022] Furthermore, in step S1, the sgRNA sequence is shown as SEQ ID No.3.

[0023] Furthermore, in step S1, the intermediate vector containing the CRISPR / Cas9 expression cassette is a CRISPR / Cas9-At vector. Specifically, the CRISPR / Cas9-At vector is driven by the AtU6 promoter, and the restriction site used in the construction process is BbsⅠ.

[0024] Furthermore, in step S1, the primer sequences used to integrate the sgRNA sequence into the intermediate vector containing the CRISPR / Cas9 expression frame are shown in SEQ ID No.4 to SEQ ID No.5.

[0025] Furthermore, in step S1, the construction steps of the CRISPR / Cas9-At vector are: using T4 PNK enzyme to anneal primers of sequences shown in SEQ ID No.4 to SEQ ID No.5; using BbsⅠ to perform single enzyme digestion on CRISPR / Cas9-At; using T4 ligase with full gold to integrate the sgRNA sequence into the CRISPR / Cas9-At intermediate vector.

[0026] Furthermore, in step S1, the annealing system is 10×T4 PNK Buffer 1μL, T4 Polynucleotide Kinase 0.5μL, forward and reverse primers 1μL each, and ddH2O 6.5μL; the reaction conditions are 37°C water bath for 30min, PCR: 95°C, 5min, and then lowering 5°C every 30sec until it drops to 25°C; the single enzyme cutting system is CRISPR / Cas9-At 3μg, BbsⅠ enzyme 3μL, r-Cutsmart 5μL, filled with water to 50μL, and the reaction conditions are 37°C, 4h; the reaction system using T4 ligase is linear psgR-Cas9-At 50ng, annealed sgRNA 1μL, T4 Ligase Buffer 2μL, T4 Ligase 1μL, filled with ddH2O to 10μL, and the reaction conditions are 22°C, 1h.

[0027] Furthermore, in step S2, the plant expression vector is a pCAMBIA1300 plant expression vector, and the knockout vector is a pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector.

[0028] Furthermore, in step S2, the double restriction sites used are: EcoRI and HindIII, and the ligase used is T4 ligase.

[0029] Further, in step S2, the double enzyme digestion system is 3 μg of CRISPR / Cas9-At vector or pCAMBIA 1300 vector containing sgRNA sequence, 3 μL of EcoRI and HindⅢ enzymes, 5 μL of r-Cutsmart, and water is added to 50 μL, and the reaction conditions are 37°C, 4h; the ligation reaction system is 50ng of CRISPR / Cas9-At vector digestion product, 1 μL of pCAMBIA 1300 vector digestion product, 2 μL of T4 Ligase Buffer, 1 μL of T4 Ligase, and ddH2O is added to 10 μL, and the reaction conditions are 22°C, 1h. Further, in step S3, the Agrobacterium tumefaciens is Agrobacterium tumefaciens C58C1. It is understandable that other strains, such as Agrobacterium tumefaciens GV3101, can also be used.

[0030] Further, in step S3, the construction step of the Agrobacterium tumefaciens strain containing the knockout vector specifically includes: taking 2 μL of the above-constructed pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector and adding it to 100 μL of Agrobacterium tumefaciens C58C1 competent cells, ice bathing for 30 minutes, quick freezing in liquid nitrogen for 5 minutes, placing at room temperature for 3 minutes, and heat shocking at 37°C for 5 minutes; adding 500 μL of YEB medium, incubating at 28°C and 200 rpm for 5 hours, and then evenly coating it on YEB solid medium containing kanamycin and rifampicin and culturing it to OD 600 =0.6.

[0031] Furthermore, in step S4, the step of infecting the sterile Salvia miltiorrhiza seedling explants with the Agrobacterium tumefaciens strain specifically includes:

[0032] Step S41, pretreatment of bacterial liquid: resuspend the activated Agrobacterium cells in 1 / 2MS liquid culture medium with a final concentration of 20 μM acetosyringone, and culture at room temperature for 20 minutes;

[0033] Step S42, co-cultivation: Place sterile Salvia miltiorrhiza seedling leaves of appropriate size into the Agrobacterium rhizogenes cultured in step S41, and infect at room temperature for 10 minutes; after the infection, remove the excess bacterial solution, face up, and spread on MS solid culture medium, and incubate in the dark at 25°C for two days;

[0034] Step S43, reducing resistance: after the co-cultivation is completed, the Salvia miltiorrhiza explants are transferred to a 1 / 2MS solid culture medium with a cephalosporin concentration of 500 mg / L, and the resistance is reduced every two weeks;

[0035] Step S44, subculture: separating the grown monoclonal hairy roots for subculture.

[0036] Furthermore, the step S4 also includes the step of performing PCR identification and sequencing on the hairy roots of Salvia miltiorrhiza to determine whether the SmSNR gene is successfully knocked out.

[0037] Furthermore, in PCR identification and sequencing, the primer sequences used for PCR identification of genomic DNA of hairy roots are shown in SEQ ID No.6 to SEQ ID No.7; the primer sequences used for PCR identification of rolB gene of hairy roots are shown in SEQ ID No.8 to SEQ ID No.9.

[0038] Furthermore, in the PCR identification of the genomic DNA of the hairy roots, upstream specific primers were designed within the above-mentioned plant expression vector sequence, and the reverse primer used in the vector construction was used as the downstream specific primer for PCR amplification and sequencing verification.

[0039] Furthermore, the genomic DNA of the hairy roots that were positive in both the genomic DNA test and the rolB gene test was sequenced to confirm whether the SmSNR gene was successfully knocked out.

[0040] The fifth aspect of the present invention is a method for constructing Salvia miltiorrhiza SmSNR gene knockout hairy roots, which adopts the steps of targeted knockout of SmSNR gene in Salvia miltiorrhiza as described in any one of the fourth aspects.

[0041] Compared with the prior art, the present invention adopts the above technical solution to have the following beneficial effects:

[0042] The present invention identifies for the first time that SmSNR is a MYB family transcription factor, and comprehensively applies methods such as vector construction, genetic transformation, molecular detection, qPT-PCR analysis, compound extraction and content determination, to provide a method for increasing the content of salvianolic acid by knocking out the SmSNR gene in Salvia miltiorrhiza, and uses ultra-high performance liquid chromatography (UPLC) and real-time fluorescence quantitative PCR (qRTPCR) to detect the content of salvianolic acid in transgenic hairy roots and the expression of key enzyme genes in its biosynthesis pathway. The results show that knocking out the SmSNR gene in Salvia miltiorrhiza can activate the expression of key enzyme genes in the downstream synthesis pathway of salvianolic acid, thereby effectively increasing the content of salvianolic acid in Salvia miltiorrhiza, especially the contents of salvianolic acid B and rosmarinic acid, which are respectively about 2.21 times and about 1.72 times that of the control group.

[0043] The method constructed by the present invention has low technical difficulty and strong operability, reduces the production cost of salvianolic acid to a certain extent, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] The drawings described herein are used to provide a further understanding of the present invention and constitute a part of the present invention. The exemplary embodiments of the present invention and their descriptions are only used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0045] Figure 1 Schematic diagram of the change in SmSNR expression before and 3 hours after gibberellin stimulation in one embodiment of the present invention;

[0046] Figure 2 Schematic diagram of the analysis results of the conserved domain of SmSNR in one embodiment of the present invention; wherein, it contains two SANT domains;

[0047] Figure 3 1 is a schematic diagram of the result of the SmSNR multiple sequence alignment in one embodiment of the present invention; wherein the red frame area represents the SANT domain;

[0048] Figure 4 is an analysis of MYB evolutionary trees of different species in one embodiment of the present invention; among them, SmSNR is most similar to AtMYB71 and AtMYB79 in Arabidopsis;

[0049] Figure 5 It is a schematic diagram of the results of the SmSNR expression characteristic analysis in one embodiment of the present invention; wherein, Part A: SmSNR tissue expression pattern analysis result diagram; Part B: SmSNR subcellular localization analysis (GFP is green fluorescent protein; BF is bright field; Merged is a combination of green fluorescent protein and bright field);

[0050] Figure 6 It is a schematic diagram of the acquisition and positive identification results of SmSNR transgenic Salvia miltiorrhiza hairy roots in one embodiment of the present invention; wherein, Part A: rooting process; Part B: schematic diagram of knockout vector construction; Part C: quantitative analysis of SmSNR expression in positive hairy roots; Part D: gene editing diagram of target gene target site;

[0051] Figure 7 This is a schematic diagram of the results of the expression detection of key genes in the salvianolic acid synthesis pathway in hairy roots knocked out by SmSNR in one embodiment of the present invention;

[0052] Figure 8 This is a schematic diagram of the results of the change in the content of salvianolic acid in SmSNR knockout hairy roots in one embodiment of the present invention; wherein RA is rosmarinic acid and SAB is salvianolic acid B. DETAILED DESCRIPTION

[0053] The following will be combined with the accompanying drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work belong to the scope of protection of the present invention. The experimental methods without specific conditions in the following embodiments are usually measured according to national standards. The experimental materials without the source indicated in the following embodiments are all commercially available raw materials. The equipment used in each step in the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to the general international standards, conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise specified, all parts are weight parts and all percentages are mass percentages. Unless otherwise defined or specified, all professional and scientific terms used in the present invention have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar or equal to the recorded content can be applied to the method of the present invention.

[0054] It should be noted that, in the absence of conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other. The present invention is further described below in conjunction with the drawings and specific embodiments, but is not intended to be a limitation of the present invention.

[0055] Example 1 - Screening and cloning of the SmSNR gene of Salvia miltiorrhiza

[0056] This example screened and obtained a MYB family transcription factor SmSNR (salvianolic acid negative regulator) that responds to gibberellin stimulation and regulates salvianolic acid biosynthesis, and cloned the gene sequence, which specifically includes the following steps:

[0057] (1) Screening of SmSNR genes in Salvia miltiorrhiza;

[0058] Through the previously established transcriptome data of Salvia miltiorrhiza in response to gibberellins (the data is registered with the National Center for Biotechnology Information of the United States, with registration number PRJNA663993), we found the MYB transcription factor (GenBank registration number AGN52058.1) whose expression level decreased after gibberellin induction, named it SmSNR and analyzed and verified it.

[0059] The roots of 2-month-old Salvia miltiorrhiza were stimulated with 100 μM gibberellin (GA), and samples were taken before and 3 h after treatment. 100 mg of each sample was used for RNA extraction using TransZol UP Plus RNA Kit (Beijing Quanshijin Biotechnology Co., Ltd.). The extracted RNA was reverse transcribed into cDNA using TransScript One-Sept gDNA Removal and cDNA Synthcsis SuperMix (Beijing Quanshijin Biotechnology Co., Ltd.). The reaction system was 1000 ng of Salvia miltiorrhiza RNA, 1 μL of Anchore Oligo (dT) 18 Primer, 1 μL of gDNA Remover, 1 μL of TransScript RT / RI Enayme Mix, 10 μL of 2×TS Reaction Mix, and the mixture was made up to 20 μL with water. The reaction conditions were 42°C, 30 min; 85°C, 5 sec. TB was used. Premix Ex TaqTM (Tli RNaseH Plus) (Beijing Quanshijin Biotechnology Co., Ltd.) was used to detect the expression of the SmSNR gene by qRT-PCR. 18S was selected as the internal reference primer. The reaction system was 2 μL of cDNA, 0.4 μL of each forward and reverse primer, 10 μL of 2×Super Mix, and filled to 20 μL with water. The reaction conditions were 94°C, 20 sec; 45 cycles (94°C, 5 sec; 60°C, 15 sec; 72°C, 10 sec;); 95°C, 15 sec; 60°C, 60 sec; 97°C, 1 sec. The above reaction systems and operation steps were all performed according to the instructions of the corresponding kits. The sequences of the qRT-PCR detection primers and internal reference primers are:

[0060] SmSNR-qPCR-F: 5'-CGAAGGCCGTTGGAACAATG-3' (SEQ ID No. 12);

[0061] SmSNR-qPCR-R: 5'-CCATCTGTTCCCCCATCGAG-3' (SEQ ID No. 13);

[0062] 18S-F: 5'-ATGATAACTCGACGGATCGC-3' (SEQ ID No. 32);;

[0063] 18S-R: 5'-CTTGGATGTGGTAGCCGTTT-3' (SEQ ID No. 33).

[0064] The above experimental results are as follows Figure 1As shown, it indicates that the SmSNR gene can respond to the stimulation of GA. The expression level of the SmSNR gene decreased significantly at 3 hours and gradually returned to its original state at 6 hours.

[0065] (2) Cloning of the SmSNR gene of Salvia miltiorrhiza;

[0066] The cDNA obtained by reverse transcription was used as template. FastPfu Fly DNA Polymeras (Beijing Quanshijin Biotechnology Co., Ltd.) were used for PCR amplification. The reaction system consisted of 2 μL cDNA, 1 μL forward and reverse primers, FastPfu Fly DNA Polymeras 1μL, FastPfu Fly Reaction Mix 25μL, water 20μL, reaction conditions are 95℃, 2min; 35 cycles (95℃, 20sec; 55℃, 20sec; 72℃, 1min); 72℃, 5min. The amplification primers are:

[0067] SmSNR-F: 5'-ATGTCTTGGGGTATGGGGTG-3' (SEQ ID No. 10);

[0068] SmSNR-R: 5'-TGGTTTCAATTAAGTAAGGGAAAT-3' (SEQ ID No. 11);

[0069] The nucleotide sequence of the SmSNR gene obtained by the above PCR amplification is shown in SEQ ID No.1, and the translated protein amino acid sequence is shown in SEQ ID No.2.

[0070]

[0071] Example 2-Bioinformatics analysis of the SmSNR gene of Salvia miltiorrhiza

[0072] This example performs biological information analysis on the SmSNR gene of Salvia miltiorrhiza, and the specific steps include:

[0073] The BLAST tool P-BLAST on the NCBI website (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LIN K_LOC=blasthome) was used to analyze the SmSNR gene and predict the domain structure of the gene. The amino acid sequence of SmSNR was compared with the amino acid sequences of the MYB family transcription factors that have been reported so far using MEG5.0 software.

[0074] The above results are Figures 2 to 4 As shown, Figure 2 and Figure 3 The results showed that SmSNR contained two SANT domains and belonged to the R2R3 subfamily; Figure 4 The results showed that SmSNR was most closely related to AtMYB71 in Arabidopsis thaliana and belonged to the R2R3 subfamily.

[0075] Example 3 - Analysis of the expression pattern and subcellular localization of SmSNR gene in Salvia miltiorrhiza

[0076] This example analyzes the gene expression pattern of SmSNR in Salvia miltiorrhiza and verifies its subcellular localization, specifically including the following steps:

[0077] (1) Analysis of the expression pattern of SmSNR gene in Salvia miltiorrhiza;

[0078] Referring to the steps of Example 1, the roots, stems, leaves, and flowers of adult Salvia miltiorrhiza were respectively taken for RNA extraction and reverse transcription into cDNA, and qRT-PCR was performed to detect the expression level of the SmSNR gene, and the primers were: SmSNR-qPCR-F (SEQ ID No. 12) and SmSNR-qPCR-R (SEQ ID No. 13).

[0079] The above test results are as follows Figure 5 As shown in part A, the SmSNR gene was expressed at the highest level in Salvia miltiorrhiza leaves and at the lowest level in Salvia miltiorrhiza flowers.

[0080] (2) Subcellular localization of SmSNR gene in Salvia miltiorrhiza;

[0081] 1) Vector construction

[0082] According to the Salvia miltiorrhiza SmSNR gene sequence obtained by cloning and amplification in Example 1, primers for subcellular localization vector construction were designed (primer sequences are shown in SEQ ID No. 14 to SEQ ID No. 15) for homology arm amplification, and the amplification reaction system and reaction conditions were referred to the steps in Example 1. At the same time, NEB's XhoⅠ and AgeI enzymes were used to double-digest the subcellular localization vector pEAQ-GFP. The enzyme digestion system was 3 μg of pEAQ-GFP plasmid, 3 μL of each of the two enzymes, 5 μL of r-Cutsmart, and filled with water to 50 μL. The reaction conditions were 37°C and 4h. After the enzyme digestion, the full-style gold seamless cloning enzyme was used to connect and construct the pEAQ-SmSNR-GFP vector containing the SmSNR target sequence. The connection system was 1 μL of linear pEAQ-GFP, 2 μL of homology arm amplification product with enzyme cutting sites, 5 μL of Basic Mix, and 2 μL of ddH2O. The reaction conditions were 50°C and 15min. The primer sequences used are as follows:

[0083] SmSNR-GFP-F: 5'-caaaaaagcaggcttctcgagATGTCTTGGGGTATGGGGTGG-3' (SEQ ID

[0084] No.14);

[0085] SmSNR-GFP-R: 5'-ttgctcaccattccaccggtATAAAAATCTAAATTTTGCTGGAAATTAG-3' (SEQ ID No. 15).

[0086] 2) Subcellular localization

[0087] Take 2 μL of the constructed pEAQ-SmSNR-GFP vector and add it to 100 μL of Agrobacterium tumefaciens GV3101 competent cells, place in an ice bath for 30 minutes, freeze in liquid nitrogen for 5 minutes, place at room temperature for 3 minutes, and heat shock at 37°C for 5 minutes; add 500 μL YEB medium, incubate at 28°C, 200 rpm for 5 hours, and evenly spread on YEB solid medium containing kanamycin and rifampicin. At the same time, transfer the pEAQ-GFP empty vector to the competent cells of Agrobacterium tumefaciens GV3101 as a blank control. After the bacteria grow out, pick them into the YEB liquid medium containing kanamycin and rifampicin and culture them until the OD 600=0.8. Collect the bacteria by centrifugation and resuspend them in transient transformation buffer (10mM MgCl2, 10mM MES and 200μM acetosyringone). After standing at room temperature for 2 hours, use a syringe to absorb the more active bacterial solution on the upper part, and then slowly inject it into the back of the tobacco leaf. After the injection, culture it in the dark for 2 to 3 days. Take the tobacco leaf near the injection needle eye on a slide, with the back facing up, soak it with double distilled water, fix the leaf with a cover glass, and observe it using a laser confocal microscope.

[0088] The above results are Figure 5 As shown in part B, the results show that the SmSNR-GFP fusion protein only displays fluorescent signals in the cell nucleus, which indicates that SmSNR is expressed in the cell nucleus, which is consistent with its characteristic of regulating its biological function as a transcription factor.

[0089] Example 4- Obtaining Salvia miltiorrhiza SmSNR gene knockout hairy roots

[0090] This embodiment provides a preferred method for constructing Salvia miltiorrhiza SmSNR gene knockout hairy roots, which specifically includes the steps of:

[0091] (1) Construction of CRISPR / Cas9-At vector;

[0092] The CHOPCHOP website (https: / / chopchop.cbu.uib.no / ) was used to analyze the open reading frame (ORF) region of the SmSNR gene and search for potential sgRNAs for SmSNR. The fragment sequence with the highest score was selected as the sgRNA (SEQ ID No.3), and primers were designed to construct the knockout vector (primer sequences are shown in SEQ ID No.4 and SEQID No.5). The designed primers were annealed using T4 PNK enzyme. The annealing system was 10×T4 PNK Buffer 1μL, T4 Polynucleotide Kinase 0.5μL, 1μL of each forward and reverse primer, 6.5μL of ddH2O, and the reaction conditions were 37℃ water bath for 30min, PCR: 95℃, 5min, and then reduced by 5℃ every 30sec until it dropped to 25℃. At the same time, refer to Example 3 (1) and use BbsⅠ to perform single enzyme digestion on CRISPR / Cas9-At. The reaction conditions are 37°C for 4h, add 1.5μLCPI, mix with a pipette, and incubate at 37°C for 30min. Use T4 ligase with full gold to integrate the sgRNA sequence into the CRISPR / Cas9-At intermediate vector. The reaction system is linear psgR-Cas9-At 50ng, annealed sgRNA 1μL, T4 Ligase Buffer 2μL, T4 Ligase 1μL, and fill to 10μL with ddH2O. The reaction conditions are 22°C for 1h. The constructed vector is driven by AtU6 promoter ( Figure 6 (as shown in Part B of FIG.

[0093] sgRNA: 5'-TTGAACTGCATGCTCGATGG-3' (SEQ ID No. 3);

[0094] SmSNR-Cas9-F: 5'-GATTGTTGAACTGCATGCTCGATGG-3' (SEQ ID No. 4);

[0095] SmSNR-Cas9-R: 5'-AAACCCATCGAGCATGCAGTTCAAC-3' (SEQ ID No. 5).

[0096] (2) Construction of pCAMBIA 1300 vector;

[0097] In reference example 3 (1), pCAMBIA 1300 and the CRISPR / Cas9-At vector containing the sgRNA sequence were double-digested with EcoRⅠ enzyme and HindⅢ enzyme at the same time. After the digestion, the intermediate vector CRISPR / Cas9-At was constructed into the plant expression vector pCAMBIA1300 by T4 ligase (Beijing Quanshijin Biotechnology Co., Ltd.) in reference example 4 (1), to obtain the pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector.

[0098] (3) infection of Salvia miltiorrhiza explants;

[0099] Reference Example 3 The constructed pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector was transferred into Agrobacterium tumefaciens C58C1 competent cells, and the pCAMBIA1300-CRISPR / Cas9 empty vector was transferred into Agrobacterium tumefaciens C58C1 competent cells as a blank control, and then spread onto a YEB solid medium containing kanamycin and rifampicin. After the bacteria grew out, they were selected and cultured into a YEB liquid medium containing kanamycin and rifampicin until OD 600 =0.6. Collect the cells by centrifugation, add 10 mL of 1 / 2MS liquid medium with a final concentration of 20 μM acetosyringone, and slowly culture until OD 600 =1.0 (cultured at room temperature for about 20 minutes). Cut the leaves of sterile Salvia miltiorrhiza seedlings into about 1 cm 2 , and use the cultured Agrobacterium liquid to infect the cut Salvia miltiorrhiza leaves (infection at room temperature for about 10 minutes). After the infection, remove the excess liquid, spread the Salvia miltiorrhiza leaves with the front side facing up on a 1 / 2MS solid culture medium, and incubate in the dark at 25°C for 2 days. After the dark culture, transfer the leaves to a 1 / 2MS solid culture medium containing 500mg / L cephalosporin for dark culture. Then reduce the cephalosporin content in the culture medium every two weeks (250mg / L, 200mg / L, 150mg / L); separate the grown monoclonal hairy roots for subculture. The rooting process of the transgenic Salvia miltiorrhiza hairy roots is as follows: Figure 6 As shown in Part A.

[0100] (4) Identification of knockout strains;

[0101] use Plant Genomic DNA Kit (Beijing Quanshijin Biotechnology Co., Ltd.) was used to extract the genomic DNA of monoclonal hairy roots. Upstream specific primers were designed in the vector pCAMBIA1300 sequence. The reverse primer used during vector construction was used as the downstream specific primer for PCR positive identification. The upstream primer was P2 (SEQ ID No. 6) and the downstream primer was SmSNR-sgRNA-R (SEQ ID No. 7). At the same time, the rolB gene was identified for positive hairy roots. The PCR primers were rolB-F (SEQ ID No. 8) and rolB-R (SEQ ID No. 9). The specific sequence information is as follows:

[0102] P2: 5'-GCGATTAAGTTGGGTAACGC-3' (SEQ ID No. 6);

[0103] SmSNR-sgRNA-R: 5'-CAAGAGCTGTAGATTGAGATG-3' (SEQ ID No. 7);

[0104] rolB-F: 5'-CGAGGGGATCCGATTTGCTT-3' (SEQ ID No. 8);

[0105] rolB-R: 5'-GACGCCCTCCCTCGCCTTCCT-3' (SEQ ID No. 9).

[0106] The genomic DNA of hairy roots that were positive in both identifications was sequenced to confirm whether the knockout was successful and the type of knockout. Figure 6 As shown in part D, a total of 8 SmSNR double-strand knockout Salvia miltiorrhiza hairy roots were obtained in this example.

[0107] Example 5- Expression of key enzyme genes for salvianolic acid biosynthesis in SmSNR gene knockout-positive hairy roots of Salvia miltiorrhiza

[0108] This example studies the expression of key enzyme genes for salvianolic acid biosynthesis in SmSNR gene knockout-positive hairy roots of Salvia miltiorrhiza, which specifically includes the following steps:

[0109] (1) RNA extraction and cDNA synthesis from hairy roots;

[0110] The SmSNR double-strand knockout Salvia miltiorrhiza hairy roots identified as positive in Example 4 were expanded and cultured in a shaking incubator at 25° C. in the dark. The hairy roots were collected after 2 months, and RNA was extracted and reverse transcribed into cDNA according to the method in Example 1. The expression level of the SmSNR gene was detected by qRT-PCR, and the primers were: SmSNR-qPCR-F (SEQ ID No. 12) and SmSNR-qPCR-R (SEQ ID No. 13).

[0111] The above experimental results show that the expression of SmSNR in the hairy roots of Salvia miltiorrhiza knocked out the SmSNR gene was downregulated to varying degrees. The three strains with the most obvious changes were selected for subsequent experiments and numbered as CR-SNR#4, CR-SNR#5, and CR-SNR#7 (as shown in Figure 2). Figure 6 (as shown in Part C of FIG.

[0112] (2) Design and synthesis of quantitative PCR primers;

[0113] Primers were designed using the Primer designing tool website based on the sequences of key enzyme genes SmPAL, SmTAT, SmC4H, Sm4CL, SmHPPR, SmRAS, SmCYP98A75, and SmCYP98A78 in the biosynthesis of salvianolic acid. All primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The primer sequences are as follows:

[0114] Primer name Detailed sequence information (5'-3') SmPAL-F TACCTCGTCGCCCTATGCCAAG(SEQ ID No.16) SmPAL-R ATTGACGCCCATTGTGAGAGTT(SEQ ID No.17) SmTAT-F CAACTGCTGGTCTTCCACAAAC(SEQ ID No.18) SmTAT-R GCGAGCCAAAACGGACA(SEQ ID No.19) SmC4H-F CCAGGAGTCCAAATAACAGAGC(SEQ ID No.20) SmC4H-R GCCACCAAGCGTTCACCAAGAT(SEQ ID No.21) Sm4CL-F TCGCCAAATACGACCTTTCC(SEQ ID No.22) Sm4CL-R TGCTTCAGTCATCCCATACCC(SEQ ID No.23) SmHPPR-F TGACTCCAGAAACAACCCACATT(SEQ ID No.24) SmHPPR-R CCCAGACGACCCTCCACAAG(SEQ ID No.25) SmRAS-F CCAAAGTCAATTATGCCAAGGG(SEQ ID No.26) SmRAS-R GTCGGATAGGTGGTGCTCGT(SEQ ID No.27) SmCYP98A75-F AACTCGAGTAAGAGCCTGCTG(SEQ ID No.28) SmCYP98A75-R CCTGTTGTCAGCAATGGACC(SEQ ID No.29) SmCYP98A78-F TCACCGCCATGGTTGAATCC(SEQ ID No.30) SmCYP98A78-R GTTGTGGAACGCCATTGAT(SEQ ID No.311)

[0115] (3) Expression of key enzyme genes in transgenic hairy roots;

[0116] The above primers were used to detect the expression of key enzyme genes in the biosynthesis of salvianolic acid in hairy roots, and TB The experiment was carried out using the Premix Ex TaqTM (Tli RNaseH Plus) kit (Beijing Quanshijin Biotechnology Co., Ltd.). The results are shown in Figure 7 As shown, in the hairy roots of Salvia miltiorrhiza with the SmSNR gene knocked out, the expression levels of most key enzyme genes involved in the biosynthesis of salvianolic acid increased to a certain extent, among which SmPAL and SmRAS changed most significantly.

[0117] Example 6-UPLC detection of salvianolic acid content in transgenic hairy roots

[0118] This example uses UPLC method to detect the content of salvianolic acid in hairy roots of Salvia miltiorrhiza with SmSNR gene knocked out, which specifically includes the steps of:

[0119] (1) Preparation of standard products;

[0120] Accurately weigh the tannic acid B and rosmarinic acid standards, dissolve them in chromatographic grade methanol to prepare 1 mg / mL standard stock solutions, then take 100 μL of each standard, prepare a 20 μg / mL mixed standard with chromatographic grade methanol, and then dilute them in a gradient with chromatographic grade methanol at a ratio of 1:2. Finally, prepare 8 standard solutions of different concentrations for drawing the standard curve.

[0121] (2) Salvianolic acid extraction;

[0122] The expanded cultured hairy roots were ground into powder using a mortar, 1 mg of the sample was weighed into a 2 mL RNase-free EP tube, 800 μL of 75% ethanol was added, and the sample was allowed to stand overnight at room temperature; the next day, the sample was vortexed and extracted with 60W ultrasound for 40 min, and then centrifuged at 12000×g for 20 min at room temperature; 700 μL of the supernatant was taken into a new 2 mL RNase-free EP tube and placed in a vacuum evaporation concentrator for evaporation; 200 μL of methanol was added for re-dissolution, and the sample was centrifuged at 12000×g for 30 min, and 180 μL of the supernatant was taken into a sample bottle for detection.

[0123] (3) UPLC detection;

[0124] Chromatographic conditions: The chromatographic column is C18, with a particle size of 5 μm, an inner diameter of 250×4.6 mm, and the filling particles are octadecylsilane bonded silica particles. The column temperature is 25°C, the mobile phase A is 0.08% formic acid in water; the mobile phase B is 100% methanol; a gradient elution method is adopted; the mobile phase is ultrasonicated for 5 to 10 min, the flow rate is 1.2 mL / min, and the injection volume is 10 μL.

[0125] The mixed standard with different concentrations prepared in step (1) was injected under the corresponding chromatographic conditions to completely separate the different components and obtain good peak shapes. The spectrum and chromatographic parameters were recorded. The standard curves of salvianolic acid B and rosmarinic acid were obtained by analyzing the peak area (Y) against the concentration of the standard (X, mg / mL). The sample was detected by UPLC, the peak area of ​​each component was recorded, and the peak area was substituted into the linear regression equation to calculate the content of the sample component.

[0126] The results are as follows Figure 8 As shown, in this example, knocking out the SmSNR gene using the CRISPR / Cas9 system can significantly increase the contents of salvianolic acid B and rosmarinic acid in transgenic hairy roots. Among them, the most obvious content was that the content of salvianolic acid B increased from 9.59 mg / g to 21.20 mg / g (about 2.21 times), and the content of rosmarinic acid increased from 12.58 mg / g to 21.68 mg / g (about 1.72 times).

[0127] It can be seen from the above examples that the present invention cloned the SmSNR gene from Salvia miltiorrhiza for the first time, and adopted a metabolic engineering strategy of knocking out the SmSNR gene to obtain a transgenic hairy root system of Salvia miltiorrhiza with high production of salvianolic acid, which provides the possibility for commercial large-scale production of salvianolic acid and also provides an important source for meeting the market demand for salvianolic acid.

[0128] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions made to the present invention are also within the scope of the present invention. Therefore, the equalization changes and modifications made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. A SmSNR gene, characterized in that: The SmSNR gene regulates the biosynthesis of salvianolic acid in response to gibberellin stimulation, and its nucleotide sequence is shown in SEQ ID No.

1.

2. A protein encoded by the SmSNR gene according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID No.

2.

3. A biomaterial related to knocking out the SmSNR gene, characterized in that: The biological material comprises: an sgRNA sequence of the SmSNR gene sequence, a recombinant vector containing the sgRNA sequence, a recombinant vector for knocking out the SmSNR gene sequence, and a recombinant cell line for knocking out the SmSNR gene sequence.

4. A use of the SmSNR gene according to claim 1 or the biomaterial according to claim 3 in increasing the content of salvianolic acid in Salvia miltiorrhiza, characterized in that: The content of salvianolic acid in Salvia miltiorrhiza was increased by targeted knockout of the SmSNR gene in Salvia miltiorrhiza.

5. The use according to claim 4, characterized in that: The step of knocking out the SmSNR gene in Salvia miltiorrhiza specifically includes: Step S1, designing the sgRNA sequence according to the SmSNR gene sequence, and integrating the sgRNA sequence into the intermediate vector containing the CRISPR / Cas9 expression frame; Step S2, performing double enzyme digestion on the intermediate vector containing the sgRNA sequence obtained in step S1, and connecting the digestion product to a plant expression vector to obtain a knockout vector; Step S3, transforming the knockout vector obtained in step S2 into Agrobacterium tumefaciens competent cells to obtain an Agrobacterium tumefaciens strain containing the knockout vector; Step S4, infecting sterile Salvia miltiorrhiza seedling explants with the Agrobacterium tumefaciens strain obtained by transformation in step S3 to obtain Salvia miltiorrhiza SmSNR gene knockout hairy roots.

6. The use according to claim 5, characterized in that: In step S1, the sgRNA sequence is as shown in SEQ ID No. 3; and / or, The intermediate vector containing the CRISPR / Cas9 expression frame is a CRISPR / Cas9-At vector.

7. The use according to claim 5, characterized in that: In step S1, the primer sequences used to integrate the sgRNA sequence into the intermediate vector containing the CRISPR / Cas9 expression frame are shown in SEQ ID No.4 to SEQ ID No.

5.

8. The use according to claim 5, characterized in that: In step S2, the plant expression vector is a pCAMBIA 1300 plant expression vector, and the knockout vector is a pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector; and / or, In step S3, the Agrobacterium tumefaciens is Agrobacterium tumefaciens C58C1.

9. The use according to claim 5, characterized in that: The step S4 also includes the step of performing PCR identification and sequencing on the hairy roots of Salvia miltiorrhiza to determine whether the SmSNR gene is successfully knocked out; wherein the primer sequences used for PCR identification of the genomic DNA of the hairy roots are shown in SEQ ID No.6 to SEQ ID No.7; and the primer sequences used for PCR identification of the rolB gene of the hairy roots are shown in SEQ ID No.8 to SEQ ID No.

9.

10. A method for constructing Salvia miltiorrhiza SmSNR gene knockout hairy roots, characterized in that: The construction method adopts the steps of directed knockout of the SmSNR gene in Salvia miltiorrhiza as described in any one of claims 5 to 9.

Images