Gibberellin high-yielding strain with byproducts eliminated, and construction method and application thereof

Abstract

The invention relates to the technical field of metabolic engineering, and discloses a by-product eliminated gibberellin high-yielding strain as well as a construction method and application thereof. In gibberella zeylanica, a bicarpin gene cluster and a fusarium gene cluster are relatively large, the size of the bicarpin gene cluster is about 17 kb, and the size of the fusarium gene cluster is about 16.8 kb, so that the difficulty of knocking out the bicarpin gene cluster and the fusarium gene cluster at the same time is relatively large. According to the present invention, with the CRISPR-Cas9 gene editing technology, the simultaneous knockout of the bicarpin gene cluster and the fusarium gene cluster is achieved, such that the influence of the fermentation by-product bicarpin and fusarium is eliminated, the gibberellin synthesis is increased, and the high-yield gibberellin gene engineering strain is obtained.

Description

Technical Field

[0001] The invention relates to the technical field of metabolic engineering, and in particular to a by-product-eliminated gibberellin high-producing bacterium, a construction method and application thereof. Background Art

[0002] Gibberellin Acid (GA3) is a plant growth hormone synthesized by plants and some fungi. It is widely used in agriculture, horticulture and wine production due to its special ability to stimulate plant growth. GA3 is a tetracyclic diterpene carboxylic acid with a molecular formula of C 19 H 22 O6, molecular weight 346.37, melting point 233 ~ 235 ℃, easily soluble in alcohol, acetone, ethyl acetate, sodium bicarbonate solution and phosphate buffer with pH 6.2, insoluble in water and ether. GA3, as a secondary metabolite, is generally obtained through liquid fermentation, solid fermentation and plant extraction. At present, the production of GA3 mainly relies on liquid deep fermentation or solid fermentation.

[0003] In the fungal metabolism process, the same primary metabolic precursor can produce a variety of secondary metabolites. Starting from acetyl coenzyme A, secondary metabolites including GA3, Bikaverin and Fusarubins can be obtained through metabolism. Therefore, when microbial fermentation produces GA3, Bikaverin and Fusarubins are often accompanied by byproducts. During the fermentation process, the production of byproducts Bikaverin and Fusarubins reduces the metabolic flux of the gibberellin pathway by competitively utilizing common precursors, which increases the difficulty of purifying the target product GA3 and the production cost in large-scale production.

[0004] The size of the bicardin gene cluster is about 17 kb, namely, bik1, bik2, bik3, bik4, bik5 and bik6, and the size of the falcarin gene cluster is about 16.8 kb, namely, fsr1, fsr2, fsr3, fsr4, fsr5 and fsr6. It is difficult to knock out the two byproduct gene clusters. Summary of the invention

[0005] In order to solve the problem of low GA3 fermentation yield caused by byproducts biccardin and fusarin, the present invention provides a byproduct-eliminated gibberellin high-yielding bacterium, a construction method and application thereof. The present invention uses CRISPR-Cas9 gene editing technology to achieve simultaneous knockout of biccardin and fusarin gene clusters, thereby eliminating the influence of fermentation byproducts biccardin and fusarin, and increasing gibberellin synthesis, to obtain a genetically engineered strain with high gibberellin production.

[0006] The specific technical scheme of the present invention is: In a first aspect, the present invention provides a gibberellin high-producing bacterium with eliminated by-products, which is obtained by simultaneously knocking out a biccardin gene cluster and a fusarin gene cluster.

[0007] As a preferred method, the bottom plate fungus is Gibberella fuscata ( Fusarium fujikuroi ) CCTCC NO:M 2019378.

[0008] Preferably, the NCBI accession number of the biccardin gene cluster is NC_036626.1 (102202..119287). The nucleotide sequence of the fusarium gene cluster is located on chromosome 5 of Gibberella tengcansis.

[0009] Preferably, the NCBI accession number of the Fusarium gene cluster is NC_036623.1 (4286817..4303612). The nucleotide sequence of the Fusarium gene cluster is located on chromosome 2 of Gibberella tengcansis.

[0010] In a second aspect, the present invention provides a method for constructing the above-mentioned gibberellin high-producing bacteria, comprising the following steps: Construction of CRISPR-Cas9 plasmid pFf332-Δ containing the bicamectin gene cluster knockout cassette and the fusarin gene cluster knockout cassette BIK Δ FSR , pFf332-Δ BIK Δ FSR The gibberellin high-yield bacteria are obtained by introducing the gibberellin high-yield bacteria into the bottom plate fungus Fujikura Gibberella.

[0011] pFf332, as a plasmid vector, can be obtained through existing techniques, such as purchased from the market.

[0012] Preferably, the method for preparing the knockout cassette of the biccardin gene cluster is: bik1 The donor DNA sequence fragment of the gene, the upstream nucleotide sequence fragment of the biccardin gene cluster and the downstream nucleotide sequence fragment of the biccardin gene cluster are subjected to fusion PCR, wherein: bik1 The donor DNA sequence of the gene is shown in SEQ ID No.1, the upstream nucleotide sequence of the biccardin gene cluster is shown in SEQ ID No.2, and the downstream nucleotide sequence of the biccardin gene cluster is shown in SEQ ID No.3.

[0013] Preferably, the method for preparing the knockout cassette of the fusarium gene cluster comprises the following steps: fsr1 The donor DNA sequence fragment of the gene, the upstream nucleotide sequence fragment of the fusarium gene cluster and the downstream nucleotide sequence fragment of the fusarium gene cluster are subjected to fusion PCR, wherein: fsr1The donor DNA sequence of the gene is shown in SEQ ID No.4, the upstream nucleotide sequence of the Fusarium gene cluster is shown in SEQ ID No.5, and the downstream nucleotide sequence of the Fusarium gene cluster is shown in SEQ ID No.6.

[0014] Preferably, the preservation number of the Gibberella fujikura is CCTCC NO: M 2019378.

[0015] In a third aspect, the present invention provides the use of the above-mentioned gibberellin high-producing bacteria in the fermentation production of gibberellin.

[0016] Compared with the prior art, the present invention has the following technical effects: The present invention uses CRISPR-Cas9 gene editing technology to achieve simultaneous knockout of the biccardin and fusarin gene clusters, thereby eliminating the Fujikura Gibberella ( Fusarium fujikuroi ) CCTCC NO:M 2019378, and increased the synthesis of gibberellins in the bacteria, based on which a genetically engineered strain with high gibberellin production was obtained. The above-mentioned genetically engineered strain with high gibberellin production provided by the present invention has a gibberellin fermentation production increased by more than 30% compared with the starting strain, and the yield is stable and has stable generation. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The synthesis process of GA3 in the production strain; Figure 2 It is a flowchart of the construction process and transformation of recombinant expression plasmids; Figure 3 It is the accumulation curve of fermentation products of the engineering strain and the starting strain; Figure 4 This is the fermentation result of the engineered strain after multiple rounds of subculture. DETAILED DESCRIPTION

[0018] The bottom plate fungus of the present invention is Gibberella fujikura ( Fusarium fujikuroi ) has a deposit number of CCTCC NO:M2019378, which has been disclosed in a patent application with publication number CN110527630A.

[0019] The NCBI accession number of the biccardin gene cluster in the embodiment of the present invention is NC_036626.1 (102202..119287), which is located on chromosome 5 of Gibberella tengcangensis; the NCBI accession number of the fusarium gene cluster is NC_036623.1 (4286817..4303612), which is located on chromosome 2 of Gibberella tengcangensis.

[0020] The process of producing GA3 by fermentation of Gibberella fuscata is as follows: Figure 1As shown. When GA3 is produced by fermentation of Gibberella fujikura, byproducts bicamectin and falcarin are often obtained. During the fermentation process, the production of byproducts bicamectin and falcarin reduces the metabolic flux of the gibberellin pathway by competitively utilizing common precursors, which increases the difficulty of purifying the target product GA3 and the production cost in large-scale production. However, since the bicamectin gene cluster and the falcarin gene cluster are large, the size of the bicamectin gene cluster is about 17 kb, and the size of the falcarin gene cluster is about 16.8 kb, it is difficult to knock out the bicamectin and falcarin gene clusters at the same time. The present invention uses CRISPR-Cas9 gene editing technology to achieve the simultaneous knockout of the bicamectin and falcarin gene clusters in Gibberella fujikura, and a genetically engineered bacterium with high gibberellin production is obtained based on this construction.

[0021] The present invention will be further described below in conjunction with embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present invention.

[0022] Example 1 Knockout vector pFf332-Δ BIK Δ FSR Construction This example constructs the knockout vector pFf332-Δ BIK Δ FSR , which is achieved by the following steps: (1) PCR using primers 1 and 2 to generate pFf332-Δ bik1 Plasmid was used as template for amplification bik1 The PCR reaction conditions for the donor DNA fragment were as follows: 98°C, 5 min; 98°C, 30 s, 60°C, 30 s, 72°C, 15 s, repeated 32 cycles; 72°C for 5 min. Fusarium fujikuroi ) The genome of CCTCC NO:M2019378 was used as a template to amplify the upstream nucleotide fragment of the biccardin gene cluster, and the downstream nucleotide fragment of the biccardin gene cluster was amplified using primers 5 and 6. The PCR product was detected by 1.0% (w / v, g / mL) agarose gel electrophoresis and the gel was cut to recover the purified fragment ( bik1 The nucleotide sequences of the donor DNA fragment of the gene, the upstream nucleotide fragment of the biccardin gene cluster and the downstream nucleotide fragment of the biccardin gene cluster are shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 respectively).

[0023] (2) The three recovered DNA fragments ( bik1 The donor DNA of the gene, the upstream nucleotide of the bicamectin gene cluster, and the downstream nucleotide of the bicamectin gene cluster) were used for fusion PCR using primers 1 and 6. The PCR reaction conditions were as follows: 98°C for 5 min; 98°C for 30 s, 60°C for 30 s, 72°C for 45 s, repeated for 32 cycles; 72°C for another 5 min. The PCR product was detected by 1.0% (w / v, g / mL) agarose gel electrophoresis and the gel was cut to recover the purified fragment. This step obtained the knockout frame of the bicamectin gene cluster.

[0024] (3) PCR using primers 7 and 8 to generate pFf332-Δ fsr1 Plasmid was used as template for amplification fsr1 The PCR reaction conditions were as follows: 98℃ for 5min; 98℃ for 30s, 60℃ for 30s, 72℃ for 15s, repeated for 32 cycles; 72℃ for 5min. Fusarium fujikuroi )CCTCC NO: M2019378(CN110527630A) genome was used as a template to amplify the upstream nucleotide fragment of the Fusarium gene cluster, and primers 11 and 12 were used to amplify the downstream nucleotide fragment of the Fusarium gene cluster. The PCR product was detected by 1.0% (w / v, g / mL) agarose gel electrophoresis and the gel was cut to recover the purified fragment ( fsr1 The nucleotide sequences of the donor DNA fragment of the gene, the upstream nucleotide fragment of the Fusarium gene cluster and the downstream nucleotide fragment of the Fusarium gene cluster are shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6 respectively).

[0025] (4) The three recovered DNA fragments ( fsr1 The donor DNA of the gene, the upstream nucleotide of the Fusarium gene cluster, and the downstream nucleotide of the Fusarium gene cluster) were used for fusion PCR using primers 7 and 12. The PCR reaction conditions were as follows: 98°C for 5 min; 98°C for 30 s, 60°C for 30 s, and 72°C for 45 s, repeated for 32 cycles; 72°C for another 5 min. The PCR product was detected by 1.0% (w / v, g / mL) agarose gel electrophoresis and the gel was cut to recover the purified fragment. This step obtained the Fusarium gene cluster knockout frame.

[0026] (5) The pFf332 vector was used as a template to connect the purified fragments recovered by fusion PCR in step (2) and step (4), and the ligation product was transformed into the E. coli DH5α recipient bacteria, spread on an LB solid plate containing a final concentration of 100 mg / L ampicillin resistance, and cultured inverted at 37°C overnight. A single clone was picked and verified by colony PCR to obtain the CRISPR-Cas9 plasmid pFf332-Δ that successfully connected the bicamphenicol gene cluster knockout frame and the fusarium gene cluster knockout frame. BIK Δ FSR . Recombinant expression plasmid pFf332-Δ BIK Δ FSR The construction process and transformation process diagram are as follows Figure 2 shown.

[0027] The sequences of the primers used in this example are shown in Table 1.

[0028] Table 1 Primer sequences Primer name sequence Primer 1 GCAAAGATGGCCAAACTCGTCACATACGACCAAAGGTAGTG Primer 2 TCCATGAATACGCTAGGCAGAAAAAAAAAGCACCGACTCGGT Primer 3 CTGCCTAGCGTATTCATGGA Primer 4 ATATGTCACTGTCTTCGAGAG Primer 5 TCTCGAAGACAGTGACATATTGCGAGTATCCTATTGGCAC Primer 6 CTGCTGTCTCGGCTGAGGTCTCAGAAAGGCCGAGCATATCC Primer 7 ATAGCTGTTCCGCTGAGGGTCACATACGACCAAAGGTAGTG Primer 8 CTACGGAGTGTATACTTCAGAAAAAAAAAGCACCGACTCGGT Primer 9 CTGAAGTATACACTCCGTAGAT Primer 10 TCAGCACTCTTTCAGCCGAG Primer 11 CTCGGCTGAAAGAGTGCTGAGAACCGGTCGACATCCCGAT Primer 12 ACTACCTTTTGGTCGTATGTGACGAGTTTGGCCATCTTTGCT Example 2 Obtaining a strain with simultaneous knockout of the bicardin and fusarin gene clusters of Gibberella fujikura In this example, a strain of Gibberella fujikura with both the biccardin and fusarin gene clusters knocked out simultaneously was constructed by the following steps: The recombinant plasmid pFf332-Δ BIK Δ FSR Transformed into Gibberella fujikura, the preparation of Gibberella fujikura protoplasts, transformation of exogenous fragments, recovery culture scheme, and verification scheme can be carried out according to the existing technology. This embodiment is carried out according to the prior patent CN113832041A (application publication number) of this unit. The transformed single colony was subjected to PCR with primers 13 and 14 to confirm whether the bicamectin gene cluster on the genome was knocked out, and PCR was carried out with primers 15 and 16 to confirm whether the fusarium gene cluster on the genome was knocked out. The constructed strain was named Fusarium fujikuroi -Δ BIK Δ FSR .

[0029] The sequences of the primers used in this example are shown in Table 2.

[0030] Table 2 Primer sequences Primer name sequence Primer 13 TTGTGCCGCCACTGAAATCA Primer 14 CTCGACTTTGCTCGCCAAAT Primer 15 AGCATATGCCCATTCCCATG Primer 16 TTTGAAGCGTAGGCCTGCTT Example 3 Shake flask fermentation verification of high-yield gibberellin GA3 engineered bacteria In this example, the strain of Fusarium fusogenum constructed in Example 2 with both the biccardin and fusarin gene clusters knocked out simultaneously Fusarium fujikuroi -Δ BIK Δ FSR To verify the production of gibberellin GA3 by fermentation in shake flasks, follow these steps: The strain constructed in 2 Fusarium fujikuroi -Δ BIK Δ FSR and the starting strain of Example 1 Fusarium fujikuroi They were inoculated into 25 mL seed culture medium and cultured at 28 °C and 250 rpm as pre-culture. After 48 hours, 2.7 mL of pre-culture was inoculated into a 2500 mL shake flask containing 40 mL fermentation medium, and then cultured at 28 °C and 250 rpm for 7 days. The GA3 content was detected according to the HPLC detection method of Example 7 of the prior art CN113832041A (application publication number). During the fermentation process, the GA3 content in the fermentation broth changed as follows: Figure 3 , where Δ BIK Δ FSR For strains Fusarium fujikuroi -Δ BIK Δ FSR The yield of Control is the starting strain Fusarium fujikuroi The fermentation yields of the strains are shown in Table 3.

[0031] Table 3 Fermentation yield of strains Genotype <![CDATA[GA3 production g / L]]> (Fusarium fujikuroi) CCTCC NO:M 2019378 1.80 -ΔΔ 2.35 From the results of shake flask fermentation in this example, it can be seen that the strain Fusarium fujikuroi -Δ BIK Δ FSR The yield of gibberellin GA3 produced by fermentation is relatively high, which is more than 30% higher than that of the starting strain.

[0032] in: The seed culture medium of this example was prepared as follows: 20 g / L corn starch, 20 g / L sucrose, 20 g / L peanut powder, 20 g / L soybean powder, 1.0 g / L potassium dihydrogen phosphate, 1.0 g / L magnesium sulfate, natural pH, and sterilized at 121°C for 30 min.

[0033] The fermentation medium of this example consists of 80 g / L corn starch, 80 g / L rice flour, 20 g / L soybean flour, 20 g / L peanut flour, 1.0 g / L potassium sulfate, and 1.0 g / L potassium dihydrogen phosphate. The solvent is tap water, the pH is natural, and the medium is sterilized at 121 degrees for 30 min.

[0034] Example 4 Verification of the subculture of high-yield gibberellin GA3 engineered bacteria In this example, the strain of Fusarium fusogenum constructed in Example 2 with both the biccardin and fusarin gene clusters knocked out simultaneously Fusarium fujikuroi -Δ BIK Δ FSR To carry out subculture fermentation, follow the steps below: The composition and culture conditions of the slant medium were set according to patent CN113832041A (application publication number), and the modified strain constructed in Example 2 was taken. Fusarium fujikuroi -Δ BIK Δ FSR , and 8 consecutive subculture fermentation cultures were carried out. The culture method and HPLC analysis were the same as those in Example 3. The subculture verification results are shown in Figure 4 As shown, G1 represents the first generation, G2 represents the second generation, and G8 represents the eighth generation.

[0035] It can be seen from the eight consecutive subculture experiments in this example that the GA3-producing engineered bacteria constructed in the present invention have a stable yield of GA3 produced by fermentation and have subculture stability.

[0036] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0037] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A gibberellin high-producing bacterium with by-product elimination, characterized in that: It is obtained by simultaneously knocking out the biccardin gene cluster and the fusarin gene cluster.

2. The gibberellin high-producing bacterium with by-product elimination as claimed in claim 1, characterized in that: The bottom fungus is Fusarium fujikura Fusarium fujikuroi ) CCTCC NO:M 2019378.

3. The gibberellin high-producing bacterium with by-product elimination as claimed in claim 1, characterized in that: The NCBI accession number of the biccardin gene cluster is NC_036626.

1.

4. The gibberellin high-producing bacterium with by-product elimination as claimed in claim 1 or 3, characterized in that: The NCBI accession number of the fusarin gene cluster is NC_036623.

1.

5. The method for constructing a gibberellin high-producing bacterium according to any one of claims 1 to 4, characterized in that: The following steps are involved: Construction of CRISPR-Cas9 plasmid pFf332-Δ containing the bicamectin gene cluster knockout cassette and the fusarin gene cluster knockout cassette BIK Δ FSR , pFf332-Δ BIK Δ FSR The gibberellin high-yield bacteria are obtained by introducing the gibberellin high-yield bacteria into the bottom plate fungus Fujikura Gibberella.

6. The construction method according to claim 5, characterized in that: The preparation method of the knockout cassette of the biccardin gene cluster is as follows: bik1 The donor DNA sequence fragment of the gene, the upstream nucleotide sequence fragment of the biccardin gene cluster and the downstream nucleotide sequence fragment of the biccardin gene cluster are subjected to fusion PCR, wherein: bik1 The donor DNA sequence of the gene is shown in SEQ ID No.1, the upstream nucleotide sequence of the biccardin gene cluster is shown in SEQ ID No.2, and the downstream nucleotide sequence of the biccardin gene cluster is shown in SEQ ID No.

3.

7. The construction method according to claim 5, characterized in that: The method for preparing the knockout cassette of the fusarium gene cluster comprises the following steps: fsr1 The donor DNA sequence fragment of the gene, the upstream nucleotide sequence fragment of the fusarium gene cluster and the downstream nucleotide sequence fragment of the fusarium gene cluster are subjected to fusion PCR, wherein: fsr1 The donor DNA sequence of the gene is shown in SEQ ID No.4, the upstream nucleotide sequence of the Fusarium gene cluster is shown in SEQ ID No.5, and the downstream nucleotide sequence of the Fusarium gene cluster is shown in SEQ ID No.

6.

8. The construction method according to claim 5, characterized in that: The preservation number of the Fujikura Gibberella is CCTCCNO: M 2019378.

9. Use of the gibberellin high-producing bacteria as described in any one of claims 1 to 4 in the fermentation production of gibberellins.

Images