Recombinant gene sequence for screening fish PGC, vector constructed by recombinant gene sequence and application of recombinant gene sequence

Abstract

The invention provides a recombinant gene sequence for screening fish PGC, the recombinant gene sequence comprises a human CD4 gene sequence optimized by a codon and a nanos3 3 'UTR sequence of a nanos3 gene specifically expressed by PGC, and the recombinant gene sequence is specifically shown as SEQ ID NO. 1. According to the invention, an expression vector pCS < 2 > + hCD4 + UTRnanos3 which contains a sequence as shown in SEQ ID NO.1 and can be used for fish PGC specific expression of human CD4 protein is constructed, CD4 is specifically expressed in fish PGC cells, and then living cell sorting and enrichment are carried out through antibody labeling. The antibody labeling and screening method provided by the invention has higher specificity, avoids dependence of large-scale instruments and equipment, performs double screening through GFP fluorescence, and greatly improves the positive cell rate and the enrichment efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of fish primordial germ cell screening, and specifically relates to a recombinant gene sequence for screening fish PGCs and a constructed vector and application thereof. Background Art

[0002] Primordial germ cells (PGCs) are the progenitor cells of sperm and eggs in the embryonic period and are the cell carriers of genetic material transmission from generation to generation. Therefore, PGCs are ideal target cells for genetic manipulations such as gene editing and transgenics. However, fish embryos often have very few PGCs. For example, there are only 4 PGCs in a 1000-cell zebrafish embryo, which severely limits the genetic manipulation and research of PGCs. How to efficiently isolate and enrich fish PGCs is one of the urgent problems to be solved in the field of genetic breeding and reproductive development.

[0003] At present, the main methods for enriching fish PGCs are manual picking and flow sorting. The manual picking method is to first fluorescently label the embryos of PGCs, separate them into single cells by enzymatic hydrolysis, dilute the cell suspension to the maximum amount, and then enrich PGCs based on fluorescent labeling, and select fluorescent-positive PGCs under a fluorescence microscope. Although this method obtains PGCs with high purity and does not rely on large instruments such as flow cytometry, the PGC enrichment efficiency is extremely low and it is difficult to use for PGC genetic manipulation research. Flow sorting is to sort out positive cells by flow cytometry. This method has a relatively high sorting efficiency and takes about 1 hour. However, the purity of PGCs is relatively low, and multiple flow sortings are often required. More importantly, due to the spontaneous fluorescence of cells such as pigments, it is difficult to distinguish positive PGCs from negative autofluorescent cells by fluorescent protein screening alone.

[0004] Therefore, it is urgent to establish a rapid and efficient method for enriching fish PGCs. Summary of the invention

[0005] In view of this, the present invention uses antibody labeling for screening based on the original green fluorescent protein (GFP) labeling cells, and then uses antibody labeling to sort and enrich living cells. Compared with GFP, antibody labeling has higher specificity and can eliminate the interference of autofluorescent cells.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: One of the purposes of the present invention is to provide a recombinant gene sequence for screening fish PGC, wherein the recombinant gene sequence comprises a codon-optimized human CD4 gene sequence and a PGC-specifically expressed nanos3 Genetic nanos33'UTR sequence, the recombinant gene sequence is specifically shown as SEQ ID NO.1.

[0007] A second object of the present invention is to provide a recombinant expression vector, wherein the recombinant vector contains the above-mentioned recombinant gene sequence.

[0008] In some specific embodiments, preferably, the expression vector of the recombinant expression vector is a pCS2+ plasmid.

[0009] The third object of the present invention is to provide a recombinant genetically engineered bacterium, wherein the recombinant genetically engineered bacterium contains the above-mentioned recombinant expression vector.

[0010] The fourth object of the present invention is to provide the use of the above-mentioned recombinant gene sequence, and / or the above-mentioned recombinant expression vector, and / or the above-mentioned recombinant genetic engineering bacteria in screening fish PGC.

[0011] Furthermore, the application steps are specifically as follows: S1. Obtain a human CD4 gene sequence and perform codon optimization to obtain a hCD4 gene that is more suitable for fish expression. The hCD4 gene sequence is specifically shown in SEQ ID NO.2; S2. Obtain PGC-specific expression nanos3 Genetic nanos3 3'UTR sequence, hCD4 gene sequence and nanos3 The 3'UTR sequence was connected to the expression vector pCS2+ vector to obtain pCS2+hCD4+UTR nanos3 Plasmid; and further obtain hCD4-UTR by in vitro transcription nanos3 mRNA; S3. Obtain hCD4-UTR nanos3 mRNA and fish PGC-specific marker molecule GFP-UTR nanos3 After the mRNA was mixed, it was microinjected into the 1-cell stage fish fertilized eggs. After the embryos developed, the embryos were dispersed into single cells and made into single cell suspensions. Among them, GFP-UTR nanos3 The sequence is shown in SEQ ID NO.3; S4. Mix the single cell suspension with CD4 antibody-coated magnetic beads, incubate, and use a magnetic column to enrich PGCs. Examine the cell suspension before and after enrichment under a fluorescent microscope to count the PGC percentage.

[0012] In some specific embodiments, preferably, the primers for amplifying the hCD4 sequence in the application process are as follows: Forward primer: CGGGATCCATGAACAGAGGTGTGCCTTTTAG; Reverse primer: CCGCTCGAGTCAGTGTCTACATCTCACACAAAAG.

[0013] In some specific embodiments, preferably, pCS2+hCD4+UTR is identified during the application process. nanos3 The primers for positive colonies are as follows: The upstream detection primers were: ATTTAGGTGACACTATAGAATAC; The downstream detection primer is: TCAGTGTCTACATCTCAC.

[0014] In some specific embodiments, preferably, the volume ratio of the single cell suspension to the CD4 antibody-coated magnetic beads in step S4 is 10:1.

[0015] Compared with the prior art, the present invention has the following beneficial effects: (1) In addition to the original green fluorescent protein (GFP)-labeled cells, the present invention also uses antibody labeling for screening. Compared with GFP, antibody labeling has higher specificity and can eliminate the interference of spontaneous fluorescent cells.

[0016] (2) Antibody labeling for live cell screening requires the combination of antibodies and live cell surface antigens. However, no surface antigen suitable for live cell sorting has been identified in fish PGCs. CD4 is a transmembrane glycoprotein that mainly exists on the surface of helper T cells (Th cells) and belongs to the immunoglobulin superfamily. Human CD4 has specific antibodies and can be used to label cells with immunofluorescence. The present invention constructs a fish PGC-specific expression vector pCS2+hCD4+UTR for human CD4. nanos3 , hCD4 was specifically expressed in fish PGC cells, and then live cell sorting and enrichment were performed by antibody labeling.

[0017] (3) In order to get rid of the dependence on large-scale instruments and equipment such as flow cytometry and improve the sorting efficiency, the present invention adopts the immunomagnetic bead method to sort and enrich fish PGCs by combining hCD4 antigen and antibody, and performs double screening by GFP fluorescence, which greatly improves the positive cell rate and enrichment efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a comparison of the amino acid sequences of human CD4 before and after codon optimization.

[0019] Figure 2 pCS2+mGFP+UTR nanos3 Plasmid maps.

[0020] Figure 3For the construction of pCS2+hCD4+UTR nanos3 Plasmid maps.

[0021] Figure 4 Zebrafish primordial germ cells are fluorescently labeled after microinjection.

[0022] Figure 5 This is a fluorescence microscopy image of cells before efficient enrichment of fish primordial germ cells.

[0023] Figure 6 This is a fluorescence microscopy image of the cells after efficient enrichment of fish primordial germ cells. DETAILED DESCRIPTION

[0024] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand the present invention more clearly.

[0025] Example 1 This embodiment provides a recombinant gene sequence for screening fish PGCs and a vector and application thereof, and the specific steps are as follows: 1. CD4 gene analysis CD4 is a transmembrane glycoprotein that is mainly present on the surface of helper T cells (Th cells) and belongs to the immunoglobulin superfamily. It plays an important role in immune responses, especially in the interaction between helper T cells and antigen-presenting cells such as dendritic cells and macrophages.

[0026] The CD4 protein is divided into several functional domains: (1) Extracellular Domain: It is composed of four immunoglobulin-like (Ig-like) domains, namely D1, D2, D3 and D4, arranged in sequence from the distal end to the proximal end of the membrane. D1 domain: It directly binds to the β2 chain of the MHC-II molecule. This interaction is essential for helper T cells to recognize antigens on antigen-presenting cells. D2-D4 domain: It plays a supporting role in stabilizing the protein structure and maintaining MHC-II binding. The entire extracellular region: It binds to the gp120 protein of HIV-1 and is a key target for HIV to infect T cells; (2) Transmembrane Region: It is a hydrophobic amino acid chain that anchors CD4 to the cell membrane to ensure its correct positioning with the MHC-II molecule; (3) Cytoplasmic Domain: It interacts with a variety of signal transduction molecules (such as Lck tyrosine kinase), participates in T cell receptor (TCR) signal transduction, and activates T cell responses.

[0027] 2.CD4 codon optimization The human CD4 gene (NM_000616.5) has 458 amino acids (NP_000607.1) and has specific commercial antibodies, which facilitate various tests and live cell sorting. The present invention deletes the region that binds to HIV, and CD4 cannot bind to gp120, thereby preventing HIV from entering cells through CD4. However, the truncated CD4 does not affect antibody binding, so it can be used for immunomagnetic bead enrichment cell experiments. In addition, in order to better express CD4 mRNA in fish cells, the present invention performs codon optimization on the human CD4 nucleic acid sequence.

[0028] Specific steps: (1) Obtain the codon preference table of zebrafish. Collect the codon usage frequencies (Codon Usage Frequency) of highly expressed genes in zebrafish (Danio rerio). Use the codon optimization tool to convert based on the codon preference table of zebrafish; (2) Identify the variability of the sequence. Replace each codon in the sequence with an equivalent codon commonly used in zebrafish, while avoiding the use of rare codons; (3) Avoid potential problems. Remove or adjust sequences that may cause problems, such as internal stop codons, secondary structures that are difficult to translate, unnecessary repeat sequences, etc.; (4) Adjust GC content. The optimized sequence should have an appropriate GC content to improve expression efficiency while maintaining transcriptional stability; (5) Add adaptation signals. Add Kozak sequences and other translation efficiency enhancement elements; (6) Check whether the protein has changed. Compare the protein sequences before and after optimization to ensure that they still encode the same protein.

[0029] Finally, the human CD4 nucleic acid sequence hCD4 (shown in SEQ ID NO.2) suitable for expression in zebrafish and other fish cells was obtained. The optimized hCD4 was compared with the original CD4 amino acid sequence and it was found that the optimized hCD4 amino acid had not changed ( Figure 1 ).

[0030] 3. Construction of PGC-specific CD4 expression plasmid.

[0031] nanos3 It is a gene specifically expressed in primordial germ cells. Its 3'UTR region has multiple specific RNA regulatory elements and RNA binding protein action sites, which enable it to be specifically expressed in primordial germ plasm cells.

[0032] (1) hCD4 template preparation The hCD4 sequence was amplified by PCR, and double restriction sites BamHI and XhoI and restriction protection bases were added at both ends of hCD4. The forward primer for PCR amplification was: CGGGATCCATGAACAGAGGTGTGCCTTTTAG; the reverse primer was: CCGCTCGAGTCAGTGTCTACATCTCACACAAAAG.

[0033] The PCR amplification system was as follows: hCD4 template (50 ng / μL) 0.5 μL; forward primer (10 μM) 0.5 μL; reverse primer (10 μM) 0.5 μL; KOD plus 1 μL; KOD Buffe 25 μL; water was added to 50 μL.

[0034] The PCR program was as follows: 94ºC for 5 min; 94ºC for 30 sec; 58ºC for 30 sec; 68ºC for 30 sec, 35 cycles; 68ºC for 10 min.

[0035] (2) PCR product recovery The PCR product recovery step is performed as follows: a) Column equilibration: Add 500 μL of equilibration solution BL (omega, D6492) to the adsorption column, centrifuge at 12,000 rpm for 1 minute, and discard the waste liquid in the collection tube.

[0036] b) Mix the enzyme digestion system and nucleic acid binding buffer CP Buffer (omega, D6492) in a ratio of 1:5.

[0037] c) Add the mixed solution to the adsorption column, place it at room temperature for 3 minutes, centrifuge it at 12000 rpm for 1 minute, and discard the waste liquid in the collection tube.

[0038] d) Add 600 μL of Wash Buffer (omega, D6492, anhydrous ethanol has been added) to the adsorption column, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid in the collection tube.

[0039] e) Repeat step 4.

[0040] f) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 minutes to remove as much rinse solution as possible. Open the cover of the adsorption column and leave it at room temperature for 5 minutes to dry thoroughly.

[0041] g) Place the adsorption column in an RNase-free centrifuge tube and add about 30 μL of RNase-free water to the middle of the adsorption membrane. Detect the concentration of the recovered PCR product and use it as a template for enzyme digestion.

[0042] (3) Enzyme digestion of PCR products and vectors pCS2+mGFP+UTR nanos3 Plasmids are commonly used marker molecules for fish primordial germ cells (Nature Communications, 2023, DOI:10.1038 / s41467-023-43587-3). See the plasmid map for details. Figure 2 , corresponding to mGFP+UTR nanos3 The sequence is shown in SEQ ID NO.3 (the sequence marked in gray is GFP). The restriction sites at both ends of the GFP sequence are BamHI and XhoI respectively.

[0043] pCS2+mGFP+UTR nanos3 The plasmid and hCD4 PCR product were double-digested with BamHI and XhoI, respectively. The digestion reaction system was as follows: BamHI enzyme 10 μL; XhoI enzyme 10 μL; 10x Buffer 20 μL; plasmid / PCR product 10 μg; water to 200 μL; incubate in a 37°C water bath for 4 hours.

[0044] (4) Purification and recovery of enzyme digestion products pCS2+mGFP+UTR nanos3 After plasmid digestion, agarose gel electrophoresis will produce two bands of different sizes. The smaller band is the mGFP band, and the larger band is the pCS2+UTR nanos3 Carrier. A larger gel strip is obtained by cutting the gel, placed in an EP tube, and an equal amount of nucleic acid binding solution CP Buffer (omega, D6492) is added (1g gel strip corresponds to 1mL CP solution), and incubated in a 65℃ water bath until the gel strip is completely dissolved. The remaining steps are consistent with the PCR product recovery process in the previous step, and the hCD enzyme digestion product recovery process is also consistent with the PCR product recovery process in the previous step.

[0045] (5) T4 ligase ligation pCS2+UTR after enzyme digestion nanos3 The vector and the digested hCD4 were connected using T4 ligase. The connection system was as follows: pCS2+UTR nanos3 Vector (100 ng / μL) 4 μL; hCD4 (100 ng / μL) 4 μL; T4 ligase (100 ng / μL) 2 μL; 5x Buffer 4 μL; add water to 20 μL. Incubate overnight in a 16°C water bath.

[0046] (6) Plasmid transformation into Escherichia coli a) Mix 10 μL of the ligation product with 100 μL of E. coli competent cells, place on ice, and incubate for 30 minutes.

[0047] b) Incubate in a 42°C water bath for 90 seconds.

[0048] c) Incubate on ice for 3 minutes.

[0049] d) Add 100 μL LB solution (10 g tryptone, 5 g yeast extract, 10 g sodium chloride, dilute to 1 L, sterilize before use), and incubate in a constant temperature shaker at 37°C, 100 rpm, for 30 min.

[0050] e) Apply the entire solution evenly onto the ampicillin antibody selection medium and incubate in a 37°C constant temperature incubator overnight.

[0051] (7) Identification of positive colonies Select 30 single clones and place them in EP tubes with 50 μL LB solution. Take 3 μL of each for PCR amplification to detect pCS2+hCD4+UTR. nanos3 Positive colonies. The upstream detection primer is: ATTTAGGTGACACTATAGAATAC; the downstream detection primer is: TCAGTGTCTACATCTCAC.

[0052] The PCR system was as follows: 3 μL bacterial solution; 0.5 μL forward primer (10 μM); 0.5 μL reverse primer (10 μM); 10 μL Taq enzyme; and water was added to 20 μL.

[0053] The PCR program was as follows: 94ºC for 5 minutes; 94ºC for 30 seconds; 56ºC for 30 seconds; 72ºC for 1 minute, 35 cycles; 72ºC for 10 minutes. Positive colonies were detected by agarose gel electrophoresis, and 3-4 positive colonies were selected and sent to the company for sequencing to further confirm the positive colonies.

[0054] (8) Plasmid extraction a) Inoculate the confirmed positive colony into 6 mL of LB solution and incubate at 37°C in a constant temperature shaker for 16 hours; b) Centrifuge the bacterial solution at 12000 rpm and discard the supernatant; c) Add 250 μL of lysis buffer Solution I / Rnase A mixture (omega, D6943), resuspend the bacterial solution, and leave at room temperature for 2-3 minutes; d) Add 250 μL of Solution II (omega, D6943) and mix well; e) Add 350 μL Solution III (omega, D6943) of the lysis buffer and mix well; a white precipitate will appear in the solution after adding Solution III; f) After centrifugation at 12000 rpm for 10 minutes, the supernatant was added to the DNA binding column and centrifuged at 12000 rpm for 1 minute; g) Discard the filtrate in the collection tube, add 600 μL of Wash Buffer (omega, D6492), and centrifuge at 12000 rpm for 1 minute; h) Repeat step g; i) Place the DNA binding column back into the collection tube, centrifuge at 12,000 rpm for 3 minutes, open the lid, and air dry the filter membrane; j) Place the DNA binding column in a new EP tube, add 50 μL of hot water to the binding column filter membrane, and leave it at room temperature for 3 minutes; k) Centrifuge at 12000 rpm for 3 minutes, measure the plasmid concentration of the collected solution, and obtain pCS2+hCD4+UTR nanos3 Plasmid, map see Figure 3 , hCD4+UTR nanos3 The sequence is shown in SEQ ID NO.1 (the gray part is nanos3 3'UTR sequence).

[0055] 4. Preparation of in vitro transcribed mRNA template The pCS2+hCD4+UTR obtained above nanos3 The plasmid was digested with NotI enzyme, and then the linearized plasmid was purified and recovered to obtain a template for in vitro transcription of mRNA.

[0056] The enzyme digestion system is as follows: pCS2+hCD4+UTR nanos3 Plasmid 10 μg; NotI enzyme 10 μL; Buffer 20 μL; water to 200 μL.

[0057] Digest at 37℃ for 1 hour and run agarose gel to check whether the plasmid is completely linearized. If not, continue digestion until it is completely linearized.

[0058] The enzymatic product recovery step is carried out as follows: a) Column equilibration: Add 500 μL of equilibration solution BL (omega, D6492) to the adsorption column, centrifuge at 12,000 rpm for 1 minute, and discard the waste liquid in the collection tube; b) Mix the enzyme digestion system and nucleic acid binding buffer CP Buffer (omega, D6492) in a ratio of 1:5.

[0059] c) Add the mixed solution to the adsorption column, place it at room temperature for 3 minutes, centrifuge it at 12000 rpm for 1 minute, and discard the waste liquid in the collection tube; d) Add 600 μL of Wash Buffer (omega, D6492, anhydrous ethanol has been added) to the adsorption column, centrifuge at 12000 rpm for 1 minute, and discard the waste liquid in the collection tube; e) Repeat step 4; f) Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 minutes to remove as much rinsing solution as possible. Open the cover of the adsorption column and leave it at room temperature for 5 minutes to dry thoroughly; g) Place the adsorption column in an RNase-free centrifuge tube and add about 30 μL of RNase-free water to the middle of the adsorption membrane. Detect the concentration of the recovered linearized plasmid and use it as a template for in vitro transcription of mRNA.

[0060] 5. In vitro transcription and purification of mRNA (1) DNA template: The linearized plasmid obtained in step 4 is used as a template for mRNA synthesis. The entire experimental process is carried out in an RNase-free environment.

[0061] (2) In vitro transcription: Use the mMessage mMachine in vitro transcription kit to synthesize mRNA. The reaction system is as follows: 0.5-1 μg DNA template; 5 μL 2×NTP / BCIP; 1 μL 10×reaction buffer; 1 μL Enzyme mix; make up to 10 μL with RNase-free water; incubate in a 37°C water bath for 2.5 hours.

[0062] (3) Purification and recovery of mRNA a) After mRNA synthesis, add 1 μL of DNase, mix well, and incubate in a 37°C water bath for 15 minutes to remove the DNA template.

[0063] b) Add 20 μL 5 M ammonium acetate, mix well, and place on ice for 30 minutes.

[0064] c) Centrifuge at 12,000 rpm for 15 minutes at 4°C. The white precipitate at the bottom is mRNA.

[0065] d) Remove the supernatant, add 1 mL of 75% ethanol to wash the precipitate, and centrifuge at 12,000 rpm for 10 min at 4°C.

[0066] e) Discard the supernatant, dry the precipitate at room temperature, and add 10 μL of water to dissolve the precipitate.

[0067] f) Take 0.3 μL of RNA and dilute it 10 times. Use Nanodrop to check the concentration and purity of 1 μL and use the remaining 2 μL for agarose gel electrophoresis to check whether it is degraded.

[0068] 6. Microinjection The hCD4+UTR obtained above nanos3 and GFP+UTR nanos3(The in vitro transcription method is the same as the previous one) Injected into the cells of 1-cell stage zebrafish fertilized eggs, 1 nL per embryo, and 100 zebrafish embryos were injected. When the embryo develops to day 1, GFP-labeled PGCs can be clearly observed in the embryonic genital ridge ( Figure 4 ).

[0069] The injection system is configured as follows: hCD4+UTR nanos3 mRNA 100ng / μL; GFP+UTR nanos3 mRNA 100ng / μL; phenol red was diluted 6:1 and used; RNase-free water was added to 4μL.

[0070] 7. Preparation of embryonic single cells (1) When the embryos develop to day 1 or at a specified time, approximately 100 embryos are anesthetized with MS222 and placed in a 1.5 mL low-adsorption centrifuge tube. The embryos are cut into pieces as much as possible with dissecting scissors; (2) Add 1 mL of digestion solution (0.26 U collagenase and 10% FBS in L-15 medium). Digest at room temperature for about 0.5 hours, using a pipette with a 1 mL low-adsorption tip to slowly pipette until no tissue chunks are visible to the naked eye; (3) Check under a microscope to see whether most of the tissue blocks have dispersed into single cells. If not, continue digestion until the tissue is dispersed into single cells; (4) Pass the cell suspension through 70 μm and 40 μm cell sieves in sequence to remove large tissue chunks; (5) Centrifuge the collected cell suspension at 400 g for 3 minutes at 4°C and resuspend in PBE (1X RNase-free PBS, 0.5% BSA, 2 mM EDTA); (6) Repeat step 5 twice; 8. Immunomagnetic Beads Enrichment of Fish Primordial Germ Cells (1) Resuspend the cells obtained in the previous step in 1 mL of PBE, add 10 μL of hCD4 antibody-coated magnetic beads (Miltenyi Biotec), and incubate on ice for 10 min.

[0071] (2) Centrifuge at 400 g for 3 minutes in a 4°C centrifuge. Resuspend the cells in ice-cold PBE solution. Repeat twice.

[0072] (3) Place the MACS magnetic column (MiniMACS Separator, Miltenyi Biotec) on the magnetic stand and rinse once with 500 μL PBE.

[0073] (4) Resuspend the cells in 1 mL of PBE and slowly add them to the MACS magnetic column.

[0074] (5) Rinse the MACS magnetic column twice with 500 μL PBE to remove unbound cells.

[0075] (6) Remove the magnetic column from the magnet and add 1 mL of PBE to elute the cells.

[0076] (7) The collected cell suspension can be passed through the magnetic column again to elute the cells as much as possible.

[0077] (8) Centrifuge at 400 g for 3 minutes, remove the supernatant, and add 20 μL of PBE solution to obtain resuspended cell solution.

[0078] 9. Analysis of the effect of immunomagnetic beads in enriching fish primordial germ cells Pipette 1 μL of the resuspended cell solution from the previous step and place it on a coverslip. Observe and count the proportion of GFP fluorescent cells before and after immunomagnetic bead enrichment under a fluorescence microscope.

[0079] The results showed that compared with the enrichment before ( Figure 5 ) compared to the cells enriched by the immunomagnetic bead method, almost all of them were GFP-positive cells ( Figure 6 ). This indicates that the invention of the present application has higher specificity and higher efficiency in enriching fish primordial germ cells.

[0080] The specific raw materials not described in the present invention are all existing materials and can be directly purchased from the market.

[0081] The above are only preferred embodiments of the present invention and are not intended to limit the protection scope of the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A recombinant gene sequence for screening fish PGC, characterized in that: The recombinant gene sequence includes a codon-optimized human CD4 gene sequence and a PGC-specifically expressed nanos3 Genetic nanos3 3'UTR sequence, the recombinant gene sequence is specifically shown as SEQ ID NO.

1.

2. A recombinant expression vector, characterized in that: The recombinant vector contains the recombinant gene sequence according to claim 1.

3. The recombinant expression vector according to claim 2, characterized in that The expression vector of the recombinant expression vector is a pCS2+ plasmid.

4. A recombinant genetically engineered bacterium, characterized in that: The recombinant genetically engineered bacteria contains the recombinant expression vector according to claim 2.

5. Use of the recombinant gene sequence according to claim 1, and / or the recombinant expression vector according to any one of claims 2 and 3, and / or the recombinant genetically engineered bacteria according to claim 4 in screening fish PGC.

6. The use according to claim 5, characterized in that: The application steps are as follows: S1. Obtain a human CD4 gene sequence and perform codon optimization to obtain a hCD4 gene that is more suitable for fish expression. The hCD4 gene sequence is specifically shown in SEQ ID NO.2; S2. Obtain PGC-specific expression nanos3 Genetic nanos3 3'UTR sequence, hCD4 gene sequence and nanos3 The 3'UTR sequence was connected to the expression vector pCS2+ vector to obtain pCS2+hCD4+UTR nanos3 Plasmid; and further obtain hCD4-UTR by in vitro transcription nanos3 mRNA; S3. Obtain hCD4-UTR nanos3 mRNA and fish PGC-specific marker molecule GFP-UTR nanos3 After the mRNA was mixed, it was microinjected into the 1-cell stage fish fertilized eggs. After the embryos developed, the embryos were dispersed into single cells and made into single cell suspensions. Among them, GFP-UTR nanos3 The sequence is shown in SEQ ID NO.3; S4. Mix the single cell suspension with CD4 antibody-coated magnetic beads, incubate, and use a magnetic column to enrich PGCs. Examine the cell suspension before and after enrichment under a fluorescent microscope to count the PGC percentage.

7. The use according to claim 6, characterized in that: The primers used to amplify the hCD4 sequence during the application are as follows: Forward primer: CGGGATCCATGAACAGAGGTGTGCCTTTTAG; Reverse primer: CCGCTCGAGTCAGTGTCTACATCTCACACAAAAG.

8. The use according to claim 6, characterized in that pCS2+hCD4+UTR was identified during the application process nanos3 The primers for positive colonies are as follows: The upstream detection primers were: ATTTAGGTGACACTATAGAATAC; The downstream detection primer is: TCAGTGTCTACATCTCAC.

9. The use according to claim 6, characterized in that: In step S4, the volume ratio of the single cell suspension to the CD4 antibody-coated magnetic beads is 10:1.

Images