ECL biosensor for detecting microcystin MC-LR

Abstract

The invention discloses an ECL (Electrochemiluminescence) biosensor for detecting microcystic toxins. According to the sensor, under excitation of a photomultiplier tube, AuNC and a co-reactant potassium persulfate (K2S2O8) directly react to generate AuNC < + > and SO4 <-> respectively, SO4 <-> is reduced into SO4 < 2-> by AuNC < + >, AuNC * is generated at the same time, AuNC * is an excited state of AuNC, light intensity can be released when the excited state transitions to a ground state, and the light intensity is captured by an ECL instrument, so that an ECL signal is generated. According to the present invention, with the increase of the MC-LR content, the stronger the ECL signal is, such that the quantitative detection of the MC-LR content is achieved, the biological sensing platform has the wide detection range from 0.1 pM to 1 nM, and the detection limit is as low as 62.3 fM; according to the invention, the rapid detection of the microcystin MC-LR serving as a low-concentration target object can be realized, and the method can be applied to the detection of various samples such as food, medicines, milk, drinks, water bodies and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of biological analysis and detection, and in particular to an ECL biosensor and an application thereof in the detection of microcystin MC-LR. Background Art

[0002] Microcystis (MCs) is a monocyclic heptapeptide mainly produced by Microcystis aeruginosa. It is currently the most widely distributed hepatotoxin and poses a serious threat to the quality of drinking water. Among the various isomers of MCs, the most common and abundant are MC-LR, MC-RR and MC-YR (L, R and Y represent leucine, arginine and tyrosine, respectively). Studies have confirmed that MC-LR is the most toxic, followed by MC-YR, and RR is the weakest. MCs inhibit the activity of protein phosphatases, leading to rapid destruction of liver structure, which usually leads to hypovolemic shock or liver failure and death. More and more studies have shown that humans are prone to liver cancer when they are exposed to low concentrations of MCs for a long time.

[0003] With global warming and eutrophication of aquatic ecosystems, the phenomenon of blue algae blooms is increasing, attracting worldwide attention. MC-LR, which can cause disease and death after being absorbed by the human body, mainly comes from edible seafood, agricultural plants and drinking water. After human consumption, it inhibits the activity of serine / threonine residues of protein phosphorylase (PP1 and PP2A), resulting in imbalance of intracellular protein phosphorylation and dephosphorylation levels, cytoskeleton changes, and DNA damage and cell apoptosis. In addition, MC-LR also specifically targets liver and kidney cells to induce embryonic and neurotoxicity. It was listed as a Class 2B carcinogen by the International Agency for Research on Cancer in 2010. The World Health Organization also stipulates that the microcystin MC-LR in drinking water should not exceed 1μg / L. Water quality safety is related to human life and health. Therefore, it is urgent to develop highly sensitive and specific MC-LR sensors for water monitoring and epidemiological toxicology research.

[0004] Electrochemiluminescence (ECL) stands out among a number of detection methods due to its low detection cost, simple operation and high sensitivity. ECL usually generates photons and releases excited states through the electron transfer reaction of electrically generated free radicals near the electrode. There are usually two pathways for electrochemiluminescence. One is the co-reactant pathway. During the redox process of the reactants and co-reactants, an intermediate free radical is generated by the reactants, which can interact with the electrochemiluminescent radical to produce an excited state. The other is the annihilation pathway, in which the electrochemiluminescent group undergoes a redox reaction on the electrode to produce free radical anions and free radical cations, which are annihilated to produce an excited state and emit light. Compared with the annihilation pathway, the intermediates produced by the co-reactant pathway have stronger redox ability, and the ECL produced is often stronger. In recent years, ECL has gradually become an emerging optical analysis tool that has attracted great interest, especially in the fields of biological and environmental analysis. Summary of the invention

[0005] The purpose of the present invention is to construct an ECL biosensor for detecting microcystin, which is based on the detection strategy of DGB@AuNC with in situ reduction and the cyclic means of T7 EXO cyclic enzyme cleavage. A strong signal output can be achieved with a trace amount of microcystin, which is conducive to the rapid detection of early infection samples. Specifically, the technical solution of the present invention is as follows: The ECL biosensor for detecting microcystin MC-LR of the present invention is prepared by the following method: (1) DNA gel ball DGB was prepared using Padlock chain and Primer chain under the action of T4 ligase, Phi29 enzyme and dNTP; (2) Using HAuCl4 and trisodium citrate to in situ reduce and synthesize gold nanoclusters on the gel spheres, the blooming nanogel spheres DGB@AuNCs were obtained; (3) Using microcystin MC-LR to open hairpin H1, a sequence of hairpin H1 is exposed and connected to hairpin H2 to form MC-LR-H1-H2; (4) Using T7 EXO to cut MC-LR-H1-H2 to obtain the enzyme digestion product F1 chain; (5) Electroplating silver nanofilm on the pretreated electrode, then modifying the hairpin H3 on the electrode surface and adding MCH to prevent specific binding; (6) adding the F1 chain obtained in step (4) to the electrode to open the hairpin H3; (7) Add the nanogel balls DGB@AuNCs bloomed in step (2) to the electrode for electrochemiluminescence detection.

[0006] For the above-mentioned ECL biosensor, preferably, in step (1), the Padlock chain and the Primer chain are first annealed at 85-95°C and cooled to room temperature, and then T4 ligase is added for reaction, and then phi29 enzyme and dNTP are reacted.

[0007] For the above-mentioned ECL biosensor, preferably, step (2) is to fully mix 0.8-1.2 mM HAuCl4 solution and gel beads DGB, then add 100 mM trisodium citrate buffer (pH = 6), stir and cool at 80-95°C.

[0008] For the above-mentioned ECL biosensor, preferably, step (3) is to incubate microcystin (MC-LR) with annealed H1 and H2 at 35-38° C. for 2-4 hours to form MC-LR-H1-H2.

[0009] For the above-mentioned ECL biosensor, preferably, step (4) is to add MC-LR-H1-H2 and T7 EXO into the ep tube, and utilize the characteristic of T7 EXO enzyme to cut the blunt end from the 5' end to obtain the cut product F1.

[0010] For the above-mentioned ECL biosensor, preferably, in step (5), the silver nanofilm is electroplated by placing the electrode in an electrolyte and depositing it at a constant potential of 0.1-0.5 V to obtain a three-dimensional layered silver nanofilm; the electrolyte includes 4-6 mM AgNO3, 0.15-0.25 M KNO3, 0.6-1.5 mM sodium citrate dihydrate, and 2-3 g / L polyvinyl pyrrolidone. The hairpin H3 is modified on the electrode surface by placing the hairpin H3 on the electrode for incubation. The electrode is first deposited with silver nanoparticles and then the hairpin is modified. This is a common practice for hairpin modification. The principle is generally based on the combination of silver-sulfur bonds, so that the hairpin H3 containing thiol groups is modified on the silver-plated electrode.

[0011] For the above-mentioned ECL biosensor, preferably, the electrochemiluminescence detection in step (7) is to place the electrode in 0.03-0.08 mM K2S2O8 and perform ECL measurement at -2V-0V and when the photomultiplier tube is 700-800V.

[0012] As a more preferred technical solution, the ECL biosensor of the present invention is prepared by the following method: (1) Mix 10 μL of 10 μM Padlock chain and 10 μL of 10 μM primer chain in 10 mM Mg 2+Solution, heated to 95℃ annealing treatment for 5min and cooled to room temperature; add 0.2U T4 ligase and incubate at 16℃ overnight, inactivate T4 ligase at 65℃, then add 5μL, 10U / μL phi29 DNA polymerase and 10mL, 10mM dNTP, incubate at 30℃ for 24h, and finally inactivate the enzyme used in the reaction at 65℃. The resulting product was collected by centrifugation at 10000rpm, 10min and washed 3 times with ultrapure water, then dispersed in 500μL ultrapure water and stored at 4℃ for later use. In this step, padlock and primer are mixed in 8-12mM Mg 2+ Under the effect of , it is better to anneal together and cool down slowly.

[0013] (2) Add 50 µL of 1 mM HAuCl4 solution and 50 µL of prepared gel balls (DGB) to 0.85 mL of ultrapure water and mix thoroughly. Then add 50 µL of freshly prepared 100 mM trisodium citrate buffer (pH = 6). Stir the mixture at 90 °C for 30 min (800 rpm), cool to room temperature, and store at 4 °C for use. DGB@AuNCs were synthesized and placed in a 4 °C refrigerator for use.

[0014] (3) Incubate microcystin (MC-LR) with annealed H1 and H2 at 37°C for 3 h to form MC-LR-H1-H2, which was then stored at 4°C.

[0015] (4) Add MC-LR-H1-H2 and 0.21U of T7 EXO to the ep tube, and take the cut product F1 by using the characteristic of T7 EXO to cut the blunt end from the 5' end. The temperature for this step is preferably 20-30℃.

[0016] (5) Electroplating silver nanoflowers on the polished electrode. The time for electroplating silver nanoflowers in this step is preferably 10-20 minutes.

[0017] (6) Hairpin H3 is then incubated on the surface and MCH is added to prevent nonspecific adsorption.

[0018] (7) Then, the cleavage product F1 was added to the electrode and incubated at 37°C for 3 h. Finally, the in situ reduced gel spheres were added to the electrode and incubated for 3 h.

[0019] The ECL biosensor of the present invention can be used in the detection of microcystin, which can realize the rapid detection of low-concentration targets and can be applied to a variety of real samples. When used, the electrode can be placed in 0.05mM K2S2O8, and the ECL measurement can be performed at -2V-0V and the photomultiplier tube is 750V.

[0020] The hairpin H1 sequence described above was designed by ourselves and is SEQ ID No. 1 in the sequence list. The sequence is as follows: 5'-GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCTCCGCC GGGC ATAATGAGGTGGT -3' Microcystin MC-LR opens the hairpin H1, exposing an underline sequence in H1 that is connected to H2 to form MC-LR-H1-H2.

[0021] The hairpin H2 described above was designed by ourselves and is SEQ ID No. 2 in the sequence list. The sequence is as follows: 5'-ACCACCTCATTATGCCCTTGCTAGCTAAGGTCATCTAGCTAGCAAGGG-3' The hairpin H3 described above was designed by ourselves and is SEQ ID No. 3 in the sequence list. The sequence is as follows: H3: 5'-TTTTTATCCCTTGCTAGCTAGATGACCGTAGCTAGCAAGGGAT-3' The F1 chain described above was designed by ourselves and is SEQ ID No. 4 in the sequence list, and the sequence is as follows: F1: 5'-AGGTCATCTAGCTAGCAAGGG-3' The Padlock chain and Primer chain are designed by themselves, and their sequences are SEQ ID No. 5 and SEQ ID No. 6 in the sequence list, respectively, as follows: Padlock chain: 5'-CAAGGGATTTTTTTTTTTCCTGCTTTTTTTTGTAGCTAG-3' Primer chain: 5'-AAAATCCCTTGCTAGCTACAAA-3' On the other hand, the ECL biosensor can also be prepared by the following method: (1) Polish the electrode with alumina slurry, rinse thoroughly with ultrapure water, ultrasonically treat in ethanol and water, and dry at room temperature; (2) The electrode was placed in an electrolyte (5 mM AgNO3, 0.2 M KNO3, 1 mM sodium citrate dihydrate, 2.5 g / L polyvinyl pyrrolidone) and deposited at a constant potential of 0.25 V for 15 min to obtain a three-dimensional layered silver nanofilm. 10 μL of 3 μM thiol DNA H3 was then added to the electrode and incubated for 6 h. (3) Add 1 mM MCH and incubate for half an hour; (4) The enzyme cleavage product F1 (10 μL) after incubation with different concentrations of MC-LR was placed on the electrode and incubated for 3 h; (5) The previously synthesized DGB@AuNC (10 μL) and 10 mM Mg 2+ Drop them together on the electrode surface and incubate for 2 h; (6) Place the electrode in 0.05 mM K2S2O8 and perform ECL measurement at -2 V to 0 V with the photomultiplier tube at 750 V. In the present invention, a cyclic means of T7 EXO cyclic enzyme cleavage is adopted, and a strong signal output can be achieved with a trace amount of microcystin, which is conducive to the rapid detection of samples in the early stage of infection.

[0022] Water quality contains many components and is relatively complex. The development of ECL has great advantages in expanding the detection methods of MC-LR. The content of MC-LR in food is relatively low, and nucleic acid amplification is often required. DNA nanotechnology provides a multifunctional platform for the rational design of multifunctional self-assembled nanostructures. Using the isothermal amplification strategy of RCA, a large number of long-chain DNA with repetitive sequences are produced by continuous rolling synthesis of carefully designed circular templates on hairpins, and self-assembled to form DNA gel balls (DGBs) according to the Watson-Crick base pairing principle. DNA is considered to be an ideal template for the synthesis of metal nanoclusters due to its non-toxicity and programmable molecular recognition ability. Adenine (A)-rich DNA is considered to be a template for the synthesis of gold nanoclusters (AuNCs). The carefully designed circular template includes two parts: thymine (T)-rich and hairpin recognition. After the hairpin is opened by cyclic enzyme cleavage and the chain is released, the circular template, under the action of polymerase, continuously adds nucleotides to produce ultra-long polymerized DNA amplicons to spontaneously form DGBs. During the in situ synthesis of AuNCs, DGB completed the transformation from spore to blossom, changing its morphology from 3D to 2D structure, generating electron transfer under the action of co-reactants and emitting ECL signals.

[0023] Specifically, the principle of the present invention is analyzed as follows: 1. T7 EXO restriction enzyme cycle principle.

[0024] First, hairpin H1 was designed based on the MC-LR aptamer sequence designed by Andy Ng et al. in the literature Environ. Sci. Technol. 2012, 46, 10697−10703. This hairpin can not only be opened by MC-LR binding, but also the exposed DNA fragment can be connected to the lower end of another hairpin H2 after being opened to form a double-stranded blunt end. T7 EXO can catalyze the removal of single nucleotides from the 5' end of the blunt end of double-stranded DNA, remove the 5' end double-stranded part of H2, and drop two sequences, one is a 21nt single-stranded F1, which is used to start the RCA reaction; the other is H1 carrying MC-LR, which participates in the cycle.

[0025] 2. Design basis of Blooming DGB Through padlock on the T-rich sequence, phi29 enzyme, dNTP, Mg 2+ Under the catalytic action of , etc., according to the principle of base complementary pairing, a nanoflower structure rich in A sequence is formed on the rolling circle amplification chain. The formation of DNA-templated gold nanoclusters usually involves three steps. First, adenine (A) bases react with Au 3+ Polyadenylation-Au 3+ Second, sodium citrate converts polyadenine-Au 3+ The complex is reduced to Au 0 Finally, Au 0 AuNCs were assembled along the contour of the polyadenine template, eventually forming a blooming hydrogel.

[0026] 3. ECL detection principle Through the padlock chain T-rich sequence, phi29 enzyme, dNTP, Mg 2+ Under the catalytic action of , etc., according to the principle of base complementary pairing, a nanoflower structure rich in A sequence is formed on the rolling circle amplification chain. After HAuCl4 is reduced in situ on adenine, in the ECL reaction system, AuNC reacts directly with the co-reactant potassium persulfate (K2S2O8) to produce AuNC •+ and SO4 •- , SO4 •- AuNC •+ Reduction to SO4 2- Simultaneous generation of AuNC * , while AuNC * It is the excited state of AuNC. When the excited state transitions to the ground state, the light intensity released is captured by the ECL instrument to generate ECL signal. The whole ECL process is described as follows: AuNC + e → AuNC •- (1) S2O8 2- + e → SO4•- (2) AU •- + SO4 •- → AuNC * + SO4 2- (3) AU * → AuNC + hν (4) The present invention designs and synthesizes self-assembled programmable DNA gel balls for in-situ synthesis of gold nanoclusters for sensitive detection of microcystin. As the content of MC-LR increases, the content of enzyme cleavage products also gradually increases, triggering more hairpins to open and exposing more sequences at the ends of the material. Adenine (A) base and Au 3+ Polyadenylation-Au 3+ The complex is then reduced by sodium citrate to form AuNC along the outline of the polyadenine template, and finally to form a blooming hydrogel. Under the excitation of the photomultiplier tube, AuNC directly reacts with the co-reactant potassium persulfate (K2S2O8) to produce AuNC •+ and SO4 •- , SO4 •- AuNC •+ Reduction to SO4 2- Simultaneous generation of AuNC * , while AuNC * It is the excited state of AuNC. When the excited state transitions to the ground state, it releases light that is captured by the ECL instrument to generate an ECL signal. As the MC-LR content increases, the ECL signal becomes stronger, thereby achieving quantitative detection of the MC-LR content.

[0027] The present invention firstly expands the contact area of ​​the biosensing platform and enhances the ECL signal of AuNC by using a thin layer of electrochemically deposited silver as the substrate; secondly. Hydrogel is selected as the material source, and the non-toxic and harmless characteristics of biomaterials are utilized to avoid the environmentally unfriendly characteristics of organic or inorganic reagents. Finally, thymine can be used as a template for the in-situ reduction of AuNC to successfully construct an ECL biosensor with excellent stability and high sensitivity for the detection of microcystin MC-LR, with a detection range as wide as 0.1pM-1nM and a detection limit as low as 62.3fM. Therefore, the present invention can realize the rapid detection of low-concentration target microcystin MC-LR, and can be applied to the detection of various samples such as food, medicine, milk, beverages, water bodies, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 Schematic diagram of the principle of self-assembled programmable DNA gel spheres for in situ synthesis of gold nanoclusters for sensitive detection of microcystins; Figure 2 The feasibility of the nucleic acid reaction design scheme was verified by gel electrophoresis experiments; Figure 3 TEM images of gel spheres before and after in-situ reduction; Figure 4 To optimize the incubation and concentration map of T7 EXO; Figure 5 It is the relationship diagram and linear relationship between the concentration of microcystin MC-LR and the ECL intensity; Figure 6 The stability and specificity of the ECL biosensor were evaluated. DETAILED DESCRIPTION

[0029] The following embodiments are further descriptions of the content of the present invention as an explanation of the technical content of the present invention, but the essential content of the present invention is not limited to the following embodiments. Ordinary technicians in this field can and should know that any simple changes or replacements based on the essential spirit of the present invention should fall within the scope of protection required by the present invention.

[0030] The literature Environ. Sci. Technol. 2012, 46, 10697−10703 was investigated to screen out MC-LR related aptamers as the analysis object, and the hairpin H1 was designed and synthesized by Shanghai Bioengineering Co., Ltd. The sequence is as follows: H1:5'- GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCTCCGCCGGGCATAATGAGGTGGT -3'. Example

[0031] Design and synthesis of DNA gel balls (DGB).

[0032] First, 10 μL of 10 μM phosphate-modified Padlock chain, 10 μL of 10 μM Primer chain and 10 mM Mg 2+Place in the ep tube for annealing at 95℃ for 5min, slowly cool to room temperature, add 0.2U T4 DNA ligase, and react at 16℃ overnight. Under the action of T4 ligase, the phosphate group at the 5' end of the padlock chain forms a phosphodiester bond with the hydroxyl group at the 3' end to perform cyclization. Then place the ep tube at 65℃ for 15min to inactivate the T4 ligase. Finally, add (10 U / μL 5μL) phi29 DNA polymerase and dNTP (10mM, 10mL) to the ep tube and incubate at 30℃ for 24h. Finally, inactivate the enzyme used in the reaction at 65℃ for 15min, collect the obtained product by centrifugation at 10000rpm for 10min, wash it with ultrapure water 3 times, and then disperse it in 500μL ultrapure water and store it at 4℃ for later use.

[0033] Synthesis of blooming nanogel spheres DGB@AuNCs.

[0034] 50 µL of 1 mM HAuCl4 solution and 50 µL of prepared gel balls (DGB) were added to 0.85 mL of ultrapure water and mixed thoroughly, and then 50 µL of freshly prepared 100 mM trisodium citrate buffer (pH = 6) was added. The mixture was stirred at 90 °C for 30 min (800 rpm), cooled to room temperature, and stored at 4 °C for use. DGB@AuNCs were synthesized and placed in a 4 °C refrigerator for use.

[0035] Design and synthesis of T7 exonuclease Different concentrations of microcystin (MC-LR) were incubated with annealed H1 and H2 at 37°C for 3 h to form MC-LR-H1-H2, which was then stored at 4°C. MC-LR-H1-H2 and 0.21 U of T7 EXO were added to the ep tube for cutting to produce F1.

[0036] Construction of the ECL sensor.

[0037] First, the GCE electrode was polished with alumina slurry. Then, the GCE was thoroughly rinsed with ultrapure water, ultrasonically treated in ethanol and water, and then dried and cleaned at room temperature. The GCE electrode was placed in an electrolyte (5 mM AgNO3, 0.2M KNO3, 1 mM sodium citrate dihydrate, 2.5 g / L polyvinyl pyrrolidone), and deposited at a constant potential of 0.25 V for 15 minutes to obtain a three-dimensional layered silver nanofilm, which was then left to dry. Then 10 μL of 3 μM thiol DNA H3 was added to the electrode and incubated for 4-6 hours; the solution on the electrode was shaken off, and 1 mM purchased MCH was added for half an hour to prevent nonspecific binding. After shaking off the solution on the electrode, 10 μL of the product F1 after enzyme digestion with different concentrations of MC-LR was added and incubated at 37°C for 3 hours. After shaking off the solution on the electrode, 10 μL of DGB@AuNC and 10 mM Mg were added to the electrode. 2+ 10 μL was incubated at 37°C for 2 h. Finally, the electrode was placed in 0.05 mM K2S2O8 and ECL measurements were performed at -2 V to 0 V with a photomultiplier tube at 750 V.

[0038] like Figure 2 Shown is the use of polyacrylamide gel electrophoresis (PAGE) to analyze DNA structures alone.

[0039] Figure 2 In A: 6% PAGE analysis of enzyme digestion. Channel 1, MC-LR replacement chain (sequence partially complementary to MC-LR aptamer); Channel 2, H1; Channel 3, H2; Channel 4, F1; Channel 5, MC-LR+H1; Channel 6, MC-LR+H1+H2; Channel 7, MC-LR+H1+H2+T7 EXO; Channel 8, H1+H2+T7 EXO.

[0040] Figure 2 In B, the DNA reaction on the electrode is 6% PAGE. Channel 1, F1; Channel 2, H3; Channel 3, padlock; Channel 4, primer; Channel 5, primer+padlock+T4; Channel 6, F1+H3; Channel 7, F1+H3+primer; Channel 8, H3+primer; Channel 9, F1+H3+RCA.

[0041] like Figure 2As shown in A, when H1 and MC-LR are introduced into channel 5, a new band can be observed in lane 5, proving that H1 can bind to MC-LR. Similarly, the new band in channel 6 also shows that MC-LR generates a larger molecular weight conjugate with H1 and H2. Compared with channel 6, a new band appears below channel 7, which is the enzyme cleavage product F1. Compared with channel 4, it is found that an enzyme cleavage reaction has occurred. When there is no MC-LR in channel 8, H1 and H2 do not bind and no enzyme cleavage reaction occurs. The above results show that the designed enzyme cleavage reaction is successful.

[0042] like Figure 2 As shown in A, when primer and padlock are introduced into channel 5, a new band can be observed in lane 5, proving that primer and padlock are successfully combined under the action of T4. Similarly, the new band in channel 6 also shows the combination of F1 and H3. Channel 7 shows that F1, H3 and primer generate a larger molecular weight conjugate. Compared with channel 8, it is found that H3 and primer do not bind without F1. Channel 9 shows the formation of rolling circle amplification products. The above results show that the designed biosensor is successfully assembled.

[0043] like Figure 3 The following are transmission images of the gel spheres before and after in situ reduction. The TEM images show that T-rich DNA can be used as a template for in situ reduction of gold nanoclusters. (A) Transmission image of gel sphere DGB, (B) DGB@AuNC, and (C) AuNC.

[0044] like Figure 4 The figure shows the optimized T7 EXO incubation and concentration. In order to study the moment when the ECL signal is the highest, the effects of different T7 EXO concentrations and different incubation times on the ECL signal were tested. Figure 4 A, we chose 100 min as the optimal incubation time; Figure 4 From B, 0.21U can be selected as the optimal concentration of T7EXO.

[0045] Figure 5 The figure shows the relationship between the concentration of microcystin MC-LR and the ECL intensity and the linear relationship. The addition of a series of MC-LR concentrations ranging from 0.1 pM to 1 nM can significantly increase the ECL intensity, which makes the ECL intensity and the logarithm of the MC-LR concentration have a linear relationship. Figure 6 The stability and specificity of the ECL biosensor were evaluated. A 10pM MC-LR concentration was selected for stability testing, and the relative standard deviation of the sensing platform was 2.46%. 2+ , Ca 2+ , Cu 2+, Fe 2+ , Fe 3+ , K + Mg 2+ 、Na + 、Zn 2+ By comparing and evaluating the specificity, it was found that even in the presence of interferents, the ECL nucleic acid sensor was still sensitive to the detection of MC-LR.

[0046] It should be noted that the above-mentioned technical contents of the present invention are only for explanation and clarification to enable those skilled in the art to understand the technical essence of the present invention, so the technical contents are not used to limit the substantial protection scope of the present invention. The substantial protection scope of the present invention shall be subject to the claims. Those skilled in the art should know that any modification, equivalent substitution and improvement based on the substantial spirit of the present invention shall be within the substantial protection scope of the present invention.

Claims

1. An ECL biosensor for detecting microcystin MC-LR is prepared by the following method: (1) DNA gel ball DGB was prepared using Padlock chain and Primer chain under the action of T4 ligase, Phi29 enzyme and dNTP; (2) Using HAuCl4 and trisodium citrate to in situ reduce and synthesize gold nanoclusters on DNA gel balls DGB, the blooming nanogel balls DGB@AuNCs were obtained; (3) using microcystin MC-LR to open hairpin H1, so that hairpin H1 is connected to hairpin H2 to form MC-LR-H1-H2; (4) Using T7 EXO to cut MC-LR-H1-H2 to obtain the enzyme digestion product F1 chain; (5) Electroplating silver nanofilm on the pretreated electrode, then modifying the hairpin H3 on the electrode surface and adding MCH to prevent specific binding; (6) adding the F1 chain obtained in step (4) to the electrode to open the hairpin H3; (7) Add the nanogel balls DGB@AuNCs bloomed in step (2) to the electrode.

2. The ECL biosensor according to claim 1, characterized in that: Step (1) first anneal the two Padlock chains and the Primer chain at 85-95°C and cool to room temperature, then add T4 ligase to react, and then react with phi29 enzyme and dNTP.

3. The ECL biosensor according to claim 1, characterized in that: Step (2) is to fully mix 0.8-1.2 mM HAuCl4 solution and gel ball DGB, then add 100 mM trisodium citrate buffer with pH=6, stir and cool at 80-95°C.

4. The ECL biosensor according to claim 1, characterized in that: Step (3) is to incubate the microcystin MC-LR with the annealed hairpin H1 and hairpin H2 at 35-38° C. for 2-4 hours to form MC-LR-H1-H2.

5. The ECL biosensor according to claim 1, characterized in that: Step (4) is to add MC-LR-H1-H2 and T7 EXO into the ep tube, and utilize the characteristic of T7 EXO to cut the blunt end from the 5' end to obtain the cut product F1.

6. The ECL biosensor according to claim 1, characterized in that: Step (5) electroplating the silver nanofilm is to place the electrode in an electrolyte and deposit it at a constant potential of 0.1-0.5 V to obtain a three-dimensional layered silver nanofilm; the electrolyte contains 4-6 mM AgNO3, 0.15-0.25 M KNO3, 0.6-1.5 mM sodium citrate dihydrate, and 2-3 g / L polyvinyl pyrrolidone.

7. The ECL biosensor according to any one of claims 1 to 6, characterized in that: Prepared by the following method: (1) Mix 10 μL of 10 μM Padlock chain and 10 μL of 10 μM primer chain in 10 mM Mg 2+ The solution was heated to 95°C for annealing for 5 minutes and then cooled to room temperature; 0.2U of T4 ligase was added and incubated at 16°C overnight, and after inactivating T4 ligase at 65°C, 5μL of 10U / μL of phi29 DNA polymerase and 10mL of 10mM dNTP were added, and incubated at 30°C for 24h. Finally, the enzyme used in the reaction was inactivated at 65°C, and the obtained product was collected by centrifugation at 10000rpm for 10min and washed with ultrapure water for 2-4 times, and then dispersed in 500μL of ultrapure water and stored at 4°C for later use; (2) Add 50 µL of 1 mM chloroauric acid solution and 50 µL of prepared DNA gel beads DGB to ultrapure water and mix thoroughly. Then add 50 µL of 100 mM trisodium citrate buffer (pH 6). Stir the mixture at 90 °C for 30 min, cool to room temperature, and store at 4 °C for later use to synthesize DGB@AuNCs. Place the mixture in a 4 °C refrigerator for later use. (3) Incubate the microcystin MC-LR with the annealed hairpins H1 and H2 at 37°C for 3 h to form MC-LR-H1-H2, and store at 4°C; (4) Add MC-LR-H1-H2 and T7 EXO into the ep tube, and use the characteristic of T7 EXO to cut the blunt end from the 5' end to obtain the cut product F1; (5) The electrode was placed in an electrolyte containing 5 mM AgNO3, 0.2 M KNO3, 1 mM sodium citrate dihydrate, and 2.5 g / L polyvinyl pyrrolidone, and deposited at a constant potential of 0.25 V for 15 min to obtain a three-dimensional layered silver nanofilm. 10 μL, 3 μM thiol hairpin H3 was then added to the electrode and incubated for 4-6 h, and MCH was added to prevent nonspecific adsorption; (6) Add 10 μL of the product F1 from step (4) to the electrode and incubate at 37°C for 1-3 h; (7) Finally, add 10 μL of DGB@AuNCs obtained in step (2) to the electrode and incubate at 37 °C for 1-3 h.

8. Use of the ECL biosensor according to any one of claims 1 to 7 in detecting microcystins.

9. The use according to claim 8, characterized in that The electrode was placed in 0.03-0.08 mM K2S2O8 and ECL measurements were performed at -2 V to 0 V with a photomultiplier tube at 700-800 V.

Images