Primer, molecular marker and identification method for identifying sex of hucho bleekeri and application

Abstract

The invention provides a primer for identifying sex of hucho bleekeri, a molecular marker, an identification method and application, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 5, and the specific primer for identifying the sex comprises an upstream primer sequence 5 '-GAACTCCCTCAGTTGCTA-3'; and the sequence of the downstream primer is 5 '-TTGGAGCG GCAATGCAGTAT-3'. According to the identification method, only DNA samples of fin rays need to be extracted, female fishes and male fishes are judged through agarose gel electrophoresis bands of PCR amplification products, damage to fish bodies is small, the method can be used for early sex identification of hucho bleekeri, and the sex proportion can be clearly known while the hucho bleekeri is protected. The 18s gene is taken as a reference, whether the deletion of the strip is caused by genome difference can be accurately judged, and misjudgment caused by the deletion of the male fish sex specific primer strip due to reasons such as sample degradation, personal error and PCR amplification failure is avoided. The method is simple, easy to implement, low in cost, free of tedious processes such as sequencing and the like, and high in operability and practicability.

Description

Technical Field

[0001] The invention relates to a primer, a molecular marker and an identification method for identifying the sex of Sichuan-Shaanxi Taimen, and belongs to the field of genetics and molecular biology. Background Art

[0002] Hucho bleekeri Kimura belongs to the genus Hucho of the family Salmonidae, order Salmoniformes. It is also known as Brussels's taimen, Yangtze River taimen, tiger fish, cat fish, tiger fish, etc. In the 1980s, due to overfishing, water pollution and blocking of migration routes, the resources were sharply reduced. It is now listed as a national first-class protected animal in the "National Key Protected Wildlife List" and an endangered species in the "Red List of Endangered Species of the World Conservation Union".

[0003] Young Sichuan-Shaanxi Taimen often have dark horizontal stripes on the sides of their bodies, and their fins are light yellow. The young fish grow slowly, and become sexually mature at 4-5 years old. The spawning season is from May to June each year. During the reproductive period, the abdomen, pelvic fins, and lower fork of the caudal fin are orange-red. After sexual maturity, there is no difference in body shape or color between male and female fish, and there are no obvious gender characteristics, so it is impossible to identify their gender by body shape or color. Sichuan-Shaanxi Taimen is a national first-class protected animal. During field surveys, the traditional method of killing fish to remove gonads and making slices for gender identification cannot be used. Therefore, it is impossible to fully understand the gender ratio of wild Sichuan-Shaanxi Taimen resources.

[0004] At present, the fully artificial breeding of Sichuan-Shaanxi Taimen has been successful and is expected to be further developed and utilized. The eggs of Sichuan-Shaanxi Taimen are similar to those of rainbow trout and Atlantic salmon and can be made into caviar. The commercial value of female fish exceeds that of male fish. At the same time, the fish is sexually mature at 4 to 5 years old. During reproduction, the semen of one male fish can be used to fertilize multiple female fish. Therefore, adjusting the breeding ratio of female and male fish during the juvenile stage can save the cost of parent fish breeding. In view of the above reasons, it is urgent to develop a simple and accurate method to identify the sex of Sichuan-Shaanxi Taimen during the juvenile stage without killing the fish. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention provides a primer, a molecular marker, an identification method and an application for identifying the sex of Sichuan-Shaanxi Taimen.

[0006] In order to achieve the above object, the technical solution provided by the present invention is:

[0007] A molecular marker for identifying the sex of Sichuan-Shaanxi Taimen, the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 5.

[0008] The sex marker specific primers include upstream primers and downstream primers:

[0009] The upstream primer sequence was 1F 5′-GAACTCCCCTCCAGTTGCTA-3′;

[0010] The downstream primer sequence was 1R 5′-TTGGAGCGGCAATGCAGTAT-3′.

[0011] The method for identifying the sex of Sichuan-Shaanxi Tailings using the primer comprises the following steps:

[0012] (1) Sample acquisition: When the Sichuan-Shaanxi Taimen are breeding, samples of fertile female and male fish are collected, and the tail fins of about 0.5 cm2 are cut off. The fins are placed in 95% ethanol by volume and the ethanol is replaced once every 4 h, 24 h, and 48 h. After the ethanol is replaced, the fins are stored in a -20°C refrigerator for future use;

[0013] (2) DNA extraction: The fin samples were taken out, rinsed repeatedly with clean water, dried with filter paper, cut into pieces, and DNA was extracted using a kit. The DNA concentration was adjusted to 30 ng / l and used as a template for PCR amplification.

[0014] (3) PCR amplification: The amplification system includes 2 l of 30 ng / l DNA template, 12.5 l of 2× PCR mix, 1.0 l of 10M sex marker-specific upstream and downstream primers, 0.7 l of 10M 18s reference upstream and downstream primers, and enzyme-free water to make up to 25 l. After mixing, PCR amplification was performed;

[0015] PCR amplification program: 95℃ pre-denaturation for 4 min, then 95℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 30 sec, amplification for 32 cycles; then 72℃ extension for 4 min to obtain the amplified product;

[0016] (4) Gel electrophoresis detection: Use agarose gel electrophoresis to detect the amplified product and determine the gender based on the electrophoresis results.

[0017] The 18s reference primers include upstream primers and downstream primers:

[0018] The upstream primer sequence was: 18sF 5′-CATGATGGAGCCTCCGATCC-3′;

[0019] The downstream primer sequence is: 18sR 5′-GCCAACACTGTGCTGTCTTG-3′.

[0020] The method for determining sex based on the electrophoresis results is: if only one 141bp 18s reference primer band can be amplified, the sample is a female fish; if in addition to a 141bp 18s reference primer band, a 229bp sex marker-specific primer band can be amplified, it is a male fish.

[0021] The primers can be used to identify the sex of Sichuan-Shaanxi Taimen salmon.

[0022] Beneficial effects of the present invention

[0023] 1. The sex identification method of Sichuan-Shaanxi Taimen of the present invention only requires extracting DNA samples from fin rays, and judging female and male fish by agarose gel electrophoresis bands of PCR amplification products. This method does little harm to the fish body and does not require killing the fish. It can be used for early sex identification of Sichuan-Shaanxi Taimen, and can clearly understand the sex ratio while protecting the Sichuan-Shaanxi Taimen, a national first-class protected animal.

[0024] 2. The present invention uses the 18s gene as a reference and can accurately determine whether the absence of the band is caused by genomic differences, thereby avoiding misjudgment caused by the absence of the sex-specific primer band of male fish due to sample degradation, human error, PCR amplification failure, etc.

[0025] 3. The method of the present invention is simple, easy to implement, low-cost, does not require tedious processes such as sequencing, and has good operability and practicality. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 : Agarose gel electrophoresis results. DETAILED DESCRIPTION

[0027] Example 1: Primers, molecular markers and identification methods for identifying the sex of Sichuan-Shaanxi Taimen

[0028] 1. Sample acquisition: 30 female and male samples of Sichuan and Shaanxi Taimen were collected when they were breeding, and the tail fin of each fish was cut about 0.5 cm 2 The fins of each fish were stored separately. To prevent DNA degradation, the fins were stored in 95% ethanol by volume, and the ethanol was replaced once every 4h, 24h, and 48h. After the replacement of ethanol, the fins were stored in a -20℃ refrigerator for later use.

[0029] 2. DNA extraction: Take out the fin samples, rinse them repeatedly with clean water, absorb the water with filter paper, cut them into pieces, and extract DNA using the QIAGEN DNA extraction kit. Adjust the DNA concentration to 30 ng / μl and use it as a PCR amplification template.

[0030] 3. PCR amplification: The amplification system includes 2 μl of 30 ng / μl DNA template, 12.5 μl of 2×PCRmix, 1.0 μl of 10 μM sex marker specific upstream and downstream primers, 0.7 μl of 10 μM 18s reference upstream and downstream primers, and enzyme-free water to make up to 25 μl;

[0031] PCR amplification program: 95℃ pre-denaturation for 4min, then 95℃ denaturation for 30sec, 60℃ annealing for 30sec, 72℃ extension for 30sec, amplification for 32 cycles; then 72℃ extension for 4min, and finally 10℃ hold. Gender marker specific primers:

[0032] Upstream primer sequence: 1F 5′GAACTCCCCTCCAGTTGCTA-3′ (SEQ ID NO: 1);

[0033] Downstream primer sequence: 1R 5′-TTGGAGCGGCAATGCAGTAT-3′ (SEQ ID NO: 2).

[0034] 18s reference primer:

[0035] Upstream primer sequence: 18sF 5′-CATGATGGAGCCTCCGATCC-3′ (SEQ ID NO: 3);

[0036] Downstream primer sequence: 18sR 5′-GCCAACACTGTGCTGTCTTG-3′ (SEQ ID NO: 4).

[0037] Since there are certain differences in the amplification efficiencies of sex marker-specific primers and 18s reference primers, it was found through experimental optimization that both primers could obtain relatively clear bands when the molar ratio was 1:0.7.

[0038] 4. Gel electrophoresis detection: Use 1.8-2.0% agarose gel electrophoresis to detect the PCR amplification product, spot 6-8μl, and record the electrophoresis results with a gel imager.

[0039] The gel imager records the electrophoresis results. Figure 1 , 30 female fish samples could only amplify one 141bp 18s reference primer band; 30 male fish samples could amplify not only one 141bp 18s reference primer band, but also one 229bp sex marker specific primer band, which was consistent with the sampling results, proving that the sex identification method of the present invention is reliable.

[0040] 5. Molecular marker: The product amplified by the sex marker-specific primers was cloned and sequenced, and the resulting sequence was SEQ ID NO: 5, which was used as the sex marker-specific molecular marker sequence.

[0041] The product amplified by the 18s reference primer was cloned and sequenced, and the obtained sequence was SEQ ID NO: 6.

[0042] Molecular marker sequence SEQ ID NO: 5:

[0043] GAACTCCCCTCCAGTTGCTAATTACTACTGGGAAAGTCTTTGGTCAATCCAC

[0044] TGGAAAGCCCCTCCAAATGGTAAATGCTACTGGGAAACACATACATCAATC

[0045] CACTGTAATGCCAATTTAACTGGCAATTACTAGTGGGAAACTCATTTATCAA

[0046] TCCCCTGGAATGCCCCTCCAACTGGTAATACTACTGGGAAAGTCTTCGTGCAATATACTGCATTGCCGCTCCAA。

[0047] 18s reference sequence SEQ ID NO: 6:

[0048] CATGATGGAGCCTCCGATCCAGACGGAGTACTTACGCTCTGCAGGGGTGAT

[0049] GGTGGAGGGGGCCAGAGAGGTGATCTCCTTCTGCATCCTGTCAGCGATGCC GGGGTACATGGTGGTTCCTCAAGACAGCACAGTGTTGGC。

Claims

1. A molecular marker for identifying the sex of Sichuan-Shaanxi Taimen, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

5.

2. A primer for molecular markers for identifying the sex of Sichuan-Shaanxi Taimen according to claim 1, characterized in that: The sex marker specific primers include upstream primers and downstream primers: The upstream primer sequence was 1F 5′-GAACTCCCCTCCAGTTGCTA-3′; The downstream primer sequence was 1R 5′-TTGGAGCGGCAATGCAGTAT-3′.

3. A method for identifying the sex of Sichuan-Shaanxi Taimen using the primers described in claim 2, characterized in that: The following steps are involved: (1) Sample acquisition: When the Sichuan-Shaanxi Taimen were breeding, samples of fertile female and male fish were collected and the tail fins of each were cut about 0.5 cm. 2 , the fins were stored in 95% ethanol by volume, and the ethanol was replaced once at 4h, 24h and 48h respectively. After the ethanol was replaced, the fins were stored in a -20℃ refrigerator for future use; (2) DNA extraction: The fin samples were taken out, rinsed repeatedly with clean water, dried with filter paper, cut into pieces, and DNA was extracted using a kit. The DNA concentration was adjusted to 30 ng / μl and used as a template for PCR amplification. (3) PCR amplification: The amplification system includes 2 μl of 30 ng / μl DNA template, 12.5 μl of 2× PCR mix, 1.0 μl of 10 μM sex marker-specific upstream and downstream primers, 0.7 μl of 10 μM 18s reference upstream and downstream primers, and enzyme-free water to make up to 25 μl. After mixing, PCR amplification is performed; PCR amplification program: 95℃ pre-denaturation for 4 min, then 95℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 30 sec, amplification for 32 cycles; then 72℃ extension for 4 min to obtain the amplified product; (4) Gel electrophoresis detection: Use agarose gel electrophoresis to detect the amplified product and determine the gender based on the electrophoresis results.

4. The method according to claim 3, characterized in that The upstream primer sequence of the 18s reference primer is: 18sF 5′-CATGATGGAGCCTCCGATCC-3′; the downstream primer sequence is: 18sR 5′-GCCAAC ACTGTGCTGTCTTG-3′.

5. The method according to claim 3, characterized in that The method for determining sex based on the electrophoresis results is: if only one 141bp 18s reference primer band can be amplified, the sample is a female fish; if in addition to a 141bp 18s reference primer band, a 229bp sex marker-specific primer band can be amplified, it is a male fish.

6. Use of the primer as claimed in claim 1 in identifying the sex of Sichuan-Shaanxi Taimen.

Images