Electrochemiluminescence sensor for detecting AFB1 and ZEN as well as preparation method and application of electrochemiluminescence sensor

Abstract

The invention provides an electrochemiluminescence sensor for detecting AFB1 and ZEN as well as a preparation method and application thereof, and relates to the technical field of analytical chemistry, the electrochemiluminescence sensor comprises a DNA tetrahedron, an AFB1 signal probe and a ZEN signal probe which are self-assembled on a gold electrode; the AFB1 signal probe is prepared from an AFB1 aptamer and an N-CDs1 / ZIF-8 composite material; the ZEN signal probe comprises a ZEN aptamer and an N-CDs2 / ZIF-8 composite material; the DNA tetrahedron is formed by combining four single-stranded DNAs, two N-doped carbon dots (N-CDs) are used as signal sources, the DNA tetrahedron (DTN) is used as a carrier, ZIF-8 is used as a signal enhancement unit, and based on high specificity of aptamer and target combination reaction, the sensitivity of the sensor is improved, and simultaneous and rapid detection of AFB1 and ZEN in coix seeds is realized. The operation is simple and the sensitivity is high; and the detection accuracy and stability are improved.

Description

Technical Field

[0001] The present invention relates to the technical field of analytical chemistry, and in particular to an electrochemiluminescence sensor for detecting AFB1 and ZEN, a preparation method and application thereof. Background Art

[0002] With the aging of the population, the acceleration of the development trend of sub-health and chronic diseases, "nurturing" and "prevention" have become the focus of people's daily health care. Among them, the "medicine and food are of the same origin" has received much attention and recognition, which has also led to a gradual increase in the demand for "medicine and food" Chinese medicinal materials. In particular, for coix seeds, which have important edible value and medicinal functions such as diuresis, spleen strengthening and diarrhea, as a common "medicine and food" Chinese medicinal material, under the influence of various internal factors (high starch content) and external environmental conditions (high temperature and high humidity), coix seeds are very easy to be contaminated with fungal toxins during their growth, harvesting, processing and storage. Among them, aflatoxin B1 (AFB1) and zearalenone (ZEN) have the highest contamination rate and detection rate. AFB1 and ZEN are common fungal toxins in food, Chinese medicinal materials and "medicine and food" Chinese medicinal materials. Although the content is low, they are very toxic and may cause irreversible acute and chronic toxicity to the human body. Therefore, developing sensitive and accurate methods to quickly detect the contamination levels of AFB1 and ZEN in large quantities of coix seeds is of great significance to ensure its quality and safety and the physical and mental health of consumers.

[0003] Current methods for detecting mycotoxins in Chinese medicinal materials (such as high performance liquid chromatography and liquid-mass spectrometry) usually rely on large, expensive instruments and professional operators, and are mostly limited to laboratory use. It is difficult to achieve low-cost rapid detection of AFB1 and ZEN in large quantities of coix seed samples in Chinese medicinal material distribution centers. Therefore, it is urgent to develop a practical, sensitive and accurate on-site rapid detection method.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] One of the purposes of the present invention is to provide an electrochemiluminescence sensor for detecting AFB1 and ZEN, so as to solve the technical problem that there is a lack of a method for rapidly and simultaneously detecting AFB1 and ZEN in the prior art.

[0006] A second object of the present invention is to provide a method for preparing the electrochemiluminescence sensor.

[0007] A third object of the present invention is to provide a method for detecting AFB1 and ZEN.

[0008] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0009] In a first aspect, the present invention provides an electrochemiluminescent sensor for detecting AFB1 and ZEN, wherein the electrochemiluminescent sensor comprises a DNA tetrahedron and an AFB1 signal probe and a ZEN signal probe self-assembled on a gold electrode;

[0010] The AFB1 signal probe includes an AFB1 aptamer and an N-CDs1 / ZIF-8 composite material;

[0011] The ZEN signal probe includes a ZEN aptamer and a N-CDs2 / ZIF-8 composite material;

[0012] The DNA tetrahedron is formed by combining four single-stranded DNAs.

[0013] Furthermore, the nucleotide sequence of the AFB1 aptamer is shown in SEQ ID NO:1, and the nucleotide sequence of the ZEN aptamer is shown in SEQ ID NO:2.

[0014] Preferably, the four single-stranded DNAs include chain A, chain B, chain C and chain D, the nucleotide sequence of the A chain is shown in SEQ ID NO:3, the nucleotide sequence of the B chain is shown in SEQ ID NO:4, the nucleotide sequence of the C chain is shown in SEQ ID NO:5, and the nucleotide sequence of the D chain is shown in SEQ ID NO:6.

[0015] In a second aspect, the present invention provides a method for preparing the electrochemiluminescent sensor, comprising modifying an AFB1 signal probe and a ZEN signal probe on a gold electrode fixed with a DNA tetrahedron to obtain an electrochemiluminescent sensor.

[0016] Further, the method comprises adding a DNA tetrahedron solution to the gold electrode treated with alumina slurry for incubation, adding a 6-mercapto-1-hexanol solution after the incubation, and then adding an AFB1 signal probe solution and a ZEN signal probe solution for incubation to obtain an electrochemiluminescent sensor;

[0017] Preferably, the method for preparing the alumina slurry comprises taking alumina powders with a particle size of 0.3 μm and 0.05 μm respectively, placing them on the surface of a polishing cloth, adding a small amount of ultrapure water to make them into a slurry state, and obtaining the alumina slurry;

[0018] Preferably, the concentration of the DNA tetrahedron solution is 0.5 to 1.5 μM, preferably 1.0 μM;

[0019] Preferably, the concentration of the 6-mercapto-1-hexanol solution is 8 to 12 mM, preferably 10 mM;

[0020] Preferably, the concentration of the AFB1 signal probe solution is 2.0-3.0 mg / mL, preferably 2.5 mg / mL;

[0021] Preferably, the concentration of the ZEN signal probe solution is 2.0 to 3.0 mg / mL, preferably 2.5 mg / mL;

[0022] Preferably, the volume ratio of the added amounts of the DNA tetrahedron solution, the 6-mercapto-1-hexanol solution, the AFB1 signal probe solution and the ZEN signal probe solution is 7-12:7-12:7-12:7-12, preferably 10:10:10:10;

[0023] Preferably, the incubation temperature for adding the DNA tetrahedron solution and adding the AFB1 signal probe solution and the ZEN signal probe solution is independently 35°C to 40°C, preferably 37°C;

[0024] Preferably, the incubation time of adding the DNA tetrahedron solution and adding the AFB1 signal probe solution and the ZEN signal probe solution is independently at least 1 hour;

[0025] Preferably, after the incubation, the electrode is further rinsed with a buffer solution and dried;

[0026] Preferably, the method for preparing the DNA tetrahedron comprises mixing four single-stranded DNAs to self-assemble into a DNA tetrahedron;

[0027] Preferably, the concentrations of the four single-stranded DNAs in the self-assembled system are independently 3 to 8 μM, preferably 5 μM.

[0028] Furthermore, the preparation method of the AFB1 signal probe comprises adding an AFB1 aptamer to the prepared N-CDs1 / ZIF-8 composite material, and incubating to obtain the AFB1 signal probe;

[0029] The preparation method of the ZEN signal probe comprises adding a ZEN aptamer to the prepared N-CDs2 / ZIF-8 composite material, and incubating to obtain an AFB1 signal probe;

[0030] Preferably, when the N-CDs1 / ZIF-8 composite material is incubated with the AFB1 aptamer, the concentration of the N-CDs1 / ZIF-8 composite material is 2-3 mg / mL, preferably 2.5 mg / mL; the concentration of the AFB1 aptamer is 3-8 μM, preferably 5 μM; the volume ratio of the N-CDs1 / ZIF-8 composite material to the AFB1 aptamer is 1:1;

[0031] Preferably, when the N-CDs2 / ZIF-8 composite material is incubated with the ZEN aptamer, the concentration of the N-CDs2 / ZIF-8 composite material is 2-3 mg / mL, preferably 2.5 mg / mL; the concentration of the ZEN aptamer is 3-8 μM, preferably 5 μM; and the volume ratio of the N-CDs1 / ZIF-8 composite material to the ZEN aptamer is 1:1.

[0032] Furthermore, the preparation method of the N-CDs1 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs1 and incubating in the dark, standing after the incubation, centrifuging and discarding the supernatant, and drying to obtain the N-CDs1 / ZIF-8 composite material;

[0033] The preparation method of the N-CDs2 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs2 and incubating in the dark, standing after the incubation, centrifuging and discarding the supernatant, and drying to obtain the N-CDs2 / ZIF-8 composite material;

[0034] Preferably, the mass concentration ratio of ZIF-8 to N-CDs1 is 1:1.5 to 2.5, preferably 1:2;

[0035] Preferably, the mass concentration ratio of ZIF-8 to N-CDs2 is 1:1.5 to 2.5, preferably 1:2;

[0036] Preferably, the incubation temperature in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 23°C to 30°C, preferably 25°C;

[0037] Preferably, the incubation time in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 10 to 14 h, preferably 12 h;

[0038] Preferably, the standing time is 8 to 12 minutes, preferably 10 minutes;

[0039] Preferably, the centrifugation further comprises washing the precipitate with water at least 3 times.

[0040] Furthermore, the preparation method of N-CDs1 comprises dissolving citric acid and urea in water, placing the mixed solution in a reactor, reacting at 160° C., cooling to room temperature after the reaction is completed, dialyzing, and drying to obtain N-CDs1;

[0041] Preferably, the mass concentration ratio of citric acid to urea is 1:1.5-2.5, preferably 1:2;

[0042] Preferably, the reaction time in the preparation method of N-CDs1 is 3 to 5 hours, preferably 4 hours.

[0043] Preferably, the preparation method of N-CDs2 comprises dissolving citric acid in dimethylformamide, adding hydrazine hydrate to form a milky white gel, placing the milky white gel in a reaction kettle, reacting at 180° C., cooling to room temperature after the reaction, centrifuging, taking the supernatant for dialysis, and drying to obtain N-CDs2;

[0044] Preferably, the mass concentration of citric acid in dimethylformamide is 0.1-0.3 g / mL, preferably 0.21 g / mL;

[0045] Preferably, the volume ratio of hydrazine hydrate to dimethylformamide is 1:9-11; preferably 1:10;

[0046] Preferably, the reaction time in the preparation method of N-CDs2 is 10 to 14 h, preferably 12 h;

[0047] Preferably, the drying temperature is 50°C to 65°C, preferably 60°C;

[0048] Preferably, the drying is vacuum drying;

[0049] Preferably, the centrifugal speed is 8000-12000 rpm, preferably 10000 rpm;

[0050] Preferably, the centrifugation time is 8 to 12 minutes, preferably 10 minutes;

[0051] Furthermore, the preparation method of ZIF-8 comprises mixing a methylimidazole aqueous solution and a zinc acetate dihydrate aqueous solution, reacting at room temperature, and centrifuging and drying after the reaction is completed to obtain ZIF-8;

[0052] Preferably, the concentration of the methylimidazole aqueous solution is 1.3-1.8 mol / L, preferably 1.5 mol / L;

[0053] Preferably, the concentration of the zinc acetate dihydrate aqueous solution is 22-28 mmol / L, preferably 25 mmol / L;

[0054] Preferably, the volume ratio of the methylimidazole aqueous solution to the zinc acetate dihydrate aqueous solution is 10:1 to 8:1, preferably 9:1;

[0055] Preferably, the reaction time of the methylimidazole aqueous solution and the zinc acetate dihydrate aqueous solution is 4 to 6 hours, preferably 5 hours.

[0056] In a third aspect, the present invention provides a method for detecting AFB1 and ZEN, wherein the sample solution to be tested is added to the above-mentioned electrochemiluminescence sensor or incubated on the above-mentioned electrochemiluminescence sensor, and after incubation, the electrochemiluminescence signal is detected using a gold electrode as a working electrode.

[0057] Furthermore, the incubation time of the sample solution to be tested is 15 to 25 minutes, preferably 20 minutes;

[0058] The incubation temperature of the sample solution to be tested is 25°C to 40°C, preferably 37°C;

[0059] The detecting of the electrochemiluminescent signal comprises placing a working electrode, an auxiliary electrode and a reference electrode in an electrochemiluminescent reaction solution, and detecting the electrochemiluminescent signal by cyclic voltammetry;

[0060] Preferably, the electrochemiluminescent reaction solution comprises K2S2O8 with a concentration of 0.05 to 0.15 M and H2O2 with a concentration of 0.005 to 0.015 M, and the solvent is 0.1 M PBS buffer, preferably K2S2O8 with a concentration of 0.1 M and H2O2 with a concentration of 0.01 M;

[0061] Preferably, the pH of the electrochemiluminescent reaction solution is 6.2 to 7.4, preferably 7.4;

[0062] Preferably, the scanning voltage of the cyclic voltammetry is 0.8 to -1.6 V;

[0063] Preferably, the scanning speed of the cyclic voltammetry is 80 to 120 mV / s, preferably 100 mV / s;

[0064] Preferably, the photomultiplier voltage is 800V.

[0065] The present invention provides an electrochemiluminescence sensor for detecting AFB1 and ZEN, which uses two nitrogen-doped carbon dots (N-CDs) with excellent electrochemiluminescence (ECL) performance and environmental friendliness as signal sources, DNA tetrahedron (DTN) as a carrier, and ZIF-8 as a signal enhancement unit. Based on the high specificity of the binding reaction between the aptamer and the target, the sensitivity of the sensor is improved, and the simultaneous rapid detection of AFB1 and ZEN in coix seed is achieved. On the other hand, the pyramid-shaped ECL aptamer sensor constructed by the preparation method of the electrochemiluminescence sensor for detecting AFB1 and ZEN provided by the present invention is simple to operate, highly sensitive, and can achieve the simultaneous rapid detection of AFB1 and ZEN in coix seed. On the other hand, the method for detecting AFB1 and ZEN provided by the present invention can be used for the simultaneous detection of AFB1 and ZEN in a sample to be tested, and the method is simple, has good specificity, and improves the accuracy and stability of the detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0067] Figure 1 A schematic diagram of the preparation and detection principle of an electrochemiluminescent sensor for detecting AFB1 and ZEN provided in Example 1 of the present invention;

[0068] Figure 2 The ECL signal reaction graph and standard curve graph of different concentrations of AFB1 and ZEN provided in Example 5 of the present invention;

[0069] Figure 3 A specificity comparison diagram of the electrochemiluminescence sensor for detecting AFB1 and ZEN provided in Example 5 of the present invention;

[0070] Figure 4 This is a graph for evaluating the reproducibility of the electrochemiluminescence sensor for detecting AFB1 and ZEN provided in Example 5 of the present invention;

[0071] Figure 5 This is a stability evaluation diagram of the electrochemiluminescence sensor for detecting AFB1 and ZEN provided in Example 5 of the present invention. DETAILED DESCRIPTION

[0072] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. The meaning and scope of the terms should be clear, however, in the case of any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. In this application, unless otherwise stated, the use of "or" means "and / or". In addition, the use of the term "including" and other forms is non-limiting.

[0073] The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated.

[0074] In one aspect, the present invention provides an electrochemiluminescent sensor for detecting AFB1 and ZEN, wherein the electrochemiluminescent sensor comprises a DNA tetrahedron and an AFB1 signal probe and a ZEN signal probe self-assembled on a gold electrode;

[0075] The AFB1 signal probe includes an AFB1 aptamer and an N-CDs1 / ZIF-8 composite material;

[0076] The ZEN signal probe includes a ZEN aptamer and a N-CDs2 / ZIF-8 composite material;

[0077] The DNA tetrahedron is formed by combining four single-stranded DNAs.

[0078] The electrochemiluminescence sensor uses two nitrogen-doped carbon dots (N-CDs) with excellent electrochemiluminescence (ECL) performance and environmental friendliness as signal sources, DNA tetrahedron (DTN) as carrier, and ZIF-8 as signal enhancement unit. Based on the high specificity of the aptamer-target binding reaction, the sensor sensitivity is improved to achieve the simultaneous rapid detection of AFB1 and ZEN in coix seed. It is conducive to the smooth progress of traditional Chinese medicine mycotoxin detection, the development of traditional Chinese medicine quality inspection industry, and also provides a general tool for the analysis of various trace components in the fields of food safety and environmental monitoring.

[0079] In some specific embodiments, the nucleotide sequence of the AFB1 aptamer is shown as SEQ ID NO:1, and the nucleotide sequence of the ZEN aptamer is shown as SEQ ID NO:2.

[0080] In some specific embodiments, the four single-stranded DNAs include chain A, chain B, chain C and chain D, the nucleotide sequence of the A chain is shown in SEQ ID NO:3, the nucleotide sequence of the B chain is shown in SEQ ID NO:4, the nucleotide sequence of the C chain is shown in SEQ ID NO:5, and the nucleotide sequence of the D chain is shown in SEQ ID NO:6.

[0081] According to another aspect of the present invention, a method for preparing the electrochemiluminescence sensor is provided, comprising modifying an AFB1 signal probe and a ZEN signal probe on a gold electrode fixed with DNA tetrahedrons to obtain an electrochemiluminescence sensor.

[0082] Using DNA tetrahedron (DTN) as a carrier, ZIF-8 as a signal enhancement unit, and nitrogen-doped carbon dots (N-CDs) as a signal source, a pyramid-shaped ECL aptamer sensor was constructed based on the high specificity of the aptamer-target binding reaction. It has simple operation, high sensitivity, and can achieve simultaneous and rapid detection of AFB1 and ZEN in coix seed.

[0083] In some specific embodiments, the electrochemiluminescent sensor is obtained by adding a DNA tetrahedron solution to a gold electrode treated with alumina slurry for incubation, adding a 6-mercapto-1-hexanol solution after incubation, and then adding an AFB1 signal probe solution and a ZEN signal probe solution for incubation.

[0084] In some specific embodiments, the method for preparing the alumina slurry comprises taking alumina powders with particle sizes of 0.3 μm and 0.05 μm respectively, placing them on the surface of a polishing cloth, adding a small amount of ultrapure water to make them into a slurry state, and obtaining alumina slurry.

[0085] In some specific embodiments, the concentration of the DNA tetrahedron solution is 0.5-1.5 μM. However, as the concentration of DTN increases further, the ECL signal intensities of N-CDs1 and N-CDs2 do not change significantly. In some specific embodiments, the concentration of the DNA tetrahedron solution is preferably 1.0 μM.

[0086] In some specific embodiments, the concentration of the 6-mercapto-1-hexanol solution is 8-12 mM, preferably 10 mM.

[0087] In some specific embodiments, the concentration of the AFB1 signal probe solution is 2.0-3.0 mg / mL, preferably 2.5 mg / mL. The concentration of the ZEN signal probe solution is 2.0-3.0 mg / mL, preferably 2.5 mg / mL.

[0088] In some specific embodiments, the volume ratio of the added amounts of the DNA tetrahedron solution, 6-mercapto-1-hexanol solution, AFB1 signal probe solution and ZEN signal probe solution is 7-12:7-12:7-12:7-12, preferably 10:10:10:10.

[0089] In some specific embodiments, the incubation temperature for adding the DNA tetrahedron solution and adding the AFB1 signal probe solution and the ZEN signal probe solution is independently 35°C to 40°C, preferably 37°C. Incubation is an important factor for the binding of the signal probes Apt1 / N-CDs1 / ZIF-8 and Apt2 / N-CDs2 / ZIF-8 to DTN, and its influence can be evaluated by detecting the ECL signal intensity. Experiments have shown that when the signal probes are incubated on AuE for 60 minutes, the ECL signal intensity values ​​of N-CDs1 and N-CDs2 are close to reaching a plateau. In some specific embodiments, the incubation time for adding the DNA tetrahedron solution and adding the AFB1 signal probe solution and the ZEN signal probe solution is independently at least 1 hour.

[0090] Wherein, after the incubation, the electrode is rinsed with a buffer solution and dried.

[0091] In some specific embodiments, the preparation method of the DNA tetrahedron includes mixing four single-stranded DNAs to self-assemble into a DNA tetrahedron. Specifically, the concentration of the four single-stranded DNAs in the self-assembled system is independently 3 to 8 μM, preferably 5 μM.

[0092] In some specific embodiments, the method for preparing the AFB1 signal probe comprises adding an AFB1 aptamer to the prepared N-CDs1 / ZIF-8 composite material, and incubating to obtain the AFB1 signal probe;

[0093] The preparation method of the ZEN signal probe comprises adding a ZEN aptamer to the prepared N-CDs2 / ZIF-8 composite material, and incubating to obtain the AFB1 signal probe.

[0094] In some specific embodiments, when the N-CDs1 / ZIF-8 composite material is incubated with the AFB1 aptamer, the concentration of the N-CDs1 / ZIF-8 composite material is 2-3 mg / mL, preferably 2.5 mg / mL; the concentration of the AFB1 aptamer is 3-8 μM, preferably 5 μM; the volume ratio of the N-CDs1 / ZIF-8 composite material to the AFB1 aptamer is 1:1;

[0095] In some specific embodiments, when the N-CDs2 / ZIF-8 composite material is incubated with the ZEN aptamer, the concentration of the N-CDs2 / ZIF-8 composite material is 2-3 mg / mL, preferably 2.5 mg / mL; the concentration of the ZEN aptamer is 3-8 μM, preferably 5 μM; and the volume ratio of the N-CDs1 / ZIF-8 composite material to the ZEN aptamer is 1:1.

[0096] In some specific embodiments, the preparation method of the N-CDs1 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs1 and incubating in the dark, standing after the incubation, centrifuging and discarding the supernatant, and drying to obtain the N-CDs1 / ZIF-8 composite material; the preparation method of the N-CDs2 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs2 and incubating in the dark, standing after the incubation, centrifuging and discarding the supernatant, and drying to obtain the N-CDs2 / ZIF-8 composite material;

[0097] In some specific embodiments, the mass concentration ratio of ZIF-8 to N-CDs1 is 1:1.5-2.5, preferably 1:2; the mass concentration ratio of ZIF-8 to N-CDs2 is 1:1.5-2.5, preferably 1:2.

[0098] In some specific embodiments, the incubation temperatures in the preparation methods of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material are independently 23°C to 30°C, preferably 25°C.

[0099] In some specific embodiments, the incubation time in the preparation methods of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 10 to 14 h, preferably 12 h;

[0100] In some specific embodiments, the standing time is 8 to 12 minutes, preferably 10 minutes;

[0101] In some specific embodiments, the centrifugation further comprises washing the precipitate with water at least 3 times.

[0102] In some specific embodiments, the preparation method of N-CDs1 comprises dissolving citric acid and urea in water, placing the mixed solution in a reactor, reacting at 160° C., cooling to room temperature after the reaction is completed, dialyzing, and drying to obtain N-CDs1;

[0103] The mass concentration ratio of citric acid to urea is 1:1.5-2.5, preferably 1:2; and the reaction time in the preparation method of N-CDs1 is 3-5h, preferably 4h.

[0104] In some specific embodiments, the preparation method of N-CDs2 comprises dissolving citric acid in dimethylformamide, adding hydrazine hydrate to form a milky white gel, placing the milky white gel in a reaction kettle, reacting at 180° C., cooling to room temperature after the reaction, centrifuging, taking the supernatant for dialysis, and drying to obtain N-CDs2;

[0105] In some specific embodiments, the mass concentration of citric acid in dimethylformamide is 0.1-0.3 g / mL, preferably 0.21 g / mL.

[0106] In some specific embodiments, the volume ratio of hydrazine hydrate to dimethylformamide is 1:9-11, preferably 1:10.

[0107] In some specific embodiments, the reaction time in the preparation method of N-CDs2 is 10 to 14 hours, preferably 12 hours.

[0108] In some specific embodiments, the drying temperature is 50°C to 65°C, preferably 60°C.

[0109] In some specific embodiments, the drying is vacuum drying.

[0110] In some specific embodiments, the centrifugal rotation speed is 8000-12000 rpm, preferably 10000 rpm.

[0111] In some specific embodiments, the centrifugation time is 8 to 12 minutes, preferably 10 minutes.

[0112] In some specific embodiments, the preparation method of ZIF-8 comprises mixing a methylimidazole aqueous solution and a zinc acetate dihydrate aqueous solution, reacting at room temperature, and centrifuging and drying after the reaction is completed to obtain ZIF-8.

[0113] The concentration of the methylimidazole aqueous solution is 1.3-1.8 mol / L, preferably 1.5 mol / L. The concentration of the zinc acetate dihydrate aqueous solution is 22-28 mol / L, preferably 25 mol / L. The volume ratio of the methylimidazole aqueous solution to the zinc acetate dihydrate aqueous solution is 10:1-8:1, preferably 9:1. The reaction time of the methylimidazole aqueous solution and the zinc acetate dihydrate aqueous solution is 4-6 hours, preferably 5 hours.

[0114] According to another aspect of the present invention, a method for detecting AFB1 and ZEN is provided, wherein the sample solution to be tested is added to the above-mentioned electrochemiluminescence sensor or incubated on the above-mentioned electrochemiluminescence sensor, and after incubation, the electrochemiluminescence signal is detected using a gold electrode as a working electrode.

[0115] The method can be used for the simultaneous detection of AFB1 and ZEN in the sample to be tested. The method is simple and has good specificity, which improves the accuracy and stability of the detection.

[0116] In some specific embodiments, the incubation time of the sample solution to be tested is 15 to 25 minutes, preferably 20 minutes;

[0117] The incubation temperature of the sample solution to be tested is 25-40°C, preferably 37°C;

[0118] The detection of the electrochemiluminescent signal comprises placing a working electrode, an auxiliary electrode and a reference electrode in an electrochemiluminescent reaction solution, and detecting the electrochemiluminescent signal by cyclic voltammetry.

[0119] In some specific embodiments, the electrochemiluminescent reaction solution includes K2S2O8 with a concentration of 0.05-0.15M and H2O2 with a concentration of 0.005-0.015M, and the solvent is 0.1M PBS buffer, preferably K2S2O8 with a concentration of 0.1M and H2O2 with a concentration of 0.01M.

[0120] The ECL performance of carbon dots is closely related to the pH value of the co-reaction system. Experiments have shown that the ECL signal increases as the pH increases from 6.2 to 7.4, and decreases as the pH exceeds 7.4. In some specific embodiments, the pH of the electrochemiluminescence reaction solution is 6.2-7.4, preferably 7.4.

[0121] In some specific embodiments, the scanning voltage of the cyclic voltammetry is 0.8 to -1.6V.

[0122] In some specific embodiments, the scanning rate of the cyclic voltammetry is 80-120 mV / s, preferably 100 mV / s.

[0123] In some specific embodiments, the photomultiplier voltage is 800V.

[0124] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0125] 1. Instrument

[0126] MPI-EⅡ ECL detector: Xi'an Remex Analytical Instrument Co., Ltd.;

[0127] CHI660E EC detector: Shanghai Chenhua Instrument Co., Ltd.;

[0128] MS105DU analytical balance: Mettler-Toledo, Switzerland;

[0129] Eppendorf N13462C pipette: Eppendorf, Germany;

[0130] TGL centrifuge: Yancheng Kate Company;

[0131] DHG-9053A Electric constant temperature air drying oven: Shanghai Jinghong Experimental Equipment Co., Ltd.;

[0132] VORTEX-vortex mixer: Shanghai Dam Company;

[0133] KQ-300E ultrasonic cleaner: Kunshan Ultrasonic Instrument Co., Ltd.;

[0134] pH meter: Sartorius, Germany;

[0135] Transmission electron microscope: FEI Company, USA;

[0136] Scanning electron microscope: FEI Company, USA;

[0137] Fluorescence spectrophotometer: Shanghai Techcomp Company;

[0138] X-ray diffractometer: Bruker, Germany

[0139] 2. Materials:

[0140] Ammonium acetate dihydrate: Shanghai Aladdin Biochemical Technology Co., Ltd.

[0141] 2-Methylimidazole: Shanghai Aladdin Biochemical Technology Co., Ltd.

[0142] Hydrazine hydrate: Shanghai Aladdin Biochemical Technology Co., Ltd.

[0143] Citric acid: Shanghai McLean Company

[0144] Urea: Shanghai McLean Company

[0145] EDC HCl: Afaesa

[0146] N-Hydroxysuccinimide (NHS): Afaesa

[0147] Mercaptohexanol (MCH): Beijing Yuanye Biotechnology Co., Ltd.

[0148] 0.1M MES buffer: Beijing Coolbo Technology Co., Ltd.

[0149] 10×PBS: Beijing Solebow Technology Co., Ltd.

[0150] Potassium persulfate: Shanghai Aladdin Biochemical Technology Co., Ltd.

[0151] Potassium ferrocyanide: Shanghai Aladdin Biochemical Technology Co., Ltd.

[0152] 3. The DNA chain was purchased from Beijing New Era Zhonghe Technology Co., Ltd. The sequence is as follows (from 5ˊ to 3ˊ):

[0153] AFB1 aptamer (hereinafter referred to as Apt1) sequence (5'-3'):

[0154] NH2-(CH2)6-CACGTGTTGTCTCTCTGTGTCTCGTG (SEQ ID NO: 1);

[0155] ZEN aptamer (hereinafter referred to as Apt2) sequence (5'-3'):

[0156] NH2-(CH2)6-TCATCTATCTATGGTACATTACTATCTGTAATGTGATAT G (SEQ ID NO: 2);

[0157] The sequences of the four strands of the DNA tetrahedron are as follows:

[0158] A strand (5'-3'):

[0159] HS-ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAG AGCCGCCATAGTATTTTTCACGAGACACAGAGTTTTTTTTCATATCA CATTACAGATAGT (SEQ ID NO: 3);

[0160] B strand (5'-3'):

[0161] HS-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGC GAGGGTCCAATAC (SEQ IDNO: 4);

[0162] C strand (5'-3'):

[0163] HS-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC(SEQ IDNO:5);

[0164] D strand (5'-3'):

[0165] HS-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT (SEQ ID NO: 6).

[0166] Wherein, HS is a thiol group.

[0167] The following example is an experiment for simultaneous detection of aflatoxin B1 and zearalenone in coix seeds based on ECL sensor.

[0168] Example 1

[0169] Combination Figure 1 The preparation and detection of electrochemiluminescence sensors for detecting AFB1 and ZEN are described.

[0170] 1. Preparation of N-CDs1 and N-CDs2

[0171] Preparation of N-CDs1: 1.0 g of citric acid and 2.0 g of urea were dissolved in 10 mL of ultrapure water, and the mixed solution was transferred to a polytetrafluoroethylene hydrothermal reactor and heated in an oven at 160°C for 4 h. After sufficient reaction, the mixture was cooled to room temperature and dialyzed with a dialysis bag (MWCO=1000) for 48 h to remove small molecule impurities. The obtained N-CDs solution was vacuum dried at 60°C, and the obtained brown-black powder was placed in a sealed container and stored away from light for later use.

[0172] Preparation of N-CDs2: First, dissolve 2.1 g of citric acid in 10 mL of DMF and continue stirring. Then, add 1.0 mL of hydrazine hydrate dropwise. It can be observed that the colorless solution turns into a milky white gel. Then, transfer the milky white gel to a stainless steel high-pressure reactor for solvothermal reaction and heat at 180°C for 12 h. After cooling to room temperature, centrifuge the brown solution in the reactor (speed 10,000 rpm, time 10 min) to remove large particle residues. Take the upper brown solution for dialyzation in deionized water and vacuum dry at 60°C. Place the obtained brown-black powder in a sealed container and store it away from light for later use.

[0173] 2. Preparation of ZIF-8

[0174] 0.2463g of 2-methylimidazole was weighed and prepared into 2mL of 1.5mol / L aqueous solution; 0.01097g of zinc acetate dihydrate was weighed and prepared into 2mL of 25mmol / L aqueous solution. 1.8mL of 2-methylimidazole aqueous solution and 200μL of zinc acetate dihydrate aqueous solution were mixed evenly, and then reacted at room temperature for 5h using a magnetic stirrer. A white precipitate was obtained by centrifugation (speed 10000rpm, time 10min), which was washed 3 times with ultrapure water and centrifuged (speed 10000rpm, time 10min), and then the precipitate was dried at 60°C to obtain a white powder, namely ZIF-8.

[0175] 3. Preparation of N-CDs1 / ZIF-8 and N-CDs2 / ZIF-8

[0176] Weigh 5 mg ZIF-8 powder, add 2 mL ultrapure water to dissolve it, and mix well to make a suspension. Then, add 10 mg N-CDs1 and 10 mg N-CDs2 powder respectively, incubate at room temperature in the dark for 12 h, then stand for 10 min, centrifuge (speed 10000 rpm, time 10 min) to obtain brown-black powder, wash the obtained precipitate 3 times with ultrapure water, and vacuum dry at 60 ° C to obtain N-CDs1 / ZIF-8 and N-CDs2 / ZIF-8 luminescent complexes respectively, and store them in a dark and dry condition.

[0177] 4. Preparation of DNA Tetrahedron

[0178] Take out the centrifuge tube containing DNA chains (A chain, B chain, C chain, D chain) from the -20℃ refrigerator, place it at room temperature for 15 minutes, then centrifuge it (speed 4000rpm, time 20min), add the required volume of TE buffer according to the instructions on the centrifuge tube, mix well, and prepare a solution with a concentration of 10μM. Add 1μL 500mM TCEP solution and 9μL TM buffer to the PCR tube in sequence, and then add 10μL of A chain, B chain, C chain, and D chain solution in sequence, and blow evenly. Put the PCR tube into the PCR instrument and synthesize the DNA tetrahedron according to the set program. The PCR program is: first heat up to 95℃, then cool down to 60℃, keep for 10min, and finally cool down to 4℃. Use agarose gel electrophoresis to verify the synthesis results.

[0179] 5. Construction of ECL sensor based on “N-CDs / ZIF-8 and DNA tetrahedron”

[0180] Before assembling the gold electrode, it was pretreated with alumina slurry. 10 μL of DNA tetrahedron solution was added to the pretreated Au electrode surface, incubated at 37°C for 1 h, and then 10 mM 6-mercapto-1-hexanol (MCH) solution was added to block the nonspecific sites on the electrode surface. The N-CDs1 / ZIF-8 composite material with a concentration of 2.5 mg / mL and the AFB1 aptamer with a concentration of 5 μM were mixed in a volume ratio of 1:1 and then incubated to obtain the AFB1 capture probe Apt1 / N-CDs1 / ZIF-8. The N-CDs2 / ZIF-8 composite material with a concentration of 2.5 mg / mL and the ZEN aptamer with a concentration of 5 μM were mixed in a volume ratio of 1:1 and then incubated to obtain the ZEN capture probe Apt2 / N-CDs2 / ZIF-8. Then, 10 μL of Apt1 / N-CDs1 / ZIF-8 and Apt2 / N-CDs2 / ZIF-8 solutions were added dropwise and incubated at 37°C for 1 hour to obtain the ECL sensor. After each assembly step, the electrode was rinsed with PBS solution (0.01 M, pH 7.4) and dried at room temperature.

[0181] 6. Detection

[0182] 1) Add the sample solution to be tested and incubate at 37°C for 20 min to capture the target AFB1 and ZEN.

[0183] 2) ECL signal detection: A three-electrode detection system was used, with the modified Au electrode as the working electrode, the platinum wire (Pt) electrode as the auxiliary electrode, and the saturated calomel electrode (SCE) as the reference electrode. When testing the ECL signal, the three electrodes were placed vertically in a detection cell containing an ECL reaction solution (0.1 M K2S2O8 and 0.01 M H2O2 in 0.1 M PBS buffer with a pH of 7.4). The ECL signal was detected by cyclic voltammetry (CV) at a scanning voltage of 0.8 V to -1.6 V, a scanning speed of 100 mV / s, and a photomultiplier voltage of 800 V.

[0184] Example 2 Concentration Optimization of DNA Tetrahedron Solution

[0185] In this embodiment, DNA tetrahedron (DTN) solutions of different concentrations were prepared and incubated on the surface of gold electrode (AuE), and the DTN concentrations were set to 0.5 μM, 0.75 μM, 1.0 μM, 1.25 μM and 1.5 μM. The ECL signal intensities of the cathode-luminescent nitrogen-doped carbon dots (N-CDs), i.e., N-CDs1, and the anode-luminescent N-CDs, i.e., N-CDs2, were detected respectively, and each influencing factor was measured in parallel 3 times.

[0186] The results showed that the ECL signal intensity (au) increased with the increase of DTN concentration from 0.5 μM to 1.0 μM, but with the further increase of DTN concentration, the ECL signal intensity of N-CDs1 and N-CDs2 did not change significantly. Therefore, 1.0 μM DTN solution was preferred to construct ECL aptamer sensor.

[0187] Example 3 Optimization of signal probe incubation time

[0188] Incubation time is an important factor affecting the binding of signal probes (Apt1 / N-CDs1 / ZIF-8 and Apt2 / N-CDs2 / ZIF-8) on the gold electrode surface with DTN. The incubation time was set to 20min, 40min, 60min, 80min and 100min, respectively. The modified Au electrode was used as the working electrode to measure the ECL signal. Each influencing factor was measured in parallel 3 times. The influence was evaluated by detecting the ECL signal intensity.

[0189] The results showed that when the signal probe was incubated on the gold electrode for 60 min, the ECL signal intensity values ​​of N-CDs1 and N-CDs2 were close to reaching a plateau. Therefore, 60 min was used as the optimized signal probe incubation time.

[0190] Example 4 Optimization of pH of the detection reaction system

[0191] The ECL performance of carbon dots is closely related to the pH value of the ECL reaction solution of the co-reaction system, and the pH values ​​are set to 6.2, 6.6, 7.0, 7.4, 7.8 and 8.2 respectively. The modified Au electrode was used as the working electrode to measure the ECL signal, and each influencing factor was measured in parallel 3 times.

[0192] The results showed that the ECL signal increased as the pH increased from 6.2 to 7.4, but decreased as the pH exceeded 7.4. Therefore, the optimal pH value of the co-reaction solution was set at 7.4.

[0193] Example 5 Performance evaluation of electrochemiluminescence sensor for detecting AFB1 and ZEN 1. Establishment of linear relationship: Under optimal conditions, a series of standard solutions of AFB1 and ZEN with concentrations of 0.01 ng / mL, 0.1 ng / mL, 1 ng / mL, 10 ng / mL, 100 ng / mL and 1000 ng / mL were prepared as test solutions, and the corresponding ECL signal intensity values ​​were measured to establish a standard curve matching the relationship between ECL signal intensity value and concentration. The linear equation was obtained by fitting the AFB1 and ZEN concentrations (C) as the horizontal coordinates and the ECL signal intensity value (IECL) as the vertical coordinates.

[0194] The results are as follows Figure 2 As shown, A is the ECL signal reaction diagram of the standard solution with different AFB1 and ZEN concentrations, B is the AFB1 corresponding ECL standard curve of the standard solution with different AFB1 and ZEN concentrations, and C is the ZEN corresponding ECL standard curve of the standard solution with different AFB1 and ZEN concentrations.

[0195] 2. Specificity evaluation: Ochratoxin A (OTA), vomitoxin (DON), and aflatoxin B2 (AFB2) were used as interfering toxins, with a concentration of 1 ng / mL, and the determination was repeated three times. The results were as follows: Figure 3 shown.

[0196] 3. Reproducibility evaluation: Under the same conditions, 5 modified Au electrodes were prepared, and the ECL signal intensity was recorded using a three-electrode system. The RSD of the 5 groups of ECL signal intensities was calculated. The results are as follows: Figure 4 shown.

[0197] 4. Stability evaluation: Under the same conditions, 15 modified Au electrodes were prepared and stored at 4°C. Three modified Au electrodes were taken out on the first, second, fourth and seventh days, respectively. The ECL signal intensity was recorded using a three-electrode system to observe the change of the ECL signal intensity with storage time. Figure 5 shown.

[0198] Depend on Figure 3 to Figure 5It can be seen that the electrochemiluminescence sensor for detecting AFB1 and ZEN constructed under optimal conditions is highly specific to AFB1 and ZEN toxins; there is no significant difference in 5 repeated experiments; the detection signal intensity of the sensor with different storage time does not change significantly, and it has good stability.

[0199] 5. Accuracy evaluation: The spiked concentration levels were low (0.01 ng / mL), medium (1 ng / mL), and high (100 ng / mL). The results are shown in Table 1, which shows that the evaluation analysis test is accurate and the method is reliable.

[0200] Table 1 Spiked recovery results

[0201]

[0202] Example 6

[0203] In this example, the ECL sensor provided in Example 1 is applied to the simultaneous quantitative detection of the AFB1 and ZEN contents of 9 batches of coix seed samples from different origins. The detection results are detected by the UFLC-MS / MS method to confirm the reliability of the ECL sensor. The specific results are shown in Table 2. It can be seen that there is no significant difference between the detection results of the ECL sensor provided in Example 1 and the detection results of the UFLC-MS / MS method, and the results are consistent, which proves that the electrochemiluminescence sensor provided by the present invention for detecting AFB1 and ZEN is reliable.

[0204] Table 2 Results of AFB1 and ZEN content detection in coix seed

[0205]

[0206]

[0207] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An electrochemiluminescent sensor for detecting AFB1 and ZEN, characterized in that: The electrochemiluminescent sensor comprises a DNA tetrahedron, an AFB1 signal probe and a ZEN signal probe self-assembled on a gold electrode; The AFB1 signal probe includes an AFB1 aptamer and an N-CDs1 / ZIF-8 composite material; The ZEN signal probe includes a ZEN aptamer and a N-CDs2 / ZIF-8 composite material; The DNA tetrahedron is formed by combining four single-stranded DNAs.

2. The electrochemiluminescence sensor according to claim 1, characterized in that The nucleotide sequence of the AFB1 aptamer is shown in SEQ ID NO:1, and the nucleotide sequence of the ZEN aptamer is shown in SEQ ID NO:

2. Preferably, the four single-stranded DNAs include chain A, chain B, chain C and chain D, the nucleotide sequence of the A chain is shown in SEQ ID NO: 3, the nucleotide sequence of the B chain is shown in SEQ ID NO: 4, the nucleotide sequence of the C chain is shown in SEQ ID NO: 5, and the nucleotide sequence of the D chain is shown in SEQ ID NO:

6.

3. The method for preparing the electrochemiluminescence sensor according to claim 1 or 2, characterized in that: The method comprises modifying an AFB1 signal probe and a ZEN signal probe on a gold electrode fixed with a DNA tetrahedron to obtain an electrochemiluminescent sensor.

4. The preparation method according to claim 3, characterized in that: The method comprises adding a DNA tetrahedron solution to a gold electrode treated with an alumina slurry for incubation, adding a 6-mercapto-1-hexanol solution after the incubation is completed, and then adding an AFB1 signal probe solution and a ZEN signal probe solution for incubation to obtain an electrochemiluminescent sensor; Preferably, the method for preparing the alumina slurry comprises taking alumina powders with a particle size of 0.3 μm and 0.05 μm respectively, placing them on the surface of a polishing cloth, adding a small amount of ultrapure water to make them into a slurry state, and obtaining the alumina slurry; Preferably, the concentration of the DNA tetrahedron solution is 0.5 to 1.5 μM, preferably 1.0 μM; Preferably, the concentration of the 6-mercapto-1-hexanol solution is 8 to 12 mM, preferably 10 mM; Preferably, the concentration of the AFB1 signal probe solution is 2.0-3.0 mg / mL, preferably 2.5 mg / mL; Preferably, the concentration of the ZEN signal probe solution is 2.0 to 3.0 mg / mL, preferably 2.5 mg / mL; Preferably, the volume ratio of the added amounts of the DNA tetrahedron solution, the 6-mercapto-1-hexanol solution, the AFB1 signal probe solution and the ZEN signal probe solution is 7-12:7-12:7-12:7-12, preferably 10:10:10:10; Preferably, the incubation temperature for adding the DNA tetrahedron solution and adding the AFB1 signal probe solution and the ZEN signal probe solution is independently 35°C to 40°C, preferably 37°C; Preferably, the incubation time of adding the DNA tetrahedron solution and adding the AFB1 signal probe solution and the ZEN signal probe solution is independently at least 1 hour; Preferably, after the incubation, the electrode is further rinsed with a buffer solution and dried; Preferably, the method for preparing the DNA tetrahedron comprises mixing four single-stranded DNAs to self-assemble into a DNA tetrahedron; Preferably, the concentrations of the four single-stranded DNAs in the self-assembled system are independently 3 to 8 μM, preferably 5 μM.

5. The preparation method according to claim 4, characterized in that: The preparation method of the AFB1 signal probe comprises adding an AFB1 aptamer to the prepared N-CDs1 / ZIF-8 composite material, and incubating to obtain the AFB1 signal probe; The preparation method of the ZEN signal probe comprises adding a ZEN aptamer to the prepared N-CDs2 / ZIF-8 composite material, and incubating to obtain the ZEN signal probe; Preferably, when the N-CDs1 / ZIF-8 composite material is incubated with the AFB1 aptamer, the concentration of the N-CDs1 / ZIF-8 composite material is 2-3 mg / mL, preferably 2.5 mg / mL; the concentration of the AFB1 aptamer is 3-8 μM, preferably 5 μM; the volume ratio of the N-CDs1 / ZIF-8 composite material to the AFB1 aptamer is 1:1; Preferably, when the N-CDs2 / ZIF-8 composite material is incubated with the ZEN aptamer, the concentration of the N-CDs2 / ZIF-8 composite material is 2-3 mg / mL, preferably 2.5 mg / mL; the concentration of the ZEN aptamer is 3-8 μM, preferably 5 μM; and the volume ratio of the N-CDs1 / ZIF-8 composite material to the ZEN aptamer is 1:

1.

6. The preparation method according to claim 5, characterized in that: The preparation method of the N-CDs1 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs1 and incubating in the dark, standing after the incubation, centrifuging and discarding the supernatant, and drying to obtain the N-CDs1 / ZIF-8 composite material; The preparation method of the N-CDs2 / ZIF-8 composite material comprises dissolving ZIF-8 in water, adding N-CDs2 and incubating in the dark, standing after the incubation, centrifuging and discarding the supernatant, and drying to obtain the N-CDs2 / ZIF-8 composite material; Preferably, the mass concentration ratio of ZIF-8 to N-CDs1 is 1:1.5 to 2.5, preferably 1:2; Preferably, the mass concentration ratio of ZIF-8 to N-CDs2 is 1:1.5 to 2.5, preferably 1:2; Preferably, the incubation temperature in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 23°C to 30°C, preferably 25°C; Preferably, the incubation time in the preparation method of the N-CDs1 / ZIF-8 composite material and the N-CDs2 / ZIF-8 composite material is independently 10 to 14 h, preferably 12 h; Preferably, the standing time is 8 to 12 minutes, preferably 10 minutes; Preferably, the centrifugation further comprises washing the precipitate with water at least 3 times.

7. The preparation method according to claim 6, characterized in that: The preparation method of N-CDs1 comprises dissolving citric acid and urea in water, placing the mixed solution in a reaction kettle, reacting at 160° C., cooling to room temperature after the reaction is completed, dialyzing, and drying to obtain N-CDs1; Preferably, the mass concentration ratio of citric acid to urea is 1:1.5-2.5, preferably 1:2; Preferably, the reaction time in the preparation method of N-CDs1 is 3 to 5 hours, preferably 4 hours. Preferably, the preparation method of N-CDs2 comprises dissolving citric acid in dimethylformamide, adding hydrazine hydrate to form a milky white gel, placing the milky white gel in a reaction kettle, reacting at 180° C., cooling to room temperature after the reaction, centrifuging, taking the supernatant for dialysis, and drying to obtain N-CDs2; Preferably, the mass concentration of citric acid in dimethylformamide is 0.1-0.3 g / mL, preferably 0.21 g / mL; Preferably, the volume ratio of hydrazine hydrate to dimethylformamide is 1:9-11; preferably 1:10; Preferably, the reaction time in the preparation method of N-CDs2 is 10 to 14 h, preferably 12 h; Preferably, the drying temperature is 50°C to 65°C, preferably 60°C; Preferably, the drying is vacuum drying; Preferably, the centrifugal speed is 8000-12000 rpm, preferably 10000 rpm; Preferably, the centrifugation time is 8 to 12 min, preferably 10 min.

8. The preparation method according to claim 6, characterized in that: The preparation method of ZIF-8 comprises mixing a methylimidazole aqueous solution and a zinc acetate dihydrate aqueous solution, reacting at room temperature, and centrifuging and drying after the reaction to obtain ZIF-8; Preferably, the concentration of the methylimidazole aqueous solution is 1.3-1.8 mol / L, preferably 1.5 mol / L; Preferably, the concentration of the zinc acetate dihydrate aqueous solution is 22-28 mmol / L, preferably 25 mmol / L; Preferably, the volume ratio of the methylimidazole aqueous solution to the zinc acetate dihydrate aqueous solution is 10:1 to 8:1, preferably 9:1; Preferably, the reaction time of the methylimidazole aqueous solution and the zinc acetate dihydrate aqueous solution is 4 to 6 hours, preferably 5 hours.

9. A method for detecting AFB1 and ZEN, characterized in that: The sample solution to be tested is added to the electrochemiluminescence sensor according to claim 1 or 2 or the electrochemiluminescence sensor according to any one of claims 3 to 8 for incubation, and after incubation, the electrochemiluminescence signal is detected using a gold electrode as a working electrode.

10. The method according to claim 9, characterized in that The incubation time of the sample solution to be tested is 15 to 25 minutes, preferably 20 minutes; The incubation temperature of the sample solution to be tested is 25°C to 40°C, preferably 37°C; The detecting of the electrochemiluminescent signal comprises placing a working electrode, an auxiliary electrode and a reference electrode in an electrochemiluminescent reaction solution, and detecting the electrochemiluminescent signal by cyclic voltammetry; Preferably, the electrochemiluminescent reaction solution comprises K2S2O8 with a concentration of 0.05 to 0.15 M and H2O2 with a concentration of 0.005 to 0.015 M, and the solvent is 0.1 M PBS buffer, preferably K2S2O8 with a concentration of 0.1 M and H2O2 with a concentration of 0.01 M; Preferably, the pH of the electrochemiluminescent reaction solution is 6.2 to 7.4, preferably 7.4; Preferably, the scanning voltage of the cyclic voltammetry is 0.8 to -1.6 V; Preferably, the scanning speed of the cyclic voltammetry is 80 to 120 mV / s, preferably 100 mV / s; Preferably, the photomultiplier voltage is 800V.

Images