Self-suspension microbubble enhanced electrochemical biological analysis method

Abstract

The invention discloses a self-suspension microbubble enhanced electrochemical biological analysis method. The method comprises the following steps: S1, modifying a hollow glass microsphere with dibenzocyclooctyne-active ester; s2, an aptamer probe used for capturing a target and a signal chain with a signal group are subjected to mismatching hybridization, and a duplex probe is obtained; s3, modifying a duplex probe on the microspheres prepared in the S1 through click chemistry; s4, modifying the capture probe to the surface of the working electrode; and S5, dropwise adding the microspheres prepared in the step S3 and a sample with the same volume onto an activation electrode, outputting an alternating electric field to the activation electrode so as to enable the activation electrode to capture a signal chain with a signal group, and selecting an analysis method according to the characteristics of the signal group on the signal chain so as to carry out electrochemical biological analysis detection on the signal chain captured on the working electrode. According to the present invention, the EV surface protein marker can be efficiently detected with characteristics of high specificity and high sensitivity.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology and nucleic acid chemistry. More specifically, the present invention relates to a self-suspended microbubble enhanced electrochemical bioanalysis method. Background Art

[0002] Extracellular vesicles (EVs) have a natural lipid bilayer membrane structure, are actively shed by host cells, and inherit many of their cargo molecules (such as proteins, lipids, and nucleic acids), participating in intercellular communication, immune regulation, and tumor metastasis. These characteristics make tumor-derived EVs potential biomarkers for cancer liquid biopsy. For example, a variety of circulating EV surface proteins, including glypican 1, epithelial cell adhesion molecule (EpCAM), and programmed death ligand 1 (PD-L1), have recently been reported to be highly correlated with tumor occurrence and progression, and have been used for cancer diagnosis and treatment monitoring, indicating the great potential of these EV surface features as non-invasive circulating biomarkers. However, in complex biological fluids, size heterogeneity, biocolloid-like dispersion, and the presence of a large number of non-target EVs pose a major obstacle to the effective separation and detection of target EVs in clinical practice. Therefore, how to efficiently and quickly detect EVs in samples is of great significance to meet the needs of EV-related diseases or early diagnosis of tumors. Summary of the invention

[0003] An object of the present invention is to solve at least the above problems and to provide at least the advantages which will be described hereinafter.

[0004] One object of the present invention is to provide a self-suspended microbubble enhanced electrochemical bioanalysis method, which can detect EV surface protein markers with high efficiency, high specificity and high sensitivity, thereby achieving early diagnosis of cancer tumors.

[0005] In order to achieve these objects and other advantages of the present invention, a self-suspended microbubble enhanced electrochemical bioanalysis method is provided, which comprises the following steps:

[0006] S1: Dibenzocyclooctyne-active ester is modified onto hollow glass microspheres to obtain antifouling glass microspheres with bioorthogonal functions;

[0007] S2: mismatch hybridization of the aptamer probe used to capture the target with the signal chain carrying the signal group to obtain a duplex probe;

[0008] S3: The duplex probes were modified onto antifouling glass microspheres with bioorthogonal functions by click chemistry to obtain glass microspheres with target capture function;

[0009] S4: modifying the capture probe onto the surface of the working electrode to obtain an activated electrode with the function of capturing the signal chain;

[0010] S5: Add equal volumes of glass microspheres with target capture function and samples to the activated electrode, output an alternating electric field to the activated electrode so that the activated electrode can capture the signal chain with signal groups, and select an analysis method based on the characteristics of the signal groups on the signal chain to perform electrochemical bioanalysis on the signal chain captured on the working electrode.

[0011] Preferably, the method for modifying the dibenzocyclooctyne-active ester onto the hollow glass microspheres comprises the following steps:

[0012] 1) adding bovine serum albumin and tri(2-carboxyethyl)phosphine hydrochloride solution to the hollow glass microspheres, adjusting the pH value to 4-6 to obtain a phase-changing bovine serum albumin coating, centrifuging, removing the lower layer solution, washing with ultrapure water, and drying to obtain hollow glass microspheres with surface modified amino groups;

[0013] 2) Mixing the hollow glass microspheres with amino groups modified on the surface with dibenzocyclooctene-active ester, centrifuging, removing the lower layer solution, washing with ultrapure water, and drying to obtain antifouling glass microspheres with bioorthogonal function.

[0014] Preferably, the capture target is a protein on the surface of an extracellular vesicle, which may be one or both of EpCAM protein and PD-L1 protein. The aptamer probe Apt for capturing EpCAM protein EpCAM The sequence is shown in SEQ ID NO: 1, and the aptamer probe Apt for capturing PD-L1 protein PD-L1 The sequence is shown in SEQ ID NO:2.

[0015] Preferably, the signal chain DNA of the target protein EpCAM protein Probe-EpCAM The sequence is shown in SEQ ID NO: 3;

[0016] Signal chain DNA of target protein PD-L1 protein Probe-PD-L1 The sequence is shown in SEQ ID NO:4.

[0017] Preferably, the signal strand DNA is captured Probe-EpCAM The capture probe can be SH-cDNA EpCAM , PolyA(10)-cDNA or Fi EpCAM SH-tFNA formed by hybridization with F-ii, F-iii, and F-iv EpCAM One of;

[0018] Capture probe SH-cDNA EpCAMThe sequence is shown in SEQ ID NO: 5;

[0019] The sequence of the capture probe PolyA(10)-cDNA is shown in SEQ ID NO: 6;

[0020] Fi EpCAM The sequence is shown in SEQ ID NO: 7;

[0021] The sequence of F-ii is shown in SEQ ID NO: 8;

[0022] The sequence of F-iii is shown in SEQ ID NO: 9;

[0023] The sequence of F-iv is shown in SEQ ID NO: 10;

[0024] For capturing signal strand DNA Probe-PD-L1 The capture probe can be SH-cDNA PD-L1 , PolyA(10)-cDNA or Fi PD-L1 SH-tFNA formed by hybridization with F-ii, F-iii, and F-iv PD-L1 One of;

[0025] Capture probe SH-cDNA PD-L1 The sequence is shown in SEQ ID NO: 11;

[0026] Fi PD-L1 The sequence is shown in SEQ ID NO:12.

[0027] Preferably, Fi EpCAM or Fi PD-L1 Anneal with F-ii, F-iii and F-iv at 95°C for 5 min, and then hybridize the four chains at 37°C for 30 min to obtain SH-tFNA EpCAM and SH-tFNA PD-L1 .

[0028] Preferably, the capture probe is added dropwise to the surface of the working electrode and incubated overnight at room temperature. The next day, the working electrode is blocked with mercaptohexanol to obtain an activated electrode with the function of capturing the signal chain.

[0029] Preferably, Apt EpCAM 、Apt PD-L1 , DNA Probe-EpCAM and DNA Probe-PD-L1 They were annealed at 95°C for 5 min and then Apt EpCAM With DNA Probe-EpCAM Mix, Apt PD-L1 With DNAProbe-PD-L1 The mixture was mixed and hybridized at 37°C for 30 min to obtain duplex probes for detecting EpCAM protein and PD-L1 protein, respectively.

[0030] Preferably, the sample may be derived from blood, urine, saliva, sweat, tears, cerebrospinal fluid, or peritoneal effusion.

[0031] Preferably, a function / arbitrary waveform generator device capable of outputting an AC electric field is used to output an AC voltage to the activated electrode, the output time is 1-30 min, the output waveform is a Sine waveform, the output channel is set to CH1, the frequency is set to 1250 Hz, and the amplitude is 800 mV. pp , offset is 1000mV DC The initial phase is 45°.

[0032] The present invention has at least the following beneficial effects:

[0033] First, the present invention provides a new method of electrochemical bioanalysis enhanced by self-suspended microbubbles. The method utilizes low-cost hollow glass microspheres, and according to their biocompatibility, easy modification and self-floating characteristics, makes them a platform for carrier transport in a non-uniform solution phase. The duplex probe pre-hybridized with the aptamer probe and the signal chain is modified on the surface of the hollow microsphere bubble by copper-free click chemistry technology. According to the principle of protein competitive chain displacement, when the sample to be tested is added to the system, the aptamer probe can more specifically recognize the EV surface protein, thereby competitively displacing the signal chain into the non-homogeneous solution system. Then, by modifying the capture probe that captures the signal chain on the working electrode, an AC electric field is applied to the electrode, and the capture probe can capture the signal chain free in the non-uniform solution phase, realize the detection of the signal chain under displacement, and use SWV or it curve as electrochemical signal detection. Compared with the current electrochemical EV detection, this technology uses a one-step, no-cleaning, efficient and rapid detection of EVs in samples, which can meet the needs of early diagnosis of EV-related diseases or tumors.

[0034] Second, the present invention combines hollow glass microspheres with electrochemistry for the first time, and accelerates the capture of competitively displaced signal chains through a function / arbitrary waveform generator that can output an alternating electric field, thereby reducing the detection time; and because a positive potential is applied to the surface of the electrochemical working electrode, it can accelerate the attraction of the signal chain, thereby increasing the sensitivity of the sensor to detect surface proteins or internal nucleic acids in extracellular vesicles. The present invention can realize the detection of single extracellular vesicles, providing a molecular basis for the early diagnosis and analysis of extracellular vesicle-related diseases and tumor diseases.

[0035] Third, the present invention can increase the click chemistry binding sites on the surface of hollow glass microspheres by modifying the surface of hollow glass microspheres with diphenylcyclooctyne, increase the number of binding aptamer probes, thereby improving the specific capture of the target and improving the speed and sensitivity of detecting the target.

[0036] Fourthly, the hollow glass microspheres with surface-modified diphenylcyclooctyne prepared by the present invention use cheap raw materials, and the prepared hollow glass microspheres with surface-modified diphenylcyclooctyne have good stability and can be stored for a long time under low temperature conditions.

[0037] Fifth, the present invention can perform single-target or multi-target electrochemical detection of protein markers on the surface of extracellular vesicles by changing the aptamer probes and signal chain probes modified on the hollow glass microspheres, as well as the capture probes on the surface of the working electrode, thereby realizing extracellular vesicle-related detection and early diagnosis and analysis of tumor diseases.

[0038] Other advantages, objectives and features of the present invention will be embodied in part through the following description, and in part will be understood by those skilled in the art through study and practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is a schematic diagram of the process of preparing self-suspended microbubbles for enhancing the electrochemical analysis method of the present invention;

[0040] Figure 2 This is a fluorescence characterization diagram of the self-suspended microbubbles used to enhance the electrochemical analysis method of the present invention;

[0041] Figure 3 The SEM and TEM characterization images of the self-suspended microbubbles for enhancing the electrochemical analysis method of the present invention;

[0042] Figure 4 The flowchart of the preparation of Click GB@ds-DNA for enhancing the electrochemical analysis method of the present invention;

[0043] Figure 5 This is a fluorescence characterization diagram of the protein competitive chain displacement principle in the analytical method;

[0044] Figure 6 Schematic diagram of protein competitive chain displacement after applying AC electric field in the analytical method;

[0045] Figure 7 This is a fluorescence characterization diagram for capturing EVs using the enhanced electrochemical analysis method of the present invention;

[0046] Figure 8 This is a SEM characterization image of the enhanced electrochemical analysis method for capturing EVs of the present invention;

[0047] Fig. 9 The single-target electrochemical SWV curve and its signal value for the enhanced electrochemical analysis method for detecting EVs of the present invention;

[0048] Fig.10 The multi-target electrochemical SWV curve and its signal value for the enhanced electrochemical analysis method for detecting EVs of the present invention;

[0049] Fig.11 It is a single-target electrochemical it curve and its signal value for the enhanced electrochemical analysis method for detecting EVs according to the present invention. DETAILED DESCRIPTION

[0050] The present invention is further described in detail below in conjunction with the accompanying drawings so that those skilled in the art can implement the invention with reference to the description.

[0051] It should be understood that terms such as “having”, “including” and “comprising” used herein do not exclude the existence or addition of one or more other elements or combinations thereof.

[0052] It should be noted that the experimental methods described in the following embodiments are conventional methods unless otherwise specified, and the reagents and materials can be obtained from commercial channels unless otherwise specified.

[0053] A self-suspended microbubble-enhanced electrochemical bioanalysis method comprising the following steps:

[0054] S1: Dibenzocyclooctyne-active ester is modified onto hollow glass microspheres to obtain antifouling glass microspheres with bioorthogonal functions;

[0055] S2: mismatch hybridization of the aptamer probe used to capture the target with the signal chain carrying the signal group to obtain a duplex probe (ds-DNA);

[0056] S3: The duplex probes were modified onto antifouling glass microspheres with bioorthogonal functions by click chemistry to obtain glass microspheres with target capture function (Click GB@ds-DNA);

[0057] S4: modifying the capture probe onto the surface of the working electrode to obtain an activated electrode with the function of capturing the signal chain;

[0058] S5: Add equal volumes of glass microspheres with target capture function and samples to the activated electrode, output an alternating electric field to the activated electrode so that the activated electrode can capture the signal chain with signal groups, and select an analysis method based on the characteristics of the signal groups on the signal chain to perform electrochemical bioanalysis on the signal chain captured on the working electrode.

[0059] In another technical solution, the method for modifying the dibenzocyclooctyne-active ester onto the hollow glass microspheres comprises the following steps:

[0060] 1) adding bovine serum albumin and tri(2-carboxyethyl)phosphine hydrochloride solution to the hollow glass microspheres, adjusting the pH value to 4-6 to obtain a phase-changing bovine serum albumin coating, centrifuging, removing the lower layer solution, washing with ultrapure water, and drying to obtain hollow glass microspheres with surface modified amino groups;

[0061] 2) Mixing the hollow glass microspheres with amino groups modified on the surface with dibenzocyclooctene-active ester, centrifuging, removing the lower layer solution, washing with ultrapure water, and drying to obtain antifouling glass microspheres with bioorthogonal function.

[0062] In another technical solution, the capture target is a protein on the surface of an extracellular vesicle, which may be one or both of EpCAM protein and PD-L1 protein. The aptamer probe Apt for capturing the EpCAM protein EpCAM The sequence is shown in SEQ ID NO: 1, and the aptamer probe Apt for capturing PD-L1 protein PD-L1 The sequence is shown in SEQ ID NO:2.

[0063] SEQ ID NO: 1: / 5N3 / cactacagaggttgcgtctgtcccacgttgtcatggggggttggcctg.

[0064] SEQ ID NO: 2: / 5N3 / acgggccacatcaactcattgatagacaatgcgtccactgcccgt.

[0065] In another technical solution, the signal chain DNA of the target protein EpCAM protein Probe-EpCAM The sequence is shown in SEQ ID NO: 3; SEQ ID NO: 3: attagtcttagaggcagacaacgtggg, the signal group modified at the 3 ends of the sequence can be methylene blue (MB) or biotin (Boitin);

[0066] That is, the sequence of the modified MB is SEQ ID NO: 3-1: attagtcttagaggcagacaacgtggg / 3MB / ;

[0067] Modified Boitin sequence SEQ ID NO: 3-2: attagtcttagaggcagacaacgtggg / 3Biotin / ;

[0068] Signal chain DNA of target protein PD-L1 proteinProbe-PD-L1 The sequence of SEQ ID NO: 4 is agttgatgtggcttt. The signal groups modified in the three segments of the sequence can be methylene blue (MB), ferrocene (Fc) or biotin (Boitin); after the signal groups are modified, they are shown in SEQ ID NO: 4-1, SEQ ID NO: 4-2, and SEQ ID NO: 4-3;

[0069] Modified MB sequence SEQ ID NO: 4-1: agttgatgtggcttt / 3MB / ;

[0070] Modified Fc sequence SEQ ID NO: 4-2: agttgatgtggcttt / 3Fc / ;

[0071] Modified Boitin sequence SEQ ID NO: 4-3: agttgatgtggcttt / 3Biotin / .

[0072] In another technical scheme, the signal chain DNA is captured Probe-EpCAM The capture probe can be SH-cDNA EpCAM , PolyA(10)-cDNA or Fi EpCAM SH-tFNA formed by hybridization with F-ii, F-iii, and F-iv EpCAM Any of the following:

[0073] Capture probe SH-cDNA EpCAM The sequence is shown in SEQ ID NO: 5;

[0074] SEQ ID NO: 5: cccacgttgtctgcctctaagactaat / 5SH C6 / ;

[0075] The sequence of the capture probe PolyA(10)-cDNA is shown in SEQ ID NO: 6;

[0076] SEQ ID NO: 6: aaagccacatcaactaaaaaaaaacccacgttgtctgcctctaagactaat;

[0077] Fi EpCAM The sequence is shown in SEQ ID NO: 7;

[0078] SEQ ID NO: 7:

[0079] acattcctaagtctgaaacattacagcttgctacacgagaagagccgccatagtaaaaaaaaaacccacgttgtctgcctctaagactaat;

[0080] The sequence of F-ii is shown in SEQ ID NO: 8;

[0081] SEQ ID NO: 8: tatcaccaggcagttgacagtgtagcaagctgtaatagatgcgagggtccaatac / 5SH C6 / ;

[0082] The sequence of F-iii is shown in SEQ ID NO: 9;

[0083] SEQ ID NO: 9: tcaactgcctggtgataaaacgacactacgtgggaatctactatggcggctcttc / 5SH C6 / ;

[0084] The sequence of F-iv is shown in SEQ ID NO: 10;

[0085] SEQ ID NO: 10: ttcagacttaggaatgtgcttcccacgtagtgtcgtttgtattggaccctcgcat / 5SH C6 / ;

[0086] For capturing signal strand DNA Probe-PD-L1 The capture probe can be SH-cDNA PD-L1 , PolyA(10)-cDNA or Fi PD-L1 SH-tFNA formed by hybridization with F-ii, F-iii, and F-iv PD-L1 Any of the following:

[0087] Capture probe SH-cDNA PD-L1 The sequence is shown in SEQ ID NO: 11;

[0088] SEQ ID NO: 11: aaagccacatcaact / 5SH C6 / ;

[0089] Fi PD-L1 The sequence is shown in SEQ ID NO: 12;

[0090] Fi PD-L1 :

[0091] acattcctaagtctgaaacattacagcttgctacacgagaagagccgccatagtaaaaaaaaaaaaaagccacatcaact.

[0092] In another technical solution, Fi EpCAM or Fi PD-L1 Anneal with F-ii, F-iii and F-iv at 95°C for 5 min, and then hybridize the four chains at 37°C for 30 min to obtain SH-tFNA EpCAM or SH-tFNA PD-L1 , that is, Fi EpCAM , F-ii, F-iii and F-iv to obtain SH-tFNA EpCAM Fi PD-L1 , F-ii, F-iii and F-iv to obtain SH-tFNA PD-L1 .

[0093] In another technical solution, the capture probe is added dropwise to the surface of the working electrode and incubated at room temperature overnight, i.e., for 6-12 hours. The next day, the working electrode is sealed with mercaptohexanol to obtain an activated electrode with capture signal chain function.

[0094] In another technical solution, Apt EpCAM 、Apt PD-L1 , DNA Probe-EpCAM and DNA Probe-PD-L1 They were annealed at 95°C for 5 min and then Apt EpCAM With DNA Probe-EpCAM Mix, Apt PD-L1 With DNA Probe-PD-L1 The mixture was mixed and hybridized at 37°C for 30 min to obtain duplex probes for detecting EpCAM protein and PD-L1 protein, respectively.

[0095] In another technical solution, the sample may be derived from blood, urine, saliva, sweat, tears, cerebrospinal fluid, or peritoneal effusion.

[0096] In another technical solution, a function / arbitrary waveform generator device capable of outputting an AC electric field is used to output an AC voltage to the activated electrode. The output time is 1-30 minutes, the output waveform is a Sine waveform, the output channel is set to CH1, the frequency is set to 1250 Hz, and the amplitude is 800 mV. pp , offset is 1000mV DC The initial phase is 45°.

[0097] <Test 1>

[0098] like Figure 1 As shown, the preparation of hollow glass microspheres with surface modified diphenylcyclooctyne (DBCO) comprises the following steps:

[0099] 1) Weigh 1 g of hollow glass microspheres and add them into a 50 mL centrifuge tube, add 20 mL of 2 mg / mL BSA (bovine serum albumin) and 20 mL of 25 mM TCEP (tris(2-carboxyethyl)phosphine hydrochloride) solution, adjust the pH to 5.0 with sodium hydroxide solution (1 M), and mix on a rotary mixer at room temperature for 2 h;

[0100] 2) The mixed solution of step 1) was centrifuged at 1000 rpm for 1 minute to remove the lower layer solution; ultrapure water was added for washing, and the centrifugation was repeated 3 times, and the glass microspheres (GB@PTB) with antifouling function were obtained and stored at -20°C;

[0101] 3) Weigh 100 mg of GB@PTB and add it to 1 mL of 1 mM DBCO-NHS (dibenzocyclooctyne-active ester) PBS solution for reaction at room temperature for 2 hours. Centrifuge at 4000 rpm for 10 seconds, remove the lower layer of solution, wash with ultrapure water, repeat centrifugation 3 times and vacuum dry to obtain antifouling glass microspheres (GB@DBCO) with bioorthogonal function, which are stored at -20°C.

[0102] <Test 2>

[0103] The hollow glass microspheres (GB), glass microspheres with antifouling function (GB@PTB), and antifouling glass microspheres with bioorthogonal function (GB@DBCO) of <Experiment 1> were characterized.

[0104] For GB@PTB and GB@DBCO, fluorescence characterization was performed. Since diphenylcyclooctyne (DBCO) can react with azide (N3), the coating on the surface of hollow glass microspheres can be characterized using Cy3 azide fluorescent dye (Cy3-N3). 1 mg of GB, GB@PTB, and GB@DBCO were weighed and reacted in a PBS solution containing 1 mM Cy3-N3 at 37°C for 5 minutes. The samples were washed with ultrapure water 5 times and observed using an inverted fluorescence microscope.

[0105] The fluorescence characterization results are as follows Figure 2 As shown in the figure, after being stained with Cy3-N3, the surface of the hollow glass microspheres of GB@DBCO modified with DBCO showed obvious fluorescence signals, while the surface of GB or GB@PTB without DBCO modification showed no signals or very weak signals, which proved that DBCO successfully modified the surface of hollow glass microspheres.

[0106] GB and GB@PTB were electrolytically characterized and observed using TEM and SEM. Figure 3 As shown. The surface of ordinary GB is relatively flat and smooth. After modification with PTB coating (bovine serum albumin and tri(2-carboxyethyl)phosphine hydrochloride coating), a layer of nanofilm can be observed on the surface, proving that PTB successfully covers the GB surface. Similarly, after modification with DBCO coating, a layer of nanofilm can also be observed on the surface, which is different from the PTB nanofilm structure, but the thickness is basically the same, proving that DBCO successfully covers the GB@PTB surface.

[0107] <Test 3>

[0108] like Figure 4 As shown, the preparation of glass microspheres with target capture function (Click GB@ds-DNA) includes the following steps:

[0109] 1) 0.5-1.5 μM Apt EpCAM 、Apt PD-L1 , DNA Probe-EpCAM and DNA Probe-PD-L1 They were annealed at 95°C for 5 min and then Apt EpCAM and DNA Probe-EpCAM 、Apt PD-L1 and DNA Probe-PD-L1 Transfer to a centrifuge tube and hybridize for 30 min to obtain duplex DNA strands (ds-DNA);

[0110] 2) 1.0-3.0 μM of the hybridized duplex probe was mixed with 0.5-3.0 mg GB@DBCO at room temperature through click chemistry for 20-50 min to complete the modification of the DNA chain on the hollow glass microspheres. The unreacted lower layer solution was removed by centrifugation and washed with PBS for 3-5 times to obtain Click GB@ds-DNA, which can be used to detect the two target proteins EpCAM and PD-L1 and then stored at 4°C.

[0111] <Test 4>

[0112] Fluorescence characterization of target protein captured by Click GB@ds-DNA.

[0113] Take 10-100μL of Click GB@ds-DNA in a 1.5mL centrifuge tube, add an equal amount of PBS solution, and set this group as the blank group; add an equal amount of extracellular vesicles and set this group as the experimental group. The two groups are mixed at room temperature for 20-50 minutes at the same time, so that the aptamer probe on the Click GB@ds-DNA in the experimental group can fully recognize the protein markers on the surface of the extracellular vesicles, resulting in the signal chain being competitively replaced and free in the centrifuge tube. The duplex probe on Click GB@ds-DNA is the aptamer probe AptEpCAM (SEQ ID NO: 1) and signal chain DNA Probe-EpCAM (SEQ ID NO: 3-1) was obtained by hybridization.

[0114] After the mixed reaction is completed, the displaced signal chain in the solution is removed by centrifugation, and then washed with PBS for 3-5 times, and then an equal amount of PBS solution is added for storage. When the signal chain is modified with a methylene blue (MB) electrochemical signal group, since methylene blue (MB) is fluorescent and can be used for fluorescence characterization, an inverted fluorescence microscope can be used for observation.

[0115] like Figure 5 As shown in the figure, the fluorescence value of the blank group (i.e., the group without extracellular vesicles) was significantly higher than that of the experimental group (i.e., the group with extracellular vesicles), proving that when extracellular vesicles exist in the system, the aptamer probe on Click GB@ds-DNA can recognize the protein markers on the surface of extracellular vesicles, thereby displacing the signal chain, indicating that the principle of protein competitive chain displacement was successfully applied in this system.

[0116] <Test 5>

[0117] like Figure 6 As shown, the protein competitive chain displacement principle of the entire system after an AC electric field is applied to the working electrode surface.

[0118] 1) Place 10-40 μL of Click GB@ds-DNA and an equal volume of extracellular vesicles on the surface of the working electrode, and use an adapter to connect the electrode to a function / arbitrary waveform generator with an output AC electric field. The output time is 1-30 min, the output waveform is a Sine waveform, and the output channel is CH1. Then set the frequency to 1250 Hz and the amplitude to 800 mV. pp , offset is 1000mV DC The initial phase is 45°.

[0119] 2) When the AC electric field output time is over, the electrode is connected to the electrochemical workstation, and the SWV or it curve is selected to detect the signal chain under displacement according to the electrochemical group modified at the end of the signal chain and the capture probe modified on the working electrode.

[0120] <Test 6>

[0121] In order to observe the captured exosomes, DiI was used to stain the Click GB@ds-DNA captured exosomes. Figure 7 As shown in Figure 2, there is an obvious fluorescence signal on the surface of Click GB@ds-DNA. The captured exosomes were fixed with glutaraldehyde and observed using SEM. Figure 8As shown in Figure 2, there is an obvious membrane structure attached to the surface of the microbubbles, proving the successful capture of exosomes. The duplex probe on Click GB@ds-DNA is the aptamer probe Apt EpCAM (SEQ ID NO: 1) and signal chain DNA Probe-EpCAM (SEQ ID NO: 3-1) was obtained by hybridization.

[0122] <Test 7>

[0123] Square wave voltammetry (SWV) electrochemical signaling for single target analysis of extracellular vesicle surface protein markers.

[0124] 1) Take 10 μL 30 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP), 20 μL 5 mM SH-cDNA (SH-cDNA EpCAM ) capture probe and 70 μL TM buffer were mixed evenly at room temperature and then dropped onto the working electrode surface for overnight incubation at room temperature. The next day, the working electrode was blocked with mercaptohexanol (MCH).

[0125] 2) Take equal amounts of Click GB@ds-DNA and extracellular vesicles on the surface of the working electrode, output an AC electric field to the working electrode for 1-30 minutes, and set the output waveform, channel and parameters in the function / arbitrary waveform generator. When the AC electric field output time is over, use the electrochemical workstation to detect the methylene blue (MB) on the captured signal chain. MB will have an obvious SWV signal peak at around -0.3V, such as Fig. 9 As shown in the figure, the square wave voltammetry (SWV) curve and its corresponding signal value can be used to analyze the surface protein markers of extracellular vesicles. The duplex probe on Click GB@ds-DNA is the aptamer probe Apt EpCAM (SEQ ID NO: 1) and signal chain DNA Probe-EpCAM (SEQ ID NO: 3-1) was obtained by hybridization.

[0126] <Test Eight>

[0127] Square wave voltammetry (SWV) electrochemical signal detection of EV multi-target analysis of extracellular vesicle surface protein markers.

[0128] 1) Take 10 μL 30 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP), 20 μL 5 mM poly(10)-cDNA capture probe and 70 μL TM buffer, mix well at room temperature, and drop onto the working electrode surface. Incubate overnight at room temperature. The next day, block the working electrode with mercaptohexanol (MCH).

[0129] 2) Take equal amounts of Click GB@ds-DNA and extracellular vesicles on the surface of the working electrode, output an AC electric field to the working electrode for 1-30 minutes, and set the output waveform, channel and parameters in the function / arbitrary waveform generator. When the AC electric field output time is over, use the electrochemical workstation to detect the methylene blue (MB) and ferrocene (Fc) on the captured signal chain. MB will have an obvious SWV signal peak at around -0.3V, and Fc will have an obvious SWV signal peak at around +0.3VV, such as Fig.10 As shown in the figure, through the square wave voltammetry (SWV) curve and its corresponding signal value, multi-target analysis of extracellular vesicle surface protein markers can be performed simultaneously. Click GB@ds-DNA is modified with two duplex probes, namely the aptamer probe Apt EpCAM (SEQ ID NO: 1) and signal chain DNA Probe-EpCAM (SEQ ID NO: 3-1) hybridized duplex probe, and aptamer probe Apt PD-L1 (SEQ ID NO: 2) and signal chain DNA Probe-PD-L1 (SEQ ID NO: 4-2) hybridized duplex probe.

[0130] <Test Nine>

[0131] Single target analysis of extracellular vesicle surface protein markers by it curve electrochemical signal.

[0132] 1) Take 10 μL 30 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP), 1 μL 1 μM Fi EpCAM , F-ii, F-iii and F-iv capture probes and 70 μL of TM buffer were mixed evenly at room temperature and then dropped onto the surface of the working electrode and incubated overnight at room temperature. The next day, the working electrode was blocked with mercaptohexanol (MCH).

[0133] 2) Take equal amounts of Click GB@ds-DNA and extracellular vesicles on the working electrode surface prepared in step 1), output AC electric field to the working electrode for 1-30 minutes, set the output waveform, channel and parameters on the function / arbitrary waveform generator, and after the output AC electric field time is over, wash the working electrode surface with PBS for 3-5 times. The duplex probe on Click GB@ds-DNA is the aptamer probe Apt EpCAM (SEQ ID NO: 1) and signal chain DNA Probe-EpCAM (SEQ ID NO: 3-2) was obtained by hybridization.

[0134] 3) Add 3 μL of Avidin-HRP (horseradish peroxidase labeled avidin) dilution solution to the electrode surface, react at room temperature for 15 minutes, and then wash with PBST (phosphate Tween buffer). Then catalyze the substrate TMB (3,3',5,5'-tetramethylbenzidine) to generate electrochemical signals. Fig.11 As shown, the it curve and its corresponding signal value can be used to analyze the extracellular vesicle surface protein markers by single target.

[0135] In this experiment, the capture probe on the working electrode can capture the signal chain of the Click GB@ds-DNA displacement free site. Since the group biotin on the signal chain will not show a signal value during electrochemical analysis, but biotin can bind to Avidin-HRP, Avidin-HRP can be bound to the electrode, and then Avidin-HRP can be used to catalyze TMB to produce an electrochemical signal. According to the electrochemical signal, the protein marker can be analyzed in terms of quantity and quality.

[0136] <Example 1>

[0137] A self-suspended microbubble-enhanced electrochemical bioanalysis method comprising the following steps:

[0138] S1: Dibenzocyclooctyne-active ester is modified onto hollow glass microspheres to obtain antifouling glass microspheres with bioorthogonal functions;

[0139] The specific steps include:

[0140] 1) adding bovine serum albumin and tri(2-carboxyethyl)phosphine hydrochloride solution to the hollow glass microspheres, adjusting the pH value to 4-6 to obtain a phase-changing bovine serum albumin coating, centrifuging, removing the lower layer solution, washing with ultrapure water, and drying to obtain hollow glass microspheres with surface modified amino groups;

[0141] 2) mixing the hollow glass microspheres with amino groups modified on the surface with dibenzocyclooctene-active ester, centrifuging, removing the lower layer solution, washing with ultrapure water, and drying to obtain antifouling glass microspheres with bioorthogonal function;

[0142] S2: mismatch hybridization of the aptamer probe used to capture the target with the signal chain carrying the signal group to obtain a duplex probe (ds-DNA);

[0143] Specific: aptamer probe Apt EpCAM Signaling DNA with modified MB Probe-EpCAM (SEQ ID NO: 3-1) hybridization, that is, Apt EpCAM , DNA Probe-EpCAM They were annealed at 95°C for 5 min and then Apt EpCAM With DNAProbe-EpCAM The mixture was mixed and hybridized for 30 min at 37°C to obtain a duplex probe for detecting EpCAM protein;

[0144] S3: The duplex probes were modified onto antifouling glass microspheres with bioorthogonal functions by click chemistry to obtain glass microspheres with target capture function (Click GB@ds-DNA);

[0145] S4: modifying the capture probe onto the surface of the working electrode to obtain an activated electrode with the function of capturing the signal chain;

[0146] Specifically, the capture probe SH-cDNA EpCAM Add dropwise to the surface of the working electrode, incubate overnight at room temperature, and the next day, seal the working electrode with mercaptohexanol to obtain an activated electrode with the function of capturing the signal chain;

[0147] S5: adding equal volumes of glass microspheres with target capture function and samples to the activated electrode, outputting an alternating electric field to the activated electrode so that the activated electrode can capture the signal chain with the signal group, connecting the activated electrode with the captured signal chain to the electrochemical workstation, outputting an alternating electric field to the activated electrode, and performing electrochemical bioanalysis detection on the signal chain captured on the working electrode through a square wave voltammetry (SWV) curve;

[0148] Specifically, a function / arbitrary waveform generator device capable of outputting an AC electric field is used to output an AC voltage to the activated electrode. The output time is 1-30 min, the output waveform is a Sine waveform, the output channel is set to CH1, the frequency is set to 1250 Hz, and the amplitude is 800 mV. pp , offset is 1000mV DC The initial phase is 45°.

[0149] This example is used for the detection of a single target protein EpCAM.

[0150] <Example 2>

[0151] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 1 in that the capture probe is PolyA(10)-cDNA.

[0152] This example is used for the detection of a single target protein EpCAM.

[0153] <Example 3>

[0154] A self-suspended microbubble enhanced electrochemical bioanalysis method, which differs from Example 1 in that the capture probe is SH-tFNA EpCAM .

[0155] This example is used for the detection of a single target protein EpCAM.

[0156] <Example 4>

[0157] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 1 in that the aptamer probe Apt EpCAM Signal chain DNA with modified biotin Probe-EpCAM (SEQ ID NO: 3-2) hybridization, add Avidin-HRP dilution to the activated electrode with captured signal chain, react at room temperature for 15 minutes, and wash with PBST after reaction. Then catalyze the substrate TMB to generate electrochemical signal. Through the it curve and its corresponding signal value, single target analysis of extracellular vesicle surface protein markers can be achieved.

[0158] This example is used for the detection of a single target protein EpCAM.

[0159] <Example 5>

[0160] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 1 in that the aptamer probe Apt EpCAM Signal chain DNA with modified biotin Probe-EpCAM (SEQ ID NO: 3-2) hybridization, capture probe is PolyA (10)-cDNA, add Avidin-HRP dilution to the activated electrode with captured signal chain, react at room temperature for 15 minutes, and wash with PBST after reaction. Then catalyze the substrate TMB to generate electrochemical signal. Through the it curve and its corresponding signal value, single target analysis of extracellular vesicle surface protein markers can be achieved.

[0161] This example is used for the detection of a single target protein EpCAM.

[0162] <Example 6>

[0163] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 1 in that the aptamer probe Apt EpCAM Signal chain DNA with modified biotin Probe-EpCAM (SEQ ID NO: 3-2) hybridization, the capture probe is SH-tFNA EpCAM , add Avidin-HRP dilution to the activated electrode with captured signal chain, react at room temperature for 15 minutes, and wash with PBST after reaction. Then catalyze the substrate TMB to generate electrochemical signal. Through the it curve and its corresponding signal value, single target analysis of extracellular vesicle surface protein markers can be achieved.

[0164] This example is used for the detection of a single target protein EpCAM.

[0165] <Example 7>

[0166] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 1 in that the aptamer probe Apt PD-L1 Signaling DNA with modified MB Probe-PD-L1 (SEQ ID NO: 4-1) hybridization, that is, Apt PD-L1 , DNA Probe-PD-L1 They were annealed at 95°C for 5 min and then Apt PD-L1 With DNA Probe-PD-L1 Mix and hybridize for 30 min at 37°C to obtain a duplex probe for detecting PD-L1 protein. The capture probe is SH-cDNA. PD-L1 .

[0167] This example is used for the detection of a single target protein, PD-L1.

[0168] <Example 8>

[0169] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 7 in that the capture probe is PolyA(10)-cDNA.

[0170] This example is used for the detection of a single target protein, PD-L1.

[0171] <Example 9>

[0172] A self-suspended microbubble enhanced electrochemical bioanalysis method, which differs from Example 7 in that the capture probe is SH-tFNA PD-L1 .

[0173] This example is used for the detection of a single target protein, PD-L1.

[0174] <Example 10>

[0175] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 7 in that the aptamer probe Apt PD-L1 Fc-modified signal chain DNA Probe-PD-L1 (SEQ ID NO: 4-2) hybridization.

[0176] This example is used for the detection of a single target protein, PD-L1.

[0177] <Example 11>

[0178] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 7 in that the aptamer probe Apt PD-L1 Fc-modified signal chain DNA Probe-PD-L1(SEQ ID NO: 4-2) hybridization, the capture probe is PolyA(10)-cDNA.

[0179] This example is used for the detection of a single target protein, PD-L1.

[0180] <Example 12>

[0181] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 7 in that the aptamer probe Apt PD-L1 Fc-modified signal chain DNA Probe-PD-L1 (SEQ ID NO: 4-2) hybridization, the capture probe is SH-tFNA PD-L1 .

[0182] This example is used for the detection of a single target protein, PD-L1.

[0183] <Example 13>

[0184] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 7 in that the aptamer probe Apt PD-L1 Boitin signaling DNA Probe-PD-L1 (SEQ ID NO: 4-3) hybridization, add Avidin-HRP dilution to the activated electrode with captured signal chain, react at room temperature for 15 minutes, and wash with PBST after reaction. Then catalyze the substrate TMB to generate electrochemical signal. Through the it curve and its corresponding signal value, single target analysis of extracellular vesicle surface protein markers can be achieved.

[0185] This example is used for the detection of a single target protein, PD-L1.

[0186] <Example 14>

[0187] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 1 in that Apt EpCAM 、Apt PD-L1 , DNA Probe-EpCAM and DNA Probe-PD-L1 They were annealed at 95°C for 5 min and then Apt EpCAM With DNA Probe-EpCAM Mix, Apt PD-L1 With DNA Probe-PD-L1 The mixture was mixed and hybridized at 37°C for 30 minutes to obtain duplex probes for detecting EpCAM protein and PD-L1 protein, respectively. The two duplex probes were then simultaneously modified onto anti-fouling glass microspheres with bioorthogonal functions through click chemistry. The signal chain DNA Probe-EpCAM Using MB modification, signal chain DNA Probe-PD-L1Utilize Fc modification; SH-cDNA EpCAM and SH-cDNA PD-L1 Two capture probes were modified onto the working electrode.

[0188] During detection, since the peak positions of MB and FC are different, this embodiment can be used for the simultaneous detection of multiple target proteins EpCAM and PD-L1.

[0189] <Example 15>

[0190] A self-suspended microbubble enhanced electrochemical bioanalysis method, which is different from Example 14 in that the capture probe is modified with PolyA(10)-cDNA onto the working electrode.

[0191] The capture probe PolyA(10)-cDNA can simultaneously capture the signal chain DNA Probe-EpCAM and DNA Probe-PD-L1 Therefore, in this embodiment, only the capture probe PolyA(10)-cDNA can be used to achieve the simultaneous detection of multiple target proteins EpCAM and PD-L1.

[0192] The analytical method of the present invention has strong specificity and high sensitivity, and can be used for the detection of samples other than blood, such as urine, saliva, sweat, tears, cerebrospinal fluid, peritoneal effusion, etc.

[0193] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.

Claims

1. A self-suspended microbubble-enhanced electrochemical bioanalysis method, characterized in that: The following steps are involved: S1: Dibenzocyclooctyne-active ester is modified onto hollow glass microspheres to obtain antifouling glass microspheres with bioorthogonal functions; S2: mismatch hybridization of the aptamer probe used to capture the target with the signal chain carrying the signal group to obtain a duplex probe; S3: The duplex probes were modified onto antifouling glass microspheres with bioorthogonal functions by click chemistry to obtain glass microspheres with target capture function; S4: modifying the capture probe onto the surface of the working electrode to obtain an activated electrode with the function of capturing the signal chain; S5: Add equal volumes of glass microspheres with target capture function and samples to the activated electrode, output an alternating electric field to the activated electrode so that the activated electrode can capture the signal chain with signal groups, and select an analysis method based on the characteristics of the signal groups on the signal chain to perform electrochemical bioanalysis on the signal chain captured on the working electrode.

2. The self-suspended microbubble enhanced electrochemical bioanalysis method according to claim 1, characterized in that: The method for modifying the dibenzocyclooctyne-active ester onto hollow glass microspheres comprises the following steps: 1) adding bovine serum albumin and tri(2-carboxyethyl)phosphine hydrochloride solution to the hollow glass microspheres, adjusting the pH value to 4-6 to obtain a phase-changing bovine serum albumin coating, centrifuging, removing the lower layer solution, washing with ultrapure water, and drying to obtain hollow glass microspheres with surface modified amino groups; 2) Mixing the hollow glass microspheres with amino groups modified on the surface with dibenzocyclooctene-active ester, centrifuging, removing the lower layer solution, washing with ultrapure water, and drying to obtain antifouling glass microspheres with bioorthogonal function.

3. The self-suspended microbubble enhanced electrochemical bioanalysis method according to claim 1, characterized in that: The capture target is a protein on the surface of extracellular vesicles, which can be one or both of EpCAM protein and PD-L1 protein. The aptamer probe Apt used to capture EpCAM protein EpCAM The sequence is shown in SEQ ID NO: 1, and the aptamer probe Apt for capturing PD-L1 protein PD-L1 The sequence is shown in SEQ ID NO:

2.

4. The self-suspended microbubble enhanced electrochemical bioanalysis method according to claim 1, characterized in that: Target protein EpCAM protein signal chain DNA Probe-EpCAM The sequence is shown in SEQ ID NO: 3, and the signal group modified at the 3 end of the sequence SEQ ID NO: 3 can be methylene blue or biotin; Signal chain DNA of target protein PD-L1 protein Probe-PD-L1 The sequence is shown in SEQ ID NO: 4, and the signal group modified at the 3 end of the sequence SEQ ID NO: 4 can be methylene blue, ferrocene or biotin.

5. The self-suspended microbubble enhanced electrochemical bioanalysis method according to claim 1, characterized in that: For capturing signal strand DNA Probe-EpCAM The capture probe can be SH-cDNA EpCAM , PolyA(10)-cDNA or Fi EpCAM SH-tFNA formed by hybridization with F-ii, F-iii, and F-iv EpCAM One of; Capture probe SH-cDNA EpCAM The sequence is shown in SEQ ID NO: 5; The sequence of the capture probe PolyA(10)-cDNA is shown in SEQ ID NO: 6; Fi EpCAM The sequence is shown in SEQ ID NO: 7; The sequence of F-ii is shown in SEQ ID NO: 8; The sequence of F-iii is shown in SEQ ID NO: 9; The sequence of F-iv is shown in SEQ ID NO: 10; For capturing signal strand DNA Probe-PD-L1 The capture probe can be SH-cDNA PD-L1 , PolyA(10)-cDNA or Fi PD-L1 SH-tFNA formed by hybridization with F-ii, F-iii, and F-iv PD-L1 One of; Capture probe SH-cDNA PD-L1 The sequence is shown in SEQ ID NO: 11; Fi PD-L1 The sequence is shown in SEQ ID NO:

12.

6. The self-suspended microbubble enhanced electrochemical bioanalysis method according to claim 5, characterized in that: Fi EpCAM or Fi PD-L1 Anneal with F-ii, F-iii and F-iv at 95°C for 5 min, and then hybridize the four chains at 37°C for 30 min to obtain SH-tFNA EpCAM or SH-tFNA PD-L1 .

7. The self-suspended microbubble enhanced electrochemical bioanalysis method according to claim 1, characterized in that: The capture probe was dropped onto the surface of the working electrode and incubated overnight at room temperature. The next day, the working electrode was sealed with mercaptohexanol to obtain an activated electrode with the function of capturing the signal chain.

8. The self-suspended microbubble enhanced electrochemical bioanalysis method according to claim 1, characterized in that: Apt EpCAM 、Apt PD-L1 , DNA Probe-EpCAM and DNA Probe-PD-L1 They were annealed at 95°C for 5 min and then Apt EpCAM With DNA Probe-EpCAM Mix, Apt PD-L1 With DNA Probe-PD-L1 The mixture was mixed and hybridized at 37°C for 30 min to obtain duplex probes for detecting EpCAM protein and PD-L1 protein, respectively.

9. The self-suspended microbubble enhanced electrochemical bioanalysis method according to claim 1, characterized in that: The sample may be derived from blood, urine, saliva, sweat, tears, cerebrospinal fluid, or peritoneal effusion.

10. The self-suspended microbubble enhanced electrochemical bioanalysis method according to claim 1, characterized in that: Use a function / arbitrary waveform generator device that can output AC electric field to output AC voltage to the activated electrode. The output time is 1-30min, the output waveform is Sine waveform, the output channel is set to CH1, the frequency is set to 1250Hz, and the amplitude is 800mV. pp , offset is 1000mV DC The initial phase is 45°.

Images