Anti-CD16A nano antibody, bispecific antibody containing same and application of anti-CD16A nano antibody

Abstract

The invention discloses an anti-CD16A nano antibody, a bispecific antibody containing the anti-CD16A nano antibody and application of the anti-CD16A nano antibody, the anti-CD16A nano antibody at least comprises a VHH chain, and the VHH chain comprises CDR1, CDR2 and CDR3. The anti-CD16A nano antibody developed by the invention has the advantages of small molecular weight, good thermal stability and the like, and is suitable for the development of bispecific antibodies. The nano antibody and the bispecific antibody containing the nano antibody have great value in treatment and diagnosis of diseases, and also have great development prospects in antibody targeted diagnosis and treatment of tumors.

Description

Technical Field

[0001] The present invention belongs to the field of antibody drugs, and specifically relates to an anti-CD16A nano antibody, a bispecific antibody containing the same, and applications thereof. Background Art

[0002] There are three major categories of human IgG Fc receptors: FcγRI (CD64), FcγRII (CD32) and FcγRIII (CD16). CD16 (FcγRIII) is a low-affinity Fc receptor that binds to the Fc portion of IgG antibodies. Studies have found that CD16 is encoded by two different highly homologous genes in a cell type-specific manner, namely FcγRIIIa (CD16a) and FcγRIIIb (CD16b), with a homology of up to 94%. CD16A has two mutants, F176 and V176. CD16A has a transmembrane domain and a cytoplasmic tail, and is expressed on the surface of NK cells, monocytes and macrophages. It is also expressed in small amounts on the surface of DC cells. It is an activating receptor whose main function is to mediate antibody-dependent cellular cytotoxicity (ADCC). It is the receptor most associated with activating innate immune cells with killing functions (such as NK cells). CD16b is a glycosylphosphatidylinositol (GPI)-anchored receptor expressed on granulocytes and does not trigger the killing of tumor cells.

[0003] The CD16 molecule is an indispensable condition for NK cells to initiate the ADCC effect. In particular, the single-domain antibody VHH fragment is more suitable for the development of bispecific antibodies due to its advantages such as smaller molecular weight and good thermal stability. Therefore, nanoantibodies are of great value in the treatment and diagnosis of diseases, and also have great development prospects in the antibody-targeted diagnosis and treatment of tumors. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides anti-CD16A nanobody, bispecific antibodies containing the same and applications thereof.

[0005] Specifically, the present invention solves the above technical problems through the following technical solutions.

[0006] The present invention provides an anti-CD16A nanobody, wherein the nanobody comprises at least one VHH chain, wherein the VHH chain comprises CDR1, CDR2, and CDR3.

[0007] Wherein, the amino acid sequence of CDR1 is shown in SEQ ID NO: 2, the amino acid sequence of CDR2 is shown in SEQ ID NO: 3, and the amino acid sequence of CDR3 is shown in SEQ ID NO: 4;

[0008] Or, the amino acid sequence of CDR1 is shown as SEQ ID NO: 10, the amino acid sequence of CDR2 is shown as SEQ ID NO: 11, and the amino acid sequence of CDR3 is shown as SEQ ID NO: 12.

[0009] In some embodiments, the VHH chain comprises FR1, FR2, FR3 and FR4,

[0010] The amino acid sequence of FR1 is shown in SEQ ID NO: 5, the amino acid sequence of FR2 is shown in SEQ ID NO: 6, the amino acid sequence of FR3 is shown in SEQ ID NO: 7, and the amino acid sequence of FR4 is shown in SEQ ID NO: 8;

[0011] Or, the amino acid sequence of FR1 is shown in SEQ ID NO: 13, the amino acid sequence of FR2 is shown in SEQ ID NO: 14, the amino acid sequence of FR3 is shown in SEQ ID NO: 15, and the amino acid sequence of FR4 is shown in SEQ ID NO: 16;

[0012] Or, the amino acid sequence of FR1 is shown in SEQ ID NO: 18, the amino acid sequence of FR2 is shown in SEQ ID NO: 14, the amino acid sequence of FR3 is shown in SEQ ID NO: 15, and the amino acid sequence of FR4 is shown in SEQ ID NO: 8.

[0013] In some specific embodiments, the VHH chain comprises an amino acid sequence as shown in any one of SEQ ID NO: 1, SEQ ID NO: 9 or SEQ ID NO: 17 or a variant thereof;

[0014] Wherein, the variant has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence from which it is derived, and has the function of targeting CD16A.

[0015] The present invention also provides an isolated nucleic acid encoding the anti-CD16A nanobody.

[0016] The present invention also provides a recombinant expression vector, which contains the nucleic acid.

[0017] In some embodiments, the recombinant expression vector is selected from: a viral vector and a non-viral vector.

[0018] In some embodiments, the non-viral vector is selected from the group consisting of: a plasmid, a linear DNA fragment, and RNA.

[0019] In some specific embodiments, the recombinant expression vector is a plasmid, and the backbone of the plasmid is, for example, pcDNA3.4.

[0020] The present invention also provides a host cell, wherein the host cell comprises the nucleic acid or the recombinant expression vector.

[0021] In some embodiments, the host cell is a prokaryotic cell or a eukaryotic cell;

[0022] In some embodiments, the eukaryotic cell is a yeast cell or a mammalian cell.

[0023] In some specific embodiments, the mammalian cells are HEK293 cells.

[0024] The present invention also provides a method for preparing an anti-CD16A nanobody, the method comprising the following steps:

[0025] The host cells are cultured under conditions suitable for the growth and fermentation of the host cells, and anti-CD16A nanobody is obtained from the culture.

[0026] The present invention also provides a fusion protein, characterized in that it comprises the anti-CD16A nanobody and:

[0027] The Fc is derived from the heavy chain constant region of IgG1, IgG2, IgG3 or IgG4.

[0028] In some embodiments, the fusion protein further comprises an antigen binding molecule having another antigen binding property operably linked to the fusion protein.

[0029] In some specific embodiments, the antigen binding molecule is linked to the C-terminus of the Fc.

[0030] In some embodiments, the connection is achieved through a linker.

[0031] In some specific embodiments, the linker is (G4S) n .

[0032] In some specific embodiments, the linker is (G4S) n , where n is 1-3.

[0033] In some specific embodiments, the linker is (G4S) n , where n is 3.

[0034] In some embodiments, the antigen binding molecule comprises a heavy chain variable region and a light chain variable region,

[0035] The heavy chain variable region comprises HCDR1 with an amino acid sequence as shown in SEQ ID NO: 43, HCDR2 with an amino acid sequence as shown in SEQ ID NO: 45, and HCDR3 with an amino acid sequence as shown in SEQ ID NO: 47; the light chain variable region comprises LCDR1 with an amino acid sequence as shown in SEQ ID NO: 35, LCDR2 with an amino acid sequence of YA, and LCDR3 with an amino acid sequence as shown in SEQ ID NO: 39;

[0036] Or, the heavy chain variable region comprises HCDR1 with an amino acid sequence as shown in SEQ ID NO: 50, HCDR2 with an amino acid sequence as shown in SEQ ID NO: 52, and HCDR3 with an amino acid sequence as shown in SEQ ID NO: 54; the light chain variable region comprises LCDR1 with an amino acid sequence as shown in SEQ ID NO: 57, LCDR2 with an amino acid sequence of DA, and LCDR3 with an amino acid sequence as shown in SEQ ID NO: 60.

[0037] In some specific embodiments, the antigen binding molecule is selected from the following:

[0038] (1) the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO: 41; the light chain variable region comprises the amino acid sequence shown in SEQ ID NO: 33;

[0039] (2) the heavy chain variable region comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 41; the light chain variable region comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 33;

[0040] (3) the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO: 48; the light chain variable region comprises the amino acid sequence shown in SEQ ID NO: 55;

[0041] (4) The heavy chain variable region comprises an amino acid sequence that has at least 80% sequence identity with SEQ ID NO: 48; and the light chain variable region comprises an amino acid sequence that has at least 80% sequence identity with SEQ ID NO: 55.

[0042] In some specific embodiments, the fusion protein comprises an amino acid sequence as shown in any one of SEQ ID NOs: 25-26 or SEQ ID NOs: 28-29 or a variant thereof; wherein the variant has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence from which it is derived, and has the function of targeting CD16A and "FAP or ROR1".

[0043] In some of the above embodiments, the amino acid sequences of the listed CDRs are determined according to the IMGT definition rules. However, it is well known to those skilled in the art that the CDR of an antibody can be defined by a variety of methods in the art, such as Chothia (Chothia et al. (1989) Nature 342: 877-883, Al-Lazikani et al., "Standard conformations for the canonical structures of immunoglobulins", Journal of Molecular Biology, 273, 927-948 (1997)), based on the three-dimensional structure of the antibody and the topology of the CDR loop, Kabat (Kabat et al., Sequences of Proteins of Immunological Interest, 4th Edition, US Department of Health and Human Services, National Institutes of Health (1987)), AbM (University of Bath), Contact (University College London), the international ImMunoGeneTics database (IMGT) (World Wide Web imgt.cines.fr / ), and the North CDR definition based on affinity propagation clustering using a large number of crystal structures. It will be understood by those skilled in the art that, unless otherwise specified, the terms "CDR" and "complementarity determining region" of a given antibody or region thereof (e.g., variable region) should be understood to cover the complementarity determining regions defined by any of the above-mentioned known schemes, or the complementarity determining regions defined by any other definition rules based on the antibodies of the present invention.

[0044] The present invention also provides a chimeric antigen receptor, which comprises (a) an antigen binding domain, which includes the anti-CD16A nanobody or the fusion protein.

[0045] In some specific embodiments, the chimeric antigen receptor further comprises: (b) a hinge domain; (c) a transmembrane domain; (d) a co-stimulatory intracellular domain; (e) a signaling domain and (f) a signal peptide.

[0046] The present invention also provides a genetically modified cell, wherein the genetically modified cell comprises the chimeric antigen receptor.

[0047] In some specific embodiments, the host of the genetically modified cell is a T cell or a NK cell.

[0048] The present invention also provides an antibody-drug conjugate, which comprises a cytotoxic agent or a label, and the anti-CD16A nanobody or the fusion protein.

[0049] The present invention also provides a pharmaceutical composition or a medicine kit containing the same, which comprises the anti-CD16A nanobody, the fusion protein, the chimeric antigen receptor, the genetically modified cell or the antibody-drug conjugate, and at least one of a pharmaceutically acceptable carrier, excipient or diluent.

[0050] In some specific embodiments, the pharmaceutical composition or the kit containing the same further contains one or more of the group consisting of hormone preparations, targeted small molecule preparations, proteasome inhibitors, imaging agents, diagnostic agents, chemotherapeutic agents, oncolytic drugs, cytotoxic agents, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules and vaccines.

[0051] The present invention also provides the use of the anti-CD16A nanobody, the fusion protein, the chimeric antigen receptor, the genetically modified cell, the antibody-drug conjugate, the pharmaceutical composition, or a drug kit containing the same in the preparation of drugs for preventing and / or treating CD16A-mediated related diseases.

[0052] In some embodiments, the CD16A-mediated related diseases include tumors, infectious diseases and autoimmune diseases.

[0053] In some embodiments, the tumor includes solid tumors and hematological tumors.

[0054] In some specific embodiments, the tumor is selected from one or more of hemangioma, gastric cancer, liver cancer, lung cancer, breast cancer, colon cancer, nasopharyngeal cancer, bladder cancer, cervical cancer, prostate cancer, bone cancer, skin cancer, thyroid cancer, kidney cancer, esophageal cancer, melanoma, fibrosarcoma, rhabdomyosarcoma, astrocytoma, neuroblastoma and glioma.

[0055] In some specific embodiments, the autoimmune disease is selected from one or more of systemic lupus erythematosus, rheumatoid arthritis, systemic vasculitis, scleroderma, dermatomyositis, autoimmune hemolytic anemia, thyroid autoimmune disease, ulcerative colitis, chronic lymphocytic thyroiditis, hyperthyroidism, insulin-dependent diabetes mellitus, myasthenia gravis, ulcerative colitis, pernicious anemia with chronic atrophic gastritis, Goodpasture's syndrome, pemphigus vulgaris, pemphigoid, primary biliary cirrhosis, multiple sclerosis and acute idiopathic polyneuritis.

[0056] The present invention also provides a method for preventing and / or treating CD16A-mediated related diseases, which comprises administering an effective amount of the anti-CD16A nanobody, the fusion protein, the chimeric antigen receptor, the genetically modified cell, the antibody-drug conjugate, the pharmaceutical composition, or a kit containing the same to a subject in need.

[0057] In some embodiments, the CD16A-mediated related diseases include tumors, infectious diseases and autoimmune diseases.

[0058] In some embodiments, the tumor includes solid tumors and hematological tumors.

[0059] In some specific embodiments, the tumor is selected from one or more of hemangioma, gastric cancer, liver cancer, lung cancer, breast cancer, colon cancer, nasopharyngeal cancer, bladder cancer, cervical cancer, prostate cancer, bone cancer, skin cancer, thyroid cancer, kidney cancer, esophageal cancer, melanoma, fibrosarcoma, rhabdomyosarcoma, astrocytoma, neuroblastoma and glioma.

[0060] In some specific embodiments, the autoimmune disease is selected from one or more of systemic lupus erythematosus, rheumatoid arthritis, systemic vasculitis, scleroderma, dermatomyositis, autoimmune hemolytic anemia, thyroid autoimmune disease, ulcerative colitis, chronic lymphocytic thyroiditis, hyperthyroidism, insulin-dependent diabetes mellitus, myasthenia gravis, ulcerative colitis, pernicious anemia with chronic atrophic gastritis, Goodpasture's syndrome, pemphigus vulgaris, pemphigoid, primary biliary cirrhosis, multiple sclerosis and acute idiopathic polyneuritis.

[0061] The present invention also provides the anti-CD16A nanobody, the fusion protein, the chimeric antigen receptor, the genetically modified cell or the antibody-drug conjugate or the pharmaceutical composition or a drug kit containing the same, for preventing and / or treating CD16A-mediated related diseases.

[0062] In some embodiments, the CD16A-mediated related diseases include tumors, infectious diseases and autoimmune diseases.

[0063] In some embodiments, the tumor includes solid tumors and hematological tumors.

[0064] In some specific embodiments, the tumor is selected from one or more of hemangioma, gastric cancer, liver cancer, lung cancer, breast cancer, colon cancer, nasopharyngeal cancer, bladder cancer, cervical cancer, prostate cancer, bone cancer, skin cancer, thyroid cancer, kidney cancer, esophageal cancer, melanoma, fibrosarcoma, rhabdomyosarcoma, astrocytoma, neuroblastoma and glioma.

[0065] In some specific embodiments, the autoimmune disease is selected from one or more of systemic lupus erythematosus, rheumatoid arthritis, systemic vasculitis, scleroderma, dermatomyositis, autoimmune hemolytic anemia, thyroid autoimmune disease, ulcerative colitis, chronic lymphocytic thyroiditis, hyperthyroidism, insulin-dependent diabetes mellitus, myasthenia gravis, ulcerative colitis, pernicious anemia with chronic atrophic gastritis, Goodpasture's syndrome, pemphigus vulgaris, pemphigoid, primary biliary cirrhosis, multiple sclerosis and acute idiopathic polyneuritis.

[0066] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0067] The reagents and raw materials used in the present invention are commercially available.

[0068] The positive and progressive effects of the present invention are:

[0069] The present invention provides a series of novel anti-CD16A nanoantibodies with specific binding and high affinity, which have the advantages of small molecular weight, good thermal stability, etc., are suitable for the development of bispecific antibodies, have great value in the treatment and diagnosis of diseases, and also have great development prospects in the antibody-targeted diagnosis and treatment of tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 The binding curve of CD16A single domain antibody Fc fusion protein to human CD16A (F176) detected by ELISA is shown.

[0071] Figure 2The binding curve of CD16A single domain antibody Fc fusion protein to human CD16A (V176) detected by ELISA is shown.

[0072] Figure 3 The ELISA shows the binding curve of CD16A single domain antibody Fc fusion protein to human CD16B.

[0073] Figure 4 The binding curve of CD16A single domain antibody Fc fusion protein to HEK293-huCD16A (F176) detected by FACS is shown.

[0074] Figure 5 The binding curve of CD16A single domain antibody Fc fusion protein to HEK293-huCD16B detected by FACS is shown.

[0075] Figure 6 The binding curve of the CD16A and FAP bispecific antibody to human CD16A (F176) detected by ELISA is shown.

[0076] Figure 7 The binding curve of the CD16A and ROR1 bispecific antibody to human CD16A (F176) detected by ELISA is shown.

[0077] Figure 8 The binding curve of the CD16A and FAP bispecific antibody to human CD16A (V176) detected by ELISA is shown.

[0078] Fig. 9 The binding curve of the CD16A and ROR1 bispecific antibody to human CD16A (V176) detected by ELISA is shown.

[0079] Fig.10 The binding curve of CD16A and FAP bispecific antibodies to human CD16B is shown by ELISA.

[0080] Fig.11 The binding curve of the CD16A and ROR1 bispecific antibody to human CD16B is shown by ELISA.

[0081] Fig.12 The binding curve of the CD16A and FAP bispecific antibody to human FAP detected by ELISA is shown.

[0082] Fig.13 The binding curve of the CD16A and ROR1 bispecific antibody to human ROR1 detected by ELISA is shown.

[0083] Fig.14The binding curve of CD16A and FAP bispecific antibody to HEK293-huCD16A(F176) detected by FACS is shown.

[0084] Fig.15 The binding curve of CD16A and ROR1 bispecific antibody to HEK293-huCD16A(F176) detected by FACS is shown.

[0085] Fig.16 The binding curve of CD16A and FAP bispecific antibody to HEK293-huCD16A(V176) detected by FACS is shown.

[0086] Fig.17 The binding curve of CD16A and ROR1 bispecific antibody to HEK293-huCD16A(V176) detected by FACS is shown.

[0087] Fig.18 The binding curves of CD16A and FAP bispecific antibodies to HEK293-huCD16B detected by FACS are shown.

[0088] Fig.19 The binding curve of CD16A and ROR1 bispecific antibody to HEK293-huCD16B detected by FACS is shown.

[0089] Fig. 20 The binding curve of CD16A and FAP bispecific antibody to CHO-K1-FAP detected by FACS is shown.

[0090] Fig.21 The binding curve of CD16A and ROR1 bispecific antibody to CHO-K1-ROR1 detected by FACS is shown. DETAILED DESCRIPTION

[0091] In order to better understand the present invention, some terms are first defined. Other definitions are listed throughout the detailed description.

[0092] The term "variable region" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to an antigen. VH and VL each contain four conserved framework regions (FRs) and three complementarity determining regions (CDRs). Among them, the term "complementarity determining region" or "CDR" refers to the region within the variable domain that primarily contributes to antigen binding; "framework" or "FR" refers to the variable domain residues other than the CDR residues. VH contains three CDR regions: HCDR1, HCDR2, and HCDR3; VL contains three CDR regions: LCDR1, LCDR2, and LCDR3. Each VH and VL consists of three CDRs and four FRs arranged from the amino terminus to the carboxyl terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0093] In the present invention, the scFv (single chain antibody fragment) VH domain and VL domain are connected by a linker (also called a connector) to form a polypeptide chain. The VL and VH domains are paired to form a monovalent molecule by a connector that enables them to be produced as a single polypeptide chain [see, for example, Bird et al., Science 242:423-426 (1988) and Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988)]. Such scFv molecules may have a general structure: NH2-VL-linker-VH-COOH or NH2-VH-linker-VL-COOH. Suitable prior art linkers are composed of repeated G4S amino acid sequences or variants thereof. For example, a linker having an amino acid sequence (G4S)4 or (G4S)3 may be used, but variants thereof may also be used.

[0094] The term "epitope" refers to an area (area or region) on an antigen that can specifically bind to an antibody. An epitope can be formed by a continuous string of amino acids (linear epitope) or contain non-continuous amino acids (conformational epitope), for example, due to the folding of the antigen (i.e., tertiary folding of the antigen by protein properties) and become spatially accessible. The difference between a conformational epitope and a linear epitope is that the binding of the antibody to the conformational epitope is lost in the presence of a denaturing solvent. The epitope contains at least 3, at least 4, at least 5, at least 6, at least 7, or 8-10 amino acids in a unique spatial conformation. Screening for antibodies that bind to a specific epitope (i.e., those that bind to the same epitope) can be performed using routine methods in the art, such as, but not limited to, alanine scanning, peptide blotting (see Meth. Mol. Biol. 248 (2004) 443-463).

[0095] The term "specific binding" refers to an antibody that binds to an antigen or an epitope within the antigen with a higher affinity than it does to other antigens or epitopes.-7 M or smaller (e.g., about 1×10 -8 M or smaller, about 1×10 - 9 M or smaller, about 1×10 -10 M or smaller, about 1×10 -11 M or smaller, or about 1×10 -12 In some embodiments, the antibody binds to the antigen with an equilibrium dissociation constant (KD) of 1.4 M or less. In some embodiments, the antibody binds to the antigen with a KD that is 10% or 1% of the KD of the antibody binding to a non-specific antigen (e.g., BSA, casein). The KD can be measured using standard procedures, such as by BIACORE® surface plasmon resonance assay. However, antibodies that specifically bind to an antigen or an epitope within an antigen may have cross-reactivity to other related antigens, for example, to the same antigen from other species (homologous) such as humans or monkeys, such as Macaca fascicularis (cynomolgus, cyno), chimpanzee (Pan troglodytes) (chimpanzee, chimp) or marmoset (Callithrix jacchus) (commonmarmoset, marmoset).

[0096] The term "affinity" refers to the overall strength of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise specified, as used herein, "affinity" refers to internal binding affinity, which reflects 1:1 interactions between members of a binding pair (e.g., an antibody and an antigen). The affinity of a molecule X to its ligand Y can generally be represented by a dissociation constant (KD). Affinity can be measured by conventional methods known in the art (including those described herein). The term "kassoc" or "ka" refers to the association rate of a specific antibody-antigen interaction, while the term "kdis" or "kd" as used herein refers to the dissociation rate of a specific antibody-antigen interaction. As used herein, the term "KD" refers to a dissociation constant, which is obtained from the ratio of kd to ka (i.e., kd / ka) and is expressed as a molar concentration (M). The KD value of an antibody can be determined using a well-established method in the art. Methods for determining antibody KD include measuring surface plasmon resonance using biosensing systems such as the ELISA system, or measuring affinity in solution by solution equilibrium titration (SET).

[0097] The term "EC50", also known as half maximal effect concentration, refers to the antibody concentration that causes 50% of the maximal effect.

[0098] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid connected thereto. One type of vector is a "plasmid", which refers to a circular double-stranded DNA loop in which another DNA segment can be connected. Another type of vector is a viral vector, in which an additional DNA segment can be connected to a viral genome. Some vectors can replicate autonomously in the host cell into which they are introduced (for example, a bacterial vector with a bacterial replication origin and an episomal mammalian vector). Other vectors (for example, non-additional mammalian vectors) can be integrated into the genome of the host cell after being introduced into the host cell, and thus replicated together with the host genome. In addition, some vectors can guide the expression of the genes to which they are effectively connected. This vector is referred to herein as a "recombinant expression vector" (or simply referred to as an "expression vector"). Generally, expression vectors useful in recombinant DNA technology are usually present in the form of plasmids. However, other forms of expression vectors are also included, such as viral vectors (for example, replication-defective retroviruses, adenoviruses and adeno-associated viruses), which play equivalent functions.

[0099] The term "nucleic acid molecule" or "nucleic acid" is intended to include DNA molecules and RNA molecules. The nucleic acid molecule can be single-stranded or double-stranded, and can be a cDNA.

[0100] The term "host cell" refers to a cell in which a vector can be propagated and its DNA can be expressed, which cell can be a prokaryotic cell or a eukaryotic cell. The term also includes any progeny of the subject host cell. It should be understood that not all progeny are identical to the parent cell, as mutations may occur during the replication process, and such progeny are included.

[0101] The term "purify" and its grammatical variations are used to refer to the complete or partial removal of at least one impurity from a mixture comprising a protein and one or more impurities, reducing the content of the impurity in the composition, thereby increasing the level of purification of the protein in the composition.

[0102] The terms "anti-human CD16A nanobody" and "antibody that specifically binds to human CD16A" refer to an antibody that can bind to human CD16A with sufficient affinity so that the antibody can be used as a diagnostic agent and / or therapeutic agent targeting human CD16A. In certain embodiments, the antibody that binds to human CD16A has a dissociation constant (KD) of < about 1 µM, < about 100 nM, < about 10 nM, < about 1 nM, < about 0.1 nM, < about 0.01 nM, or < about 0.001 nM (e.g., 10 -8 M or smaller, e.g. 10 -8 M to 10 -12 M, for example 10 -9 M to 10 -10M). In certain embodiments, the anti-human CD16A Nanobody binds to an antigenic epitope conserved in CD16A from different species.

[0103] The antibodies of the present invention include monoclonal antibodies (abbreviated as mAb or Ab), which refer to antibodies obtained from a single clonal cell line, and the cell line is not limited to eukaryotic, prokaryotic or phage clonal cell lines.

[0104] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0105] Example 1 Screening of heavy chain single domain antibodies against CD16A

[0106] 1.1 Construction of yeast immune library

[0107] Two alpacas were selected for immunization with CD16A protein (Acro cat: CD8-H52H4), and 50 mL of peripheral blood was collected after four, five, and six immunizations, and PBMCs were separated according to the instructions for lymphocyte separation fluid. Total RNA was extracted using an RNA extraction kit (MN cat: 740984), and the extracted RNA was reverse transcribed into cDNA using a kit from Novozymes (cat: C112-02-AA). The nanoantibody was amplified using nested PCR, and the specific process was as follows: In the first round of PCR, cDNA was used as a template to obtain a fragment of about 700 bp.

[0108] Upstream primer: GTCCTGGCTGCTCTTCTACAAAG (SEQ ID NO: 61)

[0109] Downstream primer: GGTACGTGCTGTTGAACTGTTC (SEQ ID NO: 62)

[0110] In the second round of PCR, the product of the first round of PCR was used as a template to obtain a VHH fragment of about 400 bp.

[0111] Upstream primer: TCGCGGCCCAGCCGGCCCAGGTCCAACTGCAGGAGTCTGGGG (SEQ ID NO: 63)

[0112] Downstream primer: ATAAGAATGCGGCCGCTGAGGAGACGGTGACCTGGGTCCC (SEQ ID NO: 64)

[0113] The recovered heavy chain single domain antibody nucleic acid fragment and the linearized pYD2 vector fragment were electroporated into yeast cells EBY100, and after recovery, gradient dilution and plating were performed. The calculated reservoir size was 4.45x10 8 .

[0114] 1.2 Screening of heavy chain single domain antibodies

[0115] Since the homology of CD16A and CD16B is as high as 94%, in order to obtain nanobodies that specifically bind to CD16A (F176) and (V176), we performed multiple sorting. In the first round, magnetic beads and CD16B negative sorting were performed. 300nM biotin-CD16B (Acro cat: CDB-H82Ea) and magnetic beads (Invitrogen Cat: 11206D) were incubated for 1 hour, and magnetic bead sorting was performed to remove yeast cells that bind to CD16B. The second round of positive sorting was performed to collect yeast cell populations that specifically bind to CD16A: 300nM biotin-CD16A (F176) (Acro cat: CDA-H82E8) and 300nM biotin-CD16A (V176) (Acro cat: The two proteins (biotin-CDA-H82E9) were incubated with SA-APC and SA-PE respectively, mixed together in proportion, added to the yeast library for incubation for 1 hour, and sorted and collected by Moflo XDP ultraspeed flow sorter; in the third round, 300nM biotin-CD16B was used for negative sorting, and the yeast cell population that did not bind to CD16B was collected by flow cytometry; in the fourth round, 100nM biotin-CD16A (V176) and 300nM biotin-CD16B were incubated with SA-APC and SA-PE respectively for 1h, mixed together in proportion, added to the yeast library and incubated for another 1 hour, and then the CD16A-positive yeast cell population was collected by flow sorting and plated, and the monoclonal culture was sent for sequencing and flow identification. After sequence alignment, a total of 4 nanoantibodies that specifically bind to human CD16A were finally obtained.

[0116] Example 2. Preparation of CD16A single domain antibody FC fusion protein

[0117] The sequence of the CD16A single-domain antibody molecule and the publicly published heavy chain constant region sequence of the human monoclonal antibody IgG1 subclass were spliced ​​together and constructed into a mammalian cell expression vector; HEK293 cells were transfected with polyethyleneimine (PEI), and the cell supernatant was collected after about 7 days and purified using protein A magnetic beads (GenScript Cat: L00695) to obtain the anti-human CD16A heavy chain single-domain antibody FC fusion protein.

[0118] Example 3. Preparation of CD16A antibody from AFFIMED

[0119] The antibody sequence of CD16A of AFFIMED was obtained from patent WO2016177846A1, and the heavy chain or light chain constant region sequence of the publicly published human monoclonal antibody IgG1 subclass was used. The variable region and constant region sequences were connected and constructed into a mammalian expression vector to prepare a plasmid, which was transiently transfected and expressed in HEK293 cells. The obtained anti-CD16A antibody of AFFIMED was renamed Ref-Ab.

[0120] Example 4. ELISA to detect the binding activity of single domain antibody FC fusion protein and human CD16A and CD16B

[0121] The three proteins of human CD16A (F176) (Acro cat: CDA-H82E8), human CD16A (V176) (Acro cat: CDA-H82E9), and human CD16B (Acro cat: CDB-H82Ea) were diluted to 1ug / mL with PBS buffer, and 100µl was coated on each well of a 96-well plate, incubated at 4℃ overnight, washed three times with PBST the next day, blocked with PBST+1% BSA, 250ul / well, 37℃, 1hr; the CD16A single domain antibody Fc fusion protein screened above was diluted with a starting concentration of 12.5nM, 4-fold gradient dilution, 100ul / well, 37℃, 1hr; HRP-goat anti-human IgG (Fcγ) diluted 1:20000 was added, 37℃, 1hr; after washing with PBST, TMB colorimetric solution was added, color was developed for 10-15min in the dark, and 2M The reaction was terminated with HCL; the absorbance at 450 nm was detected by MD microplate reader. The EC50 was calculated by the absorbance value using prism software. The results showed that the four CD16A single domain antibody Fc fusion proteins had high affinity with human CD16A (F176) and (V176) ( Figure 1 , Figure 2 ), among which NB465-20, 14 and 10 had no binding signal with human CD16B ( Figure 3 ), compared with Ref-Ab, NB465-20, 14 and 10 all have specific binding activity to human CD16A, and their affinity to human CD16A is significantly higher than that of the control molecule Ref-Ab.

[0122] Example 5. In vitro kinetic binding experiment of single domain antibody FC fusion protein

[0123] The antibody affinity was determined by the anti-human antibody capture method using the Fortebio (BLITZ pro1.1.0.28) instrument. During the determination, the anti-human antibody Fc segment capture antibody (AHC) bioprobe was soaked in KB buffer for 10 minutes; the antibody sample was diluted to 200nM, 200μl / well, loaded on the AHC bioprobe, and then balanced in KB buffer for 100s. The AHC probe was further combined with four CD16 proteins, namely human CD16A (F176), human CD16A (V176), human CD16B and cyno CD16A at different concentrations, with a binding time of 180s. After that, the AHC probe was transferred to KB buffer for a dissociation reaction for 360s. After the experiment, the blank control response value was deducted, and the software was used to perform 1:1 Langmuir binding mode fitting and calculate the kinetic constants of antigen-antibody binding. The results are shown in Tables 1 to 4. NB465-20, 14, and 10 all had specific binding activity with human CD16A (F176), human CD16A (V176), and cyno CD16A. Compared with Ref-Ab, the response value of NB465-20 molecule was higher; there was no binding signal between the three molecules and Ref-Ab and CD16B, providing a basis for subsequent experiments.

[0124] Table 1: shows the affinity analysis results of CD16A single domain antibody FC fusion protein to human CD16A (F176) extracellular domain recombinant protein

[0125]

[0126] Table 2: Affinity analysis results of CD16A single domain antibody FC fusion protein to human CD16A (V176) extracellular domain recombinant protein

[0127]

[0128] Table 3: Affinity analysis results of CD16A single domain antibody Fc fusion protein to monkey CD16A extracellular domain recombinant protein

[0129]

[0130] Table 4: shows the affinity analysis results of CD16A single domain antibody FC fusion protein to human CD16B extracellular domain recombinant protein

[0131]

[0132] Example 6. In vitro cell binding assay of single domain antibody FC fusion protein

[0133] The genes of human CD16A (F176) (sequence number: P08637) and CD16B (sequence number: O75015) were constructed into mammalian expression vectors and plasmids were prepared. The plasmids were transiently transfected into HEK293 cells for expression by PEI. After 2 days, the cells were collected and centrifuged at 100g for 5 minutes at room temperature. The cells were washed once with PBS containing 0.5% BSA, centrifuged at 100g for 5 minutes at room temperature, and the cells were resuspended at a density of 2x10 per ml. 6 cells, 50ul / well was plated, and blank HEK293 cells were used as blank controls. Then the single-domain antibody FC fusion protein was diluted 3 times from the starting concentration of 33nM, with a total of 11 concentration points. 50ul of the antibody at each concentration point was added to a 96-well plate. After incubation at room temperature for 1 hour, wash twice, and add a 1:2000 diluted APC fluorescent-labeled goat anti-human IgG secondary antibody (Jackson Cat: 109-135-098); continue to incubate at room temperature for 1 hour, wash twice, and analyze the average fluorescence reading of the cell population by flow cytometry, and use prism software to perform a 4-parameter fitting curve. The experimental results show that NB465-20, NB465-14, NB465-10 and Ref-Ab all have specific binding activity with human CD16A expressed on the cell surface ( Figure 4 The results of NB465-14 are shown in Figure 2). There is no nonspecific binding signal with HEK293 blank cells. Compared with Ref-Ab, the binding signal of NB465-14 molecule with human CD16B expressed on the cell surface is weaker than that of the control molecule ( Figure 5 ).

[0134] Example 7. Preparation of single domain antibodies

[0135] Single domain antibodies were prepared, a histidine tag was added to the C-terminus of the CD16A single domain antibody to facilitate antibody purification, and an irrelevant control NC-VHH-His was produced at the same time. The heavy chain variable region and light chain variable region of the control antibody Ref-Ab were connected by a flexible peptide in the form of Scfv, and then constructed into a mammalian cell expression vector. HEK293 cells were transfected with polyethyleneimine (PEI), and the cell supernatant was collected after about 7 days. The single domain antibody VHH-His and the control antibody Ref-Ab-scfv-His were purified using a nickel column.

[0136] Example 8. In vitro kinetic binding experiments of single domain antibodies

[0137] The affinity of single-domain antibodies was determined using the Fortebio (BLITZ pro1.1.0.28) instrument. During the determination, the anti-SA sensor was immersed in KB buffer for 10 minutes; the four biotinylated proteins CD16A (F176), human CD16A (V176), human CD16B and cyno CD16A were diluted to 300nM with KB buffer, loaded onto the SA sensor bioprobe, and then balanced in KB buffer for 100s. The SA sensor was further bound to 100nM single-domain antibodies for 180s, and then the SA sensor probe was transferred to KB buffer for a dissociation reaction for 360s. After the experiment, Fortebio's Data analysis 10.0 was used to process the data. The results are shown in Tables 5 to 8. NB465-20, 14 and 10 and Ref-Ab all had binding activity with human CD16A (F176) and human CD16A (V176). NB465-20 and Ref-Ab had binding activity with cynoCD16A, but NB465-14 and 10 had no binding signals with cynoCD16A. NB465-20, 14 and 10 had no binding signals with CD16B, but Ref-Ab had obvious binding signals with CD16B, indicating that NB465-20, 14 and 10 molecules can specifically bind to CD16A better than the control molecules.

[0138] Table 5: shows the affinity analysis results of CD16A single domain antibody to human CD16A (F176) extracellular domain recombinant protein

[0139]

[0140] Table 6: Affinity analysis results of CD16A single domain antibody to human CD16A (V176) extracellular domain recombinant protein

[0141]

[0142] Table 7: Affinity analysis results of CD16A single domain antibody to monkey CD16A extracellular domain recombinant protein

[0143]

[0144] Table 8: shows the affinity analysis results of CD16A single domain antibody to human CD16B extracellular domain recombinant protein

[0145]

[0146] Example 9. Preparation of bispecific antibodies

[0147] Two anti-CD16A nanoantibody molecules NB465-20 and NB465-14 were selected for fusion expression with anti-FAP D27hz10 (proposal number: D2300027) and anti-ROR1 N27hz20 molecules (proposal number: D2300033), respectively. The molecular form was: VHH-hFC-3*G4S-Scfv. The specific operation was: using flexible polypeptide (GGGGS) 3 to connect the anti-CD16A nanoantibodies NB465-20-FC and NB465-14-FC with the Scfv of anti-FAP D27hz10 and anti-ROR1 N27hz20, respectively, and set up monoclonal antibody controls at the same time, and construct all antibody sequences into mammalian cell expression vectors; HEK293 cells were transfected with polyethyleneimine (PEI), and the cell supernatant was collected about 7 days later, and the antibody protein was purified using protein A magnetic beads (GenScript Cat: L00695).

[0148] Example 10. ELISA to detect the binding activity of bispecific antibodies

[0149] Human CD16A (F176) (Acro cat: CDA-H82E8), human CD16A (V176) (Acro cat: CDA-H82E9), human CD16B (Acro cat: CDB-H82Ea), human FAP (Acro cat: Five proteins, FAP-H5244) and human ROR1 (Acrocat:RO1-H522y), were diluted to 1ug / mL with PBS buffer, 100µl per well was coated on a 96-well plate, incubated overnight at 4°C, washed three times with PBST the next day, blocked with PBST+1% BSA, 250ul / well, 37°C, 1hr; the prepared bispecific antibody was diluted, with a starting concentration of 50nM, 4-fold gradient dilution, and a negative control SH-hIgG (LALA) was set at 100ul / well, 37°C, 1hr; 1:20000 diluted HRP-goat anti-human IgG (Fcγ) was added, 37°C, 1hr; after washing with PBST, TMB colorimetric solution was added, color was developed in the dark for 10-15min, and 2M HCL was added to terminate the reaction; the absorbance at 450nm was detected by an MD microplate reader. The EC50 was calculated using the prism software based on the absorbance value (see Figure 6-Figure 13 ).

[0150] The results showed (see Figure 6-Figure 13), the binding activity of the bispecific antibody molecules against CD16A and FAP to huCD16A was comparable to that of the monoclonal antibody, but the binding activity of the bispecific antibody molecules of the control antibody to huCD16A was significantly lower than that of the monoclonal antibody molecules, about 10 times; only the NB465-14-Fc-D27hz10-Scfv bispecific antibody molecule had a weak binding signal with huCD16B at high concentrations, and the other molecules had no binding signals. The binding signal of the bispecific antibody molecules to huFAP was lower than that of the monoclonal antibody molecules, and the monoclonal antibody molecules of CD16A had no non-specific binding to the FAP antigen.

[0151] The results showed that the binding activity of the bispecific antibody molecules against CD16A and ROR1 to huCD16A was slightly better than that of the monoclonal antibody, but the binding activity of the bispecific antibody molecules against the control antibody to huCD16A was significantly lower than that of the monoclonal antibody molecules; there was no binding signal between the bispecific antibody molecules and huCD16B; the binding signal of the bispecific antibody molecules to huROR1 was slightly lower than that of the monoclonal antibody molecules; there was no non-specific binding between the CD16A monoclonal antibody molecules and the ROR1 antigen.

[0152] Example 11. FACS detection of binding activity of bispecific antibodies

[0153] The genes of human CD16A (F176) (sequence number: P08637), human CD16A (V176) (sequence number: P08637) and CD16B (sequence number: O75015) were constructed into mammalian expression vectors and plasmids were prepared. The plasmids were transiently transfected into HEK293 cells by PEI for expression. The cells were collected after 2 days. At the same time, CH0 K1 stable transfection cell lines with high expression of human FAP and human ROR1 on the cell surface were prepared. The cells were centrifuged at 100g for 5 minutes at room temperature, washed once with PBS containing 0.5% BSA, and resuspended at a cell density of 2x10 per ml. 6 cells, 50ul / well was plated, and negative control SH-hIgG (LALA) was set up at the same time. Then the bispecific antibody was diluted 3 times from the starting concentration of 100nM, with a total of 11 concentration points. 50ul of the antibody at each concentration point was added to a 96-well plate. After incubation at room temperature for 1 hour, it was washed twice, and a 1:2000 diluted APC fluorescent-labeled goat anti-human IgG secondary antibody (Jackson Cat: 109-135-098) was added; it was continued to be incubated at room temperature for 1 hour, washed twice, and the average fluorescence reading of the cell population was analyzed by flow cytometry, and prism software was used to perform a 4-parameter fitting curve.

[0154] Experimental results ( Figure 14-Figure 21) showed that the bispecific antibodies against CD16A and FAP as well as CD16 and ROR1 all had specific binding activity with human CD16A expressed on the cell surface, among which the binding activity of the bispecific antibody molecule of NB465-20 with human CD16A was higher than that of the control molecule and the monoclonal antibody molecule, and the six bispecific antibody molecules had weak binding signals with human CD16B expressed on the cell surface at high concentrations.

[0155] Example 12. In vitro kinetic binding experiments of bispecific antibodies

[0156] The antibody affinity was determined by the anti-human antibody capture method using the Fortebio (BLITZ pro1.1.0.28) instrument. During the measurement, the capture antibody (AHC) bioprobe of the anti-human antibody Fc segment was immersed in KB buffer for 10 minutes; the antibody sample was diluted to 200nM, 200μl / well, loaded onto the AHC bioprobe, and then equilibrated in KB buffer for 100s. The AHC probe was further combined with 5 antigens, namely different concentrations of human CD16A (F176), human CD16A (V176), human CD16B, human FAP and human ROR1, with a binding time of 180s. After that, the AHC probe was transferred to KB buffer for a dissociation reaction of 360s. After the experiment was completed, the blank control response value was deducted, and the software was used to perform a 1:1 Langmuir binding mode fitting to calculate the kinetic constants of antigen-antibody binding.

[0157] The results are shown in Tables 9 and 10. The bispecific antibody molecules against CD16A and FAP have specific binding activity with human CD16A, and the affinity is better than that of the control molecules. All molecules do not bind to human CD16B. The bispecific antibody molecules have high binding activity with human FAP. The bispecific antibody molecules against CD16A and ROR have specific binding activity with human CD16A, and the affinity is better than that of the control molecules. They do not bind to human CD16B. The bispecific antibody molecules have high binding activity with human ROR1.

[0158] Table 9: Affinity analysis results showing bispecific antibodies to CD16A and FAP

[0159]

[0160] Table 10: Affinity analysis results of bispecific antibodies for CD16A and ROR1 are shown

[0161]

[0162] Sequence Listing (where CDR definitions are based on IMGT)

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176] Although the specific embodiments of the present invention are described above, it should be understood by those skilled in the art that these are only examples, and various changes or modifications may be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the protection scope of the present invention is limited by the appended claims.

Claims

1. An anti-CD16A nanobody, characterized in that: The nanobody comprises at least one VHH chain, wherein the VHH chain comprises CDR1, CDR2, and CDR3. Wherein, the amino acid sequence of CDR1 is shown in SEQ ID NO: 2, the amino acid sequence of CDR2 is shown in SEQ ID NO: 3, and the amino acid sequence of CDR3 is shown in SEQ ID NO: 4; Or, the amino acid sequence of CDR1 is shown as SEQ ID NO: 10, the amino acid sequence of CDR2 is shown as SEQ ID NO: 11, and the amino acid sequence of CDR3 is shown as SEQ ID NO:

12.

2. The anti-CD16A nanobody according to claim 1, characterized in that The VHH chain comprises FR1, FR2, FR3 and FR4, The amino acid sequence of FR1 is shown in SEQ ID NO: 5, the amino acid sequence of FR2 is shown in SEQ ID NO: 6, the amino acid sequence of FR3 is shown in SEQ ID NO: 7, and the amino acid sequence of FR4 is shown in SEQ ID NO: 8; Or, the amino acid sequence of FR1 is shown in SEQ ID NO: 13, the amino acid sequence of FR2 is shown in SEQ ID NO: 14, the amino acid sequence of FR3 is shown in SEQ ID NO: 15, and the amino acid sequence of FR4 is shown in SEQ ID NO: 16; Or, the amino acid sequence of FR1 is shown in SEQ ID NO: 18, the amino acid sequence of FR2 is shown in SEQ ID NO: 14, the amino acid sequence of FR3 is shown in SEQ ID NO: 15, and the amino acid sequence of FR4 is shown in SEQ ID NO:

8.

3. The anti-CD16A nanobody according to claim 1 or 2, characterized in that The VHH chain comprises an amino acid sequence as shown in any one of SEQ ID NO: 1, SEQ ID NO: 9 or SEQ ID NO: 17 or a variant thereof; The variant has at least 80% sequence identity with the sequence from which it is derived and has the function of targeting CD16A.

4. An isolated nucleic acid, characterized in that The nucleic acid encodes the anti-CD16A nanobody as described in any one of claims 1-3.

5. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the nucleic acid according to claim 4; Preferably, the recombinant expression vector is selected from: a viral vector and a non-viral vector; More preferably, the non-viral vector is selected from the group consisting of: a plasmid, a linear DNA fragment, and RNA; The recombinant expression vector is, for example, a plasmid, and the backbone of the plasmid is, for example, pcDNA3.

4.

6. A host cell, characterized in that The host cell comprises the nucleic acid of claim 4 or the recombinant expression vector of claim 5; Preferably, the host cell is a prokaryotic cell or a eukaryotic cell; More preferably, the eukaryotic cell is a yeast cell or a mammalian cell; wherein the mammalian cell is, for example, a HEK293 cell.

7. A method for preparing an anti-CD16A nanobody, characterized in that: The method comprises the following steps: The host cell is cultured under conditions suitable for growth and fermentation of the host cell as claimed in claim 6, and the anti-CD16A nanobody is obtained from the culture.

8. A fusion protein, characterized in that It comprises the anti-CD16A nanobody according to any one of claims 1 to 3, and: Fc derived from the heavy chain constant region of IgG1, IgG2, IgG3 or IgG4; Preferably, it further comprises an antigen binding molecule having another antigen binding property which is operably linked to the fusion protein; the antigen binding molecule is preferably linked to the C-terminus of the Fc.

9. The fusion protein according to claim 8, characterized in that The connection is achieved through a linker. Preferably, the linker is (G4S) n , wherein n is preferably 1-3, more preferably 3.

10. The fusion protein according to claim 8 or 9, characterized in that The antigen binding molecule comprises a heavy chain variable region and a light chain variable region, The heavy chain variable region comprises: HCDR1 with an amino acid sequence as shown in SEQ ID NO: 43, HCDR2 with an amino acid sequence as shown in SEQ ID NO: 45, and HCDR3 with an amino acid sequence as shown in SEQ ID NO: 47; the light chain variable region comprises LCDR1 with an amino acid sequence as shown in SEQ ID NO: 35, LCDR2 with an amino acid sequence of YA, and LCDR3 with an amino acid sequence as shown in SEQ ID NO: 39; Or, the heavy chain variable region comprises HCDR1 with an amino acid sequence as shown in SEQ ID NO: 50, HCDR2 with an amino acid sequence as shown in SEQ ID NO: 52, and HCDR3 with an amino acid sequence as shown in SEQ ID NO: 54; the light chain variable region comprises LCDR1 with an amino acid sequence as shown in SEQ ID NO: 57, LCDR2 with an amino acid sequence of DA, and LCDR3 with an amino acid sequence as shown in SEQ ID NO: 60; Preferably, The antigen binding molecule is selected from the following: (1) the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO: 41; the light chain variable region comprises the amino acid sequence shown in SEQ ID NO: 33; (2) the heavy chain variable region comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 41; the light chain variable region comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 33; (3) the heavy chain variable region comprises the amino acid sequence shown in SEQ ID NO: 48; the light chain variable region comprises the amino acid sequence shown in SEQ ID NO: 55; (4) the heavy chain variable region comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 48; the light chain variable region comprises an amino acid sequence having at least 80% sequence identity to SEQ ID NO: 55; More preferably, The fusion protein comprises an amino acid sequence as shown in any one of SEQ ID NOs: 25-26 or SEQ ID NOs: 28-29 or a variant thereof; wherein the variant has at least 80% sequence identity compared to the sequence from which it is derived, and has the function of targeting CD16A and "FAP or ROR1".

11. A chimeric antigen receptor, characterized in that The chimeric antigen receptor comprises (a) an antigen binding domain, which includes the anti-CD16A nanobody according to any one of claims 1 to 3 or the fusion protein according to claim 8 or 9; Preferably, the chimeric antigen receptor further comprises: (b) a hinge domain; (c) a transmembrane domain; (d) a co-stimulatory intracellular domain; (e) a signaling domain and (f) a signal peptide.

12. A genetically modified cell, characterized in that It comprises the chimeric antigen receptor as claimed in claim 11; preferably, the host of the genetically modified cell is a T cell or a NK cell.

13. An antibody-drug conjugate, characterized in that: The antibody-drug conjugate comprises a cytotoxic agent or a label, and the anti-CD16A nanobody according to any one of claims 1 to 3 or the fusion protein according to any one of claims 8 to 10.

14. A pharmaceutical composition or a kit containing the same, characterized in that: The pharmaceutical composition or the drug kit containing the same comprises the anti-CD16A nanobody according to any one of claims 1 to 3, the fusion protein according to any one of claims 8 to 10, the chimeric antigen receptor according to claim 11, the genetically modified cell according to claim 12 or the antibody-drug conjugate according to claim 13, and at least one of a pharmaceutically acceptable carrier, excipient or diluent; Preferably, the pharmaceutical composition or the kit containing the same further contains one or more of the group consisting of hormone preparations, targeted small molecule preparations, proteasome inhibitors, imaging agents, diagnostic agents, chemotherapeutic agents, oncolytic drugs, cytotoxic agents, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules and vaccines.

15. Use of the anti-CD16A nanobody according to any one of claims 1 to 3, the fusion protein according to any one of claims 8 to 10, the chimeric antigen receptor according to claim 11, the genetically modified cell according to claim 12, or the antibody-drug conjugate according to claim 13, or the pharmaceutical composition according to claim 14, or a kit containing the same, in the preparation of a drug for preventing and / or treating CD16A-mediated related diseases; Preferably, the CD16A-mediated related diseases include tumors, infectious diseases and autoimmune diseases; More preferably, the tumor includes solid tumors and hematological tumors, and the tumor is preferably selected from one or more of hemangioma, gastric cancer, liver cancer, lung cancer, breast cancer, colon cancer, nasopharyngeal cancer, bladder cancer, cervical cancer, prostate cancer, bone cancer, skin cancer, thyroid cancer, kidney cancer, esophageal cancer, melanoma, fibrosarcoma, rhabdomyosarcoma, astrocytoma, neuroblastoma and glioma; and / or The autoimmune disease is selected from one or more of systemic lupus erythematosus, rheumatoid arthritis, systemic vasculitis, scleroderma, dermatomyositis, autoimmune hemolytic anemia, thyroid autoimmune disease, ulcerative colitis, chronic lymphocytic thyroiditis, hyperthyroidism, insulin-dependent diabetes mellitus, myasthenia gravis, ulcerative colitis, pernicious anemia with chronic atrophic gastritis, Goodpasture's syndrome, pemphigus vulgaris, pemphigoid, primary biliary cirrhosis, multiple sclerosis and acute idiopathic polyneuritis.

Images