Gene editing disease-resistant pig molecular feature detection method and application

Abstract

The invention discloses a gene editing disease-resistant pig molecular feature detection method and application. The invention provides a CRISPR / Cas12a nucleic acid detection system. The CRISPR / Cas12a nucleic acid detection system comprises a nucleic acid detection system 1, the nucleic acid detection system 1 comprises crRNA1; the nucleotide sequence of the crRNA1 is as shown in SEQ ID NO. 11. The invention provides a CRISPR / Cas12a system-based detection method for AE26-CAAS gene editing disease-resistant pigs, which is high in sensitivity, strong in specificity, simple, convenient, feasible, convenient for on-site rapid detection, economical, simple, convenient, efficient and rapid, and lays a foundation for commercial production of gene editing disease-resistant pigs.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a method for detecting molecular characteristics of gene-edited disease-resistant pigs and its application. Background Art

[0002] Gene editing breeding is one of the future development directions of animal breeding. The United States, Japan and other countries have approved the listing of a variety of gene-edited animals, including GalSafe gene-edited pigs, Madai red snapper, 22-seiki fugu tiger pufferfish, and PRLR-SLICK gene-edited cattle. The pAPN protein of pigs is the key receptor for transmissible gastroenteritis virus (TGEV) to enter cells. Knocking out or editing the pAPN gene can make pigs completely resistant to TGEV. At present, many teams at home and abroad have successfully prepared pAPN gene-edited pigs, and virus challenge experiments have confirmed that pAPN gene editing can completely resist TGEV infection.

[0003] The AE26-CAAS gene-edited pig was obtained through gene editing technology. After genetic modification, the pAPN gene of this pig had a 26 bp base deletion in the second exon, which caused the pAPN gene to terminate translation prematurely and could not produce functional APN protein, thereby achieving resistance to porcine transmissible gastroenteritis TGEV virus.

[0004] Nucleic acid testing of gene-edited animals is a prerequisite for the supervision, management and industrialization of gene-edited animals and their products. Therefore, it is necessary to find a rapid method for detecting AE26-CAAS gene-edited disease-resistant pigs. Summary of the invention

[0005] The technical problem solved by the present invention is how to quickly and accurately detect AE26-CAAS gene-edited disease-resistant pigs.

[0006] In order to solve the above technical problems, the present invention provides a crRNA group in a first aspect, which includes crRNA1, The nucleotide sequence of the crRNA1 binding target is SEQ ID NO.2.

[0007] The above crRNA group targets the pAPN gene.

[0008] In the crRNA group described above, the crRNA1 is transcribed in vitro from transcription template 1; The transcription template 1 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.5 and the single-stranded DNA molecule shown in SEQ ID NO.8.

[0009] In the crRNA group described above, the nucleotide sequence of crRNA1 is SEQ ID NO.11.

[0010] In the crRNA group described above, the crRNA also includes crRNA2, The nucleotide sequence of the crRNA2 binding target is SEQ ID NO.3.

[0011] In the crRNA group described above, the crRNA2 is transcribed in vitro from transcription template 2; The transcription template 2 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.6 and the single-stranded DNA molecule shown in SEQ ID NO.9.

[0012] In the crRNA group described above, the nucleotide sequence of crRNA2 is SEQ ID NO.12.

[0013] In a second aspect, the present invention provides a product, comprising the crRNA1, Cas12a protein, a primer pair for specifically amplifying each binding target, and a single-stranded DNA probe described in the first aspect; Or, the product includes the crRNA1 and crRNA2 described in the first aspect, Cas12a protein, a primer pair for specific amplification of each binding target, and a single-stranded DNA probe; And / or, the two ends of the single-stranded DNA probe are respectively labeled with different groups; And / or, the group is a fluorescent group, a quenching group and / or biotin.

[0014] The single-stranded DNA probe is a single-stranded DNA rich in AT bases with a length of 10-50 nt.

[0015] The above-mentioned single-stranded DNA probe can be specifically as follows: The two ends of the single-stranded DNA probe used for fluorescence detection are labeled with a fluorescent group and a quenching group respectively; The single-stranded DNA probe used for test strip detection is labeled with a fluorescent group and biotin at both ends.

[0016] In the product described above, the primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO.13 and a single-stranded DNA molecule shown in SEQ ID NO.14; The products described above are test kits, test strips or fluorescence detection systems.

[0017] The product has any of the following functions: B1) Identify or assist in identifying AE26-CAAS gene-edited pigs; B2) Identify or assist in identifying whether the sample to be tested contains the AE26-CAAS gene editing sequence; B3) Identify or assist in identifying the genotype of AE26-CAAS gene-edited pigs.

[0018] In a third aspect, the present invention provides any of the following substances: A1) the Cas12a protein and the crRNA described in the second aspect, or a complex formed by the two; A2) the Cas12a protein, the crRNA1 and the crRNA2 described in the second aspect, or a complex group formed by each of them and the Cas12a protein; A2) The primer pair described in the second aspect.

[0019] In a fourth aspect, the present invention provides the use of the crRNA described in the first aspect and the product described in the second aspect in any of the following: B1) Identify or assist in identifying AE26-CAAS gene-edited pigs; B2) Identify or assist in identifying whether the sample to be tested contains the AE26-CAAS gene editing sequence; B3) Identify or assist in identifying the genotype of AE26-CAAS gene-edited pigs; B4) Prepare products to identify or assist in identifying AE26-CAAS gene-edited pigs; B5) Prepare products for identification or auxiliary identification of whether the sample to be tested contains the AE26-CAAS gene editing sequence; B6) Prepare products for identifying or assisting in identifying the genotype of AE26-CAAS gene-edited pigs.

[0020] In a fifth aspect, the present invention provides a method for identifying or assisting in identifying AE26-CAAS gene-edited pigs, comprising the following steps: C1) using the nucleic acid of the sample to be tested as a template, and performing RPA amplification using the primer pair described in the second aspect to obtain an RPA amplification product; C2) preparing a CRISPR-Cas12a detection system containing the following components: the PCR product, the Cas12a protein described in the second aspect, the crRNA1 in the crRNA described in the second aspect, and the single-stranded DNA probe described in the second aspect; C3) reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying or assisting in identifying the AE26-CAAS gene-edited pig; In an embodiment of the present invention, In the above, the detection reaction product is used to identify or assist in identifying the AE26-CAAS gene-edited pig as E or F as follows: E. Detect the fluorescence intensity of each reaction product using a fluorescence detection instrument such as an enzyme-labeled instrument or a fluorescence quantitative PCR instrument: If the fluorescence intensity of the reaction product of the detection system is extremely significant ( P <0.01) is higher than the reaction product of the negative control system, then the sample to be tested is derived from or is a candidate for being derived from the AE26-CAAS gene-edited pig; if the fluorescence intensity of the reaction product of the detection system 1 is not significant ( P >0.05) is higher than the reaction product of the negative control system, then the sample to be tested does not originate from or the candidate does not originate from the AE26-CAAS gene-edited pig; the negative control system differs from the detection system only in that crRNA1 is not added; F. Each reaction product is tested with colloidal gold test strips (Cas12 / 13 special nucleic acid colloidal gold test strips (JY0301) Beijing Libo Taiye Technology Co., Ltd.): If both the T and C lines detected by the reaction product of the detection system are colored or only the T line is colored (positive), the sample to be tested is derived from or may be derived from the AE26-CAAS gene-edited pig; if the C line detected by the reaction product of the detection system 1 is colored and the T line is not colored (negative), the sample to be tested is not derived from or may not be derived from the AE26-CAAS gene-edited pig.

[0021] In a sixth aspect, the present invention provides a method for identifying or assisting in identifying the genotype of an AE26-CAAS gene-edited pig, comprising the following steps: D1) using the nucleic acid of the sample to be tested as a template, and performing RPA amplification with the primer pair described in the second aspect to obtain an RPA amplification product; D2) preparing CRISPR-Cas12a detection system 1 and CRISPR-Cas12a detection system 2 containing the following components; The CRISPR-Cas12a detection system 1 includes the PCR product, the Cas12a protein described in the second aspect, the crRNA1 in the crRNA described in the second aspect, and the single-stranded DNA probe in the second aspect; The CRISPR-Cas12a detection system 2 includes the PCR product, the Cas12a protein described in the second aspect, the crRNA2 in the crRNA described in the second aspect, and the single-stranded DNA probe in the second aspect; D3) The CRISPR-Cas12a detection system 1 and the CRISPR-Cas12a detection system 2 are reacted separately, and the reaction products of the two systems are detected to identify or assist in identifying the genotype of the AE26-CAAS gene-edited pig.

[0022] In the above, the reaction product identification or auxiliary identification of the AE26-CAAS gene-edited pig genotype can be detected by colloidal gold test strips (Cas12 / 13 special nucleic acid colloidal gold test strips (JY0301) Beijing Libo Taiye Technology Co., Ltd.), as follows: If the reaction product of the detection system 1 detects that both the T and C lines are colored or only the T line is colored (positive), and the reaction product of the detection system 2 detects that the C line is colored and the T line is not colored (negative), then the sample to be tested is derived from or is a candidate for being derived from the AE26-CAAS gene-edited pig homozygote; If the reaction product of the detection system 1 detects that both the T and C lines are colored or only the T line is colored (positive), and the reaction product of the detection system 2 detects that both the T and C lines are colored or only the T line is colored (positive), then the sample to be tested originates from or is candidate to originate from the AE26-CAAS gene-edited pig heterozygote.

[0023] In the above, the sample to be tested is the ear or other tissue of the pig to be tested.

[0024] The method is for non-disease diagnosis and treatment purposes.

[0025] The experiments of the present invention have proved that the present invention provides a detection method for AE26-CAAS gene-edited disease-resistant pigs based on the CRISPR / Cas12a system, which has high sensitivity, strong specificity, is simple and easy to use, is convenient for rapid on-site detection, and is economical, simple, efficient and fast, laying the foundation for the commercial production of gene-edited disease-resistant pigs. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Standard plasmid sequencing results for AE26-CAAS gene-edited pigs and pAPN gene wild-type pigs.

[0027] Figure 2 The results of RPA primer amplification are shown in Figure 2.

[0028] Figure 3 The results of crRNA activity detection targeting AE26-CAAS gene editing of pig pAPN gene sequence. ** indicates a significant difference compared with the negative control group ( P <0.01), ns means there is no significant difference compared with the negative control group ( P >0.05).

[0029] Figure 4 The results of crRNA activity detection targeting the WT pig pAPN gene sequence. ** indicates a very significant difference compared with the negative control group ( P <0.01), ns means there is no significant difference compared with the negative control group ( P >0.05).

[0030] Figure 5 RPA amplification sensitivity results for targeting AE26-CAAS gene editing of porcine pAPN gene sequences.

[0031] Figure 6 The sensitivity results of RPA amplification targeting the WT pig pAPN gene sequence.

[0032] Figure 7 The fluorescence detection sensitivity results of the porcine pAPN gene sequence targeted by pAE26-CAAS gene editing. ** indicates a significant difference compared with the negative control group ( P <0.01), ns means there is no significant difference compared with the negative control group ( P >0.05).

[0033] Figure 8 The fluorescence detection sensitivity results of the WT pig pAPN gene sequence are shown in Table 1. ** indicates a significant difference compared with the negative control group ( P <0.01), ns means there is no significant difference compared with the negative control group ( P >0.05).

[0034] Fig. 9 AE26crRNA system is used to detect pig nucleic acid samples.

[0035] Fig.10 Detect pig nucleic acid samples for the WT crRNA system.

[0036] Fig.11 This is the analysis result of the combined detection of pig nucleic acid samples by AE26crRNA system and WTcrRNA system. DETAILED DESCRIPTION

[0037] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0038] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0039] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0040] The present invention is described below in conjunction with specific examples, which are merely examples and are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are all based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or the conditions recommended by the manufacturer's instructions.

[0041] The main reagents used in the following examples are: LbCas12a protein (EDE0005-2000) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; 10×LbCas12a Cleavage Buffer (EDE0005-B) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; tissue DNA extraction kit (DP304-03) was purchased from Tiangen Biochemical Technology Co., Ltd.; EX Taq enzyme (RR001Q) was purchased from Takara; CloneSmarter TOPO cloning vector kit (C5865-50) was purchased from Sino-US Taihe Biotechnology (Beijing) Co., Ltd.; Escherichia coli DH5α competent cells (B528413-0100) were purchased from Sangon Biotech (Shanghai) Co., Ltd.; primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.; T7 in vitro transcription kit (AM1354) was produced by Invitrogen; single-stranded DNA fluorescent probe was synthesized by Sangon Biotech (Shanghai) Co., Ltd.; single-stranded DNA colloidal gold test paper probe (EDN-THD02) was purchased from Guangzhou Aidi Gene Technology Co., Ltd.; Cas12 / 13 special nucleic acid detection test strip (JY0301) was purchased from Beijing Libo Taiye Technology Co., Ltd.; TWistAmp Basic kit (TABS03KIT) was purchased from Beijing Libo Taiye Technology Co., Ltd.

[0042] The main instruments are as follows: PCR instrument (C1000 TouchTM, BIO-RAD); desktop high-speed refrigerated centrifuge (Heraeus Multifuge X1R, Thermo); bacterial incubator (MIR-254, SANYO); vortex shaker (SA8, Stuart-equipment); electronic weighing balance (Sartorius SQP, Sartorius Scientific Instrument Co., Ltd.); gel imaging system (BIO-RID, Universal HoodⅡ); constant temperature water bath (HHS-21-4, Changzhou Noki Instrument Co., Ltd.); fluorescence quantitative PCR instrument (QuantStudio™5, Thermo Scientific).

[0043] The AE26-CAAS gene-edited pigs in the following examples were prepared as follows: DKO pigs were bred with wild-type Large White pigs (from the Ninghe original breeding farm in Tianjin, hereinafter referred to as pAPN gene wild-type pigs (WT)) to produce offspring pigs, and genotype testing was performed on the offspring pigs, and offspring pigs with only the 26bp deletion of the pAPN gene were selected, namely AE26-CAAS pigs.

[0044] The method of the above genotype detection is as follows: The genomic DNA of the ear skin or tail skin tissue of the offspring pigs was extracted, and PCR amplification was performed using primers pAPN-PCR-F (5`-TACCCAGTTCAGTGACCTTCGTC-3`) and pAPN-PCR-R (5`-TGCTCGGCATTCTTGTTCTTCT-3`), and then detected by gel electrophoresis.

[0045] Electrophoresis detection showed that the sample with a single band of 260 bp in length was a genotype with single pAPN gene editing on two homologous chromosomes and a 26 bp deletion, and was named AE26-CAAS gene-edited pig homozygote.

[0046] Electrophoresis detection showed that the sample with two bands of 286 bp and 260 bp in length was a genotype with a single pAPN gene edited on one homologous chromosome and a 26bp deletion, and the other was a wild-type pAPN gene, named AE26-CAAS gene-edited pig heterozygote.

[0047] Electrophoresis detection showed that the sample with a single band of 286 bp in length contained the wild-type pAPN gene on two homologous chromosomes, and was named pAPN gene wild-type pig or wild-type pig.

[0048] Compared with wild-type pigs with the pAPN gene, the homozygous AE26-CAAS gene-edited pigs have only the 82-107th position of the second exon of the pAPN gene (genbank number: NM_214277, submitted on 2024-6-2) in the two homologous chromosomes (82-107th position of the nucleotide sequence of the pAPN gene shown in genbank number NM_214277) missing (26bp bases), while other genes remain unchanged.

[0049] Compared with wild-type pigs with the pAPN gene, the AE26-CAAS gene-edited heterozygous pigs have only the 82-107th position of the second exon of the pAPN gene (genbank number: NM_214277, submitted on 2024-6-2) in one homologous chromosome (82-107th position of the nucleotide sequence of the pAPN gene shown in genbank number: NM_214277) missing (26bp bases), and other genes remain unchanged; the other homologous chromosome is the same as the wild-type pig with the pAPN gene.

[0050] The above-mentioned DKO pigs are gene-edited pigs in which both CD163 and pAPN genes are knocked out simultaneously, and the pAPN gene has two genotypes: 5bp deletion and 26bp deletion. After genetic modification, the pAPN gene has a 26 bp base deletion in the second exon, which causes the pAPN gene to terminate translation prematurely and cannot generate functional APN protein, thereby achieving resistance to transmissible gastroenteritis of swine virus (TGEV).

[0051] DKO pigs are described in the following literature, in which the names are double-gene-knockout (DKO) pigs. The literature is Xu K, Zhou Y, Mu Y, Liu Z, Hou S, Xiong Y, Fang L, Ge C, Wei Y, Zhang X, Xu C, Che J, Fan Z, Xiang G, Guo J, Shang H, Li H, Xiao S, Li J, LiK. CD163 and pAPN double-knockout pigs are resistant to PRRSV and TGEV and exhibit decreased susceptibility to PDCoV while maintaining normal production performance. Elife. 2020 Sep 2;9:e57132. doi: 10.7554 / eLife.57132. Example 1: RPA-CRISPR / Cas12a nucleic acid detection system for detecting AE26-CAAS gene-edited pigs 1. Acquisition of crRNA 1. Standard plasmid construction A tissue DNA extraction kit was used to extract the ear tissue DNA of homozygous AE26-CAAS gene-edited pigs and wild-type pigs (WT) with the pAPN gene, and the primers shown in Table 1 were used to amplify the upstream and downstream sequences of the target site of the second exon of the pAPN gene to obtain PCR products.

[0052] Table 1 shows the primers for amplifying the pAPN gene

[0053] The PCR reaction system is as shown in Table 2: Table 2 shows the PCR reaction system

[0054] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 1 min, 36 cycles; 72°C for 5 min.

[0055] The PCR products were gel-recovered and purified, and the purified products were connected to the pClone-EZ-TOPO vector (China-US Taihe Biotechnology (Beijing) Co., Ltd., C5865-50). After sequencing verification, the gene-edited pig pAPN gene standard plasmid pClone-EZ-TOPO-AE26 and the wild-type pig pAPN gene standard plasmid pClone-EZ-TOPO-WT were obtained.

[0056] pClone-EZ-TOPO-AE26 is a vector obtained by replacing the TOPO I site of the pClone-EZ-TOPO vector with the AE26-CAAS gene editing sequence (SEQ ID NO.16).

[0057] pClone-EZ-TOPO-WT is a vector obtained by replacing the TOPO I site of the pClone-EZ-TOPO vector with a wild-type sequence (SEQ ID NO. 17).

[0058] Compared with the wild-type sequence, the above gene editing sequence is a sequence obtained by deleting positions 487-512 of the wild-type sequence.

[0059] The sequencing results of the two plasmids are as follows Figure 1 As shown, Figure 1 A is the sequencing result of the standard plasmid of AE26-CAAS gene-edited pig pAPN gene. Figure 1 B is the sequencing result of the standard plasmid of wild-type pig pAPN gene.

[0060] 2. crRNA target design According to the DNA sequences within 40 bp upstream and downstream of the target site of the second exon of the pAPN gene in AE26-CAAS gene-edited pigs and pAPN gene wild-type pigs, the sequences that met the recognition requirements of LbCas12a were searched, and then three candidate target sites were screened out according to the rules of sequence GC content, sequence complementarity, etc. Among them, AE26crRNA-T1 to AE26crRNA-T2 were candidate target sites screened for gene-edited disease-resistant pigs AE26-CAAS, and WTcrRNA-T1 was a candidate target site screened for wild-type pigs (wildtype, WT, wild type) of the pAPN gene, as shown in Table 3.

[0061] Table 3 shows the crRNA of candidate target sites

[0062] 3. Preparation of specific crRNA in vitro transcription template According to the candidate target site sequence, the T7 promoter sequence (TAATACGACTCACTATAGGG) (Chen JS et al. Science, 2018, 360(6387):436-439.) and the crRNA repeat region template sequence (TAATTTCTACTAAGTGTAGAT) were added to form the specific crRNA in vitro transcription template positive-strand DNA sequence (SEQ ID NO.4-6) shown in Table 4, and the negative-strand DNA sequence (SEQ ID NO.7-9) was formed according to the complementary pairing of the positive-strand DNA sequence.

[0063] Table 4 shows the positive and negative strands of the specific crRNA in vitro transcription templates.

[0064] The positive and negative DNA single strands were synthesized, and the specific crRNA in vitro transcription template was prepared by annealing. The annealing reaction system in Table 5 was prepared in a PCR tube as follows: Table 5 shows the annealing reaction system

[0065] Place the PCR tube in a PCR instrument and incubate at 95°C for 10 min, then immediately turn off the PCR instrument to allow the double-stranded strand to slowly cool down at room temperature, and incubate on ice for 5 min after 90 min. The annealed product is the crRNA in vitro transcription template and can be used for crRNA in vitro transcription.

[0066] 4. Specific crRNA in vitro transcription The T7 in vitro transcription kit (AM1354) produced by Invitrogen was used to configure the transcription system in the PCR tube as shown in Table 6: Table 6 is a specific crRNA in vitro transcription system

[0067] The transcription system was placed in a 37°C incubator for overnight incubation. The crRNA was recovered using an RNA purification and recovery kit produced by NEB.

[0068] The recovered crRNA sequences are shown in Table 7: Table 7 is the crRNA sequence name Sequence (5′-3′) length AE26crRNA-F1 (SEQ ID NO.10) UAAUUUCUACUAAGUGUAGAUUACAUUUCCAAGGCCCUGGGCGGC 45 bp AE26crRNA-F2 (SEQ ID NO.11) UAAUUUCUACUAAGUGUAGAUCAAGGCCCUGGGCGGCCGUGG 42 bp WTcrRNA-F1 (SEQ ID NO.12) UAAUUUCUACUAAGUGUAGAUAAGGCCCUGGGCAUCCUGGG 41 bp 2. Design and Screen RPA Primers According to the upstream and downstream sequences of the second exon target site of the porcine pAPN gene, RPA amplification primers were designed. The candidate RPA primer sequences are shown in Table 8 below: Table 8 shows the RPA amplification primers

[0069] The RPA reaction system is as shown in Table 9: Table 9 shows the RPA reaction system

[0070] The RPA reaction conditions are as follows: Incubate at 37°C for 30 min.

[0071] 3.2×10 10 The standard plasmid pClone-EZ-TOPO-AE26 of AE26-CAAS gene-edited pig pAPN gene with a capacity of 100 copies / μL was used as a template, and RPA amplification was performed using the primer pairs (F and R) shown in Table 8, the system and RPA reaction conditions shown in Table 9 to obtain RPA amplification products.

[0072] The RPA amplification products of each primer pair were subjected to agarose gel electrophoresis. Figure 2 As shown in the figure, Papn-PRA-1 represents pAPN-RPA-1F / pAPN-RPA-1R, and so on. It can be seen that pAPN-RPA-4F / R has a good amplification effect.

[0073] Primers pAPN-RPA-4F (SEQ ID NO. 13) and pAPN-RPA-4R (SEQ ID NO. 14) with better amplification effects were selected as RPA amplification primers.

[0074] 3. Establishment of RPA-CRISPR / Cas12a nucleic acid detection system and screening of crRNA The DNA probe in Table 10 is a single-stranded DNA fluorescent probe double-labeled with a 6-FAM group and a BHQ1 group, and the sequence is 6-FAM-TTATT-BHQ1. The CRISPR / Cas12a fluorescent detection system is prepared according to the components shown in Table 10 below: Table 10 is a CRISPR / Cas12a fluorescence detection system

[0075] Among them, the RPA product was obtained by RPA amplification using standard plasmids pClone-EZ-TOPO-AE26 and pClone-EZ-TOPO-WT as DNA templates. The AE26crRNA-F1, AE26crRNA-F2 and WTcrRNA-F1 detection systems were prepared according to the above system. Three technical replicates were set up for each detection system, and a negative control (NC) without crRNA was set up. The configured detection system was reacted at 37°C in a Q5 quantitative PCR instrument for 60 minutes, and the fluorescence intensity was set to be detected every 30 seconds.

[0076] The results are as follows Figure 3 As shown, AE26crRNA-F1 has a cleavage effect on both AE26-CAAS and WT sequences, stimulates trans-cleavage activity, and produces fluorescence with extremely significant differences (p<0.01) compared with the NC group. It cannot specifically identify the AE26-CAAS sequence, so AE26crRNA-F1 cannot be used to distinguish AE26-CAAS from WT samples. AE26crRNA-F2 only specifically targets and cleaves the AE26-CAAS sequence, and produces fluorescence with extremely significant differences (p<0.01) compared with the NC group. It can specifically identify the AE26-CAAS sequence, so AE26crRNA-F2 can be used to distinguish AE26-CAAS from WT samples.

[0077] Figure 4 It shows that WTcrRNA-F1 can specifically cut the WT sequence, stimulate trans-cutting activity, and produce fluorescence with a very significant difference (p<0.01) compared with the NC group, but cannot cut the AE26-CAAS sequence. Therefore, WTcrRNA-F1 can specifically recognize the WT sequence and can be used to distinguish AE26-CAAS and WT samples.

[0078] 4. Establishment of the RPA-CRISPR / Cas12a nucleic acid detection system for AE26-CAAS gene-edited pigs 1. RPA amplification The DNA of the sample to be tested was extracted as a template, and RPA amplification was performed using pAPN-RPA-4F / R primers according to the system and RPA reaction conditions shown in Table 9 to obtain an RPA amplification product.

[0079] 2. CRISPR / Cas12a detection of AE26-CAAS gene-edited pigs 1) CRISPR / Cas12a fluorescence detection The above RPA amplification product and AE26crRNA-F2 are configured into a CRISPR / Cas12a fluorescence detection system according to the system shown in Table 10 to obtain an AE26crRNA-F2 fluorescence detection system; The above RPA amplification product and WTcrRNA-F1 were configured with the CRISPR / Cas12a fluorescence detection system according to the system shown in Table 10 to obtain the WTcrRNA-F1 fluorescence detection system.

[0080] Three technical replicates were set up for each of the above detection systems, and a negative control (NC) without crRNA was set up.

[0081] The configured detection system was reacted in a Q5 quantitative PCR instrument at 37°C for 60 minutes.

[0082] The reaction products of each of the above fluorescence detection systems were used to detect the fluorescence intensity in real time using a Q5 quantitative PCR instrument.

[0083] If the fluorescence intensity of the reaction product of the AE26crRNA-F2 detection system is extremely significant ( P value <0.01) is higher than the reaction product of the negative control system, then the sample to be tested contains or is a candidate to contain the AE26-CAAS gene editing sequence, or the sample to be tested is derived from or is a candidate to be derived from the AE26-CAAS gene-edited pig; if the fluorescence intensity of the reaction product of the AE26crRNA-F2 detection system is not significant ( P >0.05) is higher than the reaction product of the negative control system, then the sample to be tested does not contain or is not a candidate for containing the AE26-CAAS gene editing sequence, or the sample to be tested does not originate from or is not a candidate for originating from the AE26-CAAS gene-edited pig.

[0084] The above negative control system differs from the AE26crRNA-F2 detection system only in that no crRNA is added.

[0085] The above-mentioned AE26-CAAS gene-edited pigs are homozygous AE26-CAAS gene-edited pigs or heterozygous AE26-CAAS gene-edited pigs.

[0086] 2) CRISPR / Cas12a test strip detection The above RPA amplification product and AE26crRNA-F2 are configured into a CRISPR / Cas12a test strip detection system according to the system shown in Table 11 to obtain an AE26crRNA-F2 test strip detection system; The above RPA amplification product and WTcrRNA-F1 were configured with the CRISPR / Cas12a fluorescence detection system according to the system shown in Table 11 to obtain the WTcrRNA-F1 test strip detection system.

[0087] The DNA probe in Table 11 is a single-stranded DNA test strip probe doubly labeled with a Biotin group and a 6-FAM group, and the sequence is 6-FAM-TTTTTTTATTTTTTT (SEQ ID NO. 15)-C6Biotin.

[0088] Table 11 shows the CRISPR / Cas12a test strip detection system

[0089] The AE26crRNA-F2 and WTcrRNA-F1 test strip detection systems were prepared according to the above system, and a negative control (NC) without crRNA was set up.

[0090] Three technical replicates were set up for each of the above detection systems, and a negative control (NC) without crRNA was set up.

[0091] The configured detection system was reacted in a PCR instrument at 37°C for 30 minutes to obtain a reaction product (reaction solution).

[0092] The reaction products of each of the above-mentioned test strip detection systems are detected using Cas12 / 13 dedicated nucleic acid detection test strips.

[0093] Open the tube cap and insert the pad end of the test strip into the reaction solution. The liquid level should not exceed the top of the pad. Wait until the reading area is completely soaked (it takes about 1 to 2 minutes. When the ambient temperature is low, such as in winter, the water absorption speed will be reduced and the soaking time of the reading area will be extended). Read the test results directly according to the color development of the test strip.

[0094] If the T line of the reaction product detection of the AE26crRNA-F2 detection system is colored or the C line and T line are displayed (positive), the sample to be tested contains or is a candidate to contain the AE26-CAAS gene editing sequence, or the sample to be tested is derived from or is a candidate to be derived from the AE26-CAAS gene-edited pig; if the C line of the reaction product detection of the AE26crRNA-F2 detection system is colored and the T line is not colored (negative), the sample to be tested does not contain or is a candidate to not contain the AE26-CAAS gene editing sequence, or the sample to be tested does not originate from or is a candidate to not originate from the AE26-CAAS gene-edited pig.

[0095] 3. CRISPR / Cas12a detection of AE26-CAAS gene-edited pig genotype The reaction products of each test strip system in 2) above are detected using a Cas12 / 13 dedicated nucleic acid detection test strip.

[0096] Read the test results directly according to the color development of the test strip.

[0097] If the reaction product of the AE26crRNA-F2 detection system is positive (the product of the AE26crRNA-F2 reaction system has T line color or C line and T line display), and the reaction product of the WTcrRNA-F1 detection system is negative (the product of the WTcrRNA-F1 reaction system has C line color and T line does not display color), then the sample to be tested is derived from or is a candidate for being derived from the AE26-CAAS gene-edited pig homozygote; If the reaction product of the AE26crRNA-F2 detection system is detected as positive (the product of the AE26crRNA-F2 reaction system is colored by the T line or displayed by the C line and the T line), and the reaction product of the WTcrRNA-F1 detection system is also detected as positive (the product of the WTcrRNA-F1 reaction system is colored by the T line or displayed by the C line and the T line), then the sample to be tested is derived from or may be derived from the AE26-CAAS gene-edited pig heterozygote.

[0098] The above-mentioned AE26-CAAS gene-edited pig RPA-CRISPR / Cas12 detection system includes: AE26crRNA-F2 and / or WT26crRNA-F1, pAPN-RPA-4F primer, pAPN-RPA-4R primer, LbCas12a protein, and single-stranded DNA probe.

[0099] Example 2: Sensitivity analysis of the CRISPR / Cas12a nucleic acid detection system in AE26-CAAS gene-edited pigs Dilute the AE26-CAAS gene-edited pig pAPN gene standard plasmid pClone-EZ-TOPO-AE26 and the pAPN gene wild-type pig pAPN gene standard plasmid pClone-EZ-TOPO-WT to 3.2×10 10 , 3.2×10 9 , 3.2×10 8 , 3.2×10 7 , 3.2×10 6 , 3.2×10 5 , 3.2×10 4 , 3.2×10 3 , 3.2×10 2, 3.2×10 1 , 3.2×10 0 copies / μL concentration.

[0100] Using gradient concentrations of pClone-EZ-TOPO-AE26 plasmid and pClone-EZ-TOPO-WT plasmid as templates, RPA amplification was performed using the aforementioned RPA primers (pAPN-RPA-4F / R) and conditions, and the RPA products were detected by electrophoresis.

[0101] The results of RPA amplification of AE26-CAAS standard plasmid pClone-EZ-TOPO-AE26 plasmid are shown in Figure 5 At a plasmid concentration of 3.2×10 2 When the concentration of plasmid is 200 copies / μL, the brightness of the electrophoresis band is already quite weak. When the concentration of plasmid is even lower, the result is not visible.

[0102] The results of RPA amplification of WT standard plasmid pClone-EZ-TOPO-WT plasmid are shown in Figure 6 At a plasmid concentration of 3.2×10 2 When the concentration of plasmid is lower, the brightness of the electrophoresis band is very weak. When the concentration of plasmid is lower, the result is not visible.

[0103] The above RPA product was used as the detection template, and CRISPR / Cas12a fluorescence detection was performed using the AE26crRNA-F2 fluorescence detection system and the WTcrRNA-F1 fluorescence detection system.

[0104] The detection system and reaction conditions are shown in Example 1.

[0105] The fluorescence intensity detection results of AE26crRNA-F2 fluorescence detection system and WTcrRNA-F1 fluorescence detection system are shown in Figure 7 and Figure 8 When the standard plasmid concentration is 3.2×10 2 When the detection results were less than 100 copies / μL, there was still an order of magnitude difference between the detection results and the negative control, and there was a very significant difference in fluorescence intensity ( P <0.01). This indicates that the detection sensitivity of the AE26crRNA-F2 system and the WTcrRNA-F1 system is 3.2×10 2 copies / μL, with higher sensitivity.

[0106] Example 3: Detection of pig nucleic acid samples using the AE26-CAAS gene-edited pig RPA-Cas12a nucleic acid detection system The AE26-CAAS gene-edited pig nucleic acid detection system provided by the present invention was used to divide pAPN gene wild-type pigs, AE26-CAAS gene-edited pigs, and other gene-edited pigs (MSTN gene-edited pigs) to detect whether the system can accurately identify AE26-CAAS gene-edited pig samples.

[0107] The above nucleic acid samples are all extracted from the genomic DNA of each pig.

[0108] The RPA amplification system was prepared according to the composition in Table 9, and the prepared amplification system was reacted in a thermostat at 37° C. for 30 minutes.

[0109] A single-stranded DNA test strip probe double-labeled with a Biotin group and a 6-FAM group was synthesized, and the sequence was 6-FAM-TTTTTTTATTTTTTT (SEQ ID NO.15)-C6Biotin. A CRISPR / Cas12a detection system was prepared according to the following components in Table 11, and an AE26crRNA-F2 test strip detection system and a WTcrRNA-F1 test strip detection system were prepared according to the above system, and a negative control (NC) without crRNA was set up.

[0110] The configured test strip detection system was reacted in a thermostat at 37° C. for 60 minutes to obtain a reaction product (reaction solution).

[0111] The reaction solution is tested with a Cas12 / 13 dedicated nucleic acid test strip, and the test result is directly read according to the color development of the test strip.

[0112] The results are as follows Fig. 9 and Fig.10 As shown, Fig. 9 In the figure, the number above each test strip indicates the sample number. When the RPA-Cas12a detection system with AE26crRNA-F2 as crRNA detects nucleic acid samples of AE26-CAAS gene-edited pig homozygotes, AE26-CAAS gene-edited pig heterozygotes, pAPN gene wild-type pigs (wild pigs), and other gene-edited pigs, the test results of nucleic acid samples without AE26-CAAS gene-edited sequences (wild pigs, other gene-edited pig nucleic acid samples) are consistent with the negative control results, with C line coloring and T line no coloring reaction, showing a negative result. The test results of nucleic acid samples containing AE26-CAAS gene-edited sequences (AE26-CAAS gene-edited homozygous pigs, AE26-CAAS gene-edited heterozygous pigs) are positive results in that both C line and T line are colored. This shows that the AE26crRNA-F2 system combined with colloidal gold test paper can accurately detect nucleic acid samples containing AE26-CAAS gene-edited sequences.

[0113] Fig.10In the test, when the RPA-Cas12a detection system with WTcrRNA-F1 as crRNA was used for nucleic acid samples of AE26-CAAS gene-edited homozygous pigs, AE26-CAAS gene-edited heterozygous pigs, wild pigs, and other gene-edited pigs, the samples without WT sequence (AE26-CAAS gene-edited homozygous pigs) were consistent with the negative control results, with C line coloring and T line no coloring reaction, showing a negative result. The test results of samples containing WT sequence (AE26-CAAS gene-edited heterozygous pigs, wild pigs, and other gene-edited pigs) were that both C line and T line were colored, showing a positive result. This shows that the WTcrRNA-F1 system combined with colloidal gold test paper can accurately detect nucleic acid samples containing WT sequence.

[0114] The combined use of AE26crRNA-F2 and WTcrRNA-F1 detection systems can accurately determine the genotype of pig nucleic acid samples. Fig.11 As shown, when the detection result of the AE26crRNA-F2 system is positive and the detection result of the WTcrRNA-F1 system is negative, it indicates that the nucleic acid sample is a sample of the AE26-CAAS gene-edited pig homozygote; when the detection result of the AE26crRNA-F2 system is positive and the detection result of the WTcrRNA-F1 system is also positive, it indicates that the nucleic acid sample is a sample of the AE26-CAAS gene-edited pig heterozygote; when the detection result of the AE26crRNA-F2 system is negative and the detection result of the WTcrRNA-F1 system is positive, it indicates that the nucleic acid sample is a wild-type sample.

[0115] Therefore, by using the crRNAs such as AE26crRNA-F2 and WTcrRNA-F1 and the detection method provided by the present invention, the genotype of AE26-CAAS gene-edited pigs can be determined quickly, with high sensitivity and high specificity, and can be applied to the detection, breeding, production, and supervision of AE26-CAAS gene-edited pigs.

[0116] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. crRNA, comprising crRNA1, The nucleotide sequence of the crRNA1 binding target is SEQ ID NO.

2.

2. The crRNA according to claim 1, characterized in that: The crRNA1 is obtained by in vitro transcription from the transcription template 1; The transcription template 1 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.5 and the single-stranded DNA molecule shown in SEQ ID NO.

8.

3. The crRNA group according to claim 1 or 2, characterized in that: The nucleotide sequence of the crRNA1 is SEQ ID NO.

11.

4. The crRNA group according to any one of claims 1 to 3, characterized in that: The crRNA group also includes crRNA2, The nucleotide sequence of the crRNA2 binding target is SEQ ID NO.

3.

5. The crRNA group according to claim 4, characterized in that: The crRNA2 is obtained by in vitro transcription from the transcription template 2; The transcription template 2 is the product obtained by annealing the single-stranded DNA molecule shown in SEQ ID NO.6 and the single-stranded DNA molecule shown in SEQ ID NO.

9.

6. The crRNA according to claim 4 or 5, characterized in that: The nucleotide sequence of the crRNA2 is SEQ ID NO.

12.

7. A product comprising the crRNA1, Cas12a protein, a primer pair for specific amplification of each binding target and a single-stranded DNA probe described in any one of claims 1 to 6; Or, the product comprises crRNA1 and crRNA2, Cas12a protein, primer pairs for specific amplification of each binding target, and single-stranded DNA probes as described in any one of claims 4-6; And / or, the two ends of the single-stranded DNA probe are respectively labeled with different groups; And / or, the group is a fluorescent group, a quenching group and / or biotin.

8. The product according to claim 7, characterized in that: The primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO.13 and a single-stranded DNA molecule shown in SEQ ID NO.14; Alternatively, the product is a test kit, a test strip or a fluorescence detection system.

9. Any of the following substances: A1) the Cas12a protein described in claim 7 and the crRNA1, or a complex formed by the two; A2) the Cas12a protein, the crRNA1 and the crRNA2 described in claim 7, or a complex group formed by each of them and the Cas12a protein; A3) The primer pair according to claim 7 or 8.

10. Use of the crRNA according to any one of claims 1 to 6 or the product according to any one of claims 7 to 8 in any of the following: B1) Identify or assist in identifying AE26-CAAS gene-edited pigs; B2) Identify or assist in identifying whether the sample to be tested contains the AE26-CAAS gene editing sequence; B3) Identify or assist in identifying the genotype of AE26-CAAS gene-edited pigs; B4) Prepare products to identify or assist in identifying AE26-CAAS gene-edited pigs; B5) Prepare products for identification or auxiliary identification of whether the sample to be tested contains the AE26-CAAS gene editing sequence; B6) Prepare products for identifying or assisting in identifying the genotype of AE26-CAAS gene-edited pigs; Or, a method for identifying or assisting in identifying AE26-CAAS gene-edited pigs, comprising the following steps: C1) using the nucleic acid of the sample to be tested as a template, performing RPA amplification with the primer pair described in claim 7 or 8 to obtain an RPA amplification product; C2) preparing a CRISPR-Cas12a detection system containing the following components: the PCR product, the Cas12a protein described in claim 7, the crRNA1 in the crRNA described in claim 7, and the single-stranded DNA probe described in claim 7; C3) reacting the CRISPR-Cas12a detection system and detecting the reaction product, thereby identifying or assisting in identifying the AE26-CAAS gene-edited pig; Or, a method for identifying or assisting in identifying the genotype of AE26-CAAS gene-edited pigs, comprising the following steps: D1) using the nucleic acid of the sample to be tested as a template, and performing RPA amplification with the primer pair described in claim 7 to obtain an RPA amplification product; D2) preparing CRISPR-Cas12a detection system 1 and CRISPR-Cas12a detection system 2 containing the following components; The CRISPR-Cas12a detection system 1 comprises the PCR product, the Cas12a protein described in claim 7, the crRNA1 in the crRNA described in claim 7, and the single-stranded DNA probe in claim 7; The CRISPR-Cas12a detection system 2 comprises the PCR product, the Cas12a protein described in claim 7, the crRNA2 in the crRNA described in claim 7, and the single-stranded DNA probe in claim 7; D3) The CRISPR-Cas12a detection system 1 and the CRISPR-Cas12a detection system 2 are reacted separately, and the reaction products of the two systems are detected to identify or assist in identifying the genotype of the AE26-CAAS gene-edited pig.

Images