A rape ammonium transporter BnaAMT1; application of 10 and haplotype thereof

Abstract

The invention relates to a method for preparing a rape ammonium transporter BnaAMT1; 10 and application of the haplotype thereof. According to the present invention, the experiment results prove that the BnaAMT1; 10 has an ammonium transport capability and can inhibit growth and development of rape and absorption and assimilation of nitrogen after mutation, and under a low-nitrogen condition, BnaAMT1; the mutation of BnaAMT1, BnaAMT1, BnaAMT1, BnaAMT1, BnaAMT1; 10 overexpression can increase the yield of rape. Further, an unreported excellent allelic site is found through candidate gene correlation analysis, and the allelic site is used for detecting BnaAMT1; the invention plays a crucial role in ammonium transport activity of protein 10 and regulation and control of nitrogen efficiency of rape.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular breeding, and in particular relates to an application of a rapeseed ammonium transporter BnaAMT1;10 and a haplotype thereof. Background Art

[0002] Nitrogen (N) is a macronutrient essential for plants. The demand for nitrogen in agriculture has been growing over the years. About 50% of the population relies on industrial fertilizers for food production. The efficiency of nitrogen use is generally low. Crops can only use 30-40% of the nitrogen in the fertilizers. A large amount of nitrogen is lost to the air, water and soil, causing a series of environmental and human health problems. When NUE increases by 1%, about $1.1 billion can be saved each year. Therefore, in order to minimize nitrogen losses, reduce environmental pollution, and reduce agricultural production costs, it is crucial to explore crop nitrogen efficient utilization genes and accelerate the cultivation of crop nitrogen efficient varieties.

[0003] Plants generally rely on ammonium and nitrate, two more active forms of available inorganic nitrogen, for growth and development. Inorganic nitrogen is assimilated into glutamate (Glu) and glutamine (Gln) in plants. For most plants, a small amount of nitrate is absorbed and assimilated in the roots, while most is transported to the aboveground parts for assimilation. It is first reduced to nitrite by nitrate reductase in the cytoplasm, and then reduced to ammonium by nitrite reductase in the plastids and glutamine synthetase (GS) in the plastids and cytoplasm. Ammonium from nitrate or directly from ammonium transporter (AMT) absorption is further assimilated into amino acids through the GS / glutamine-2-oxoglutarate aminotransferase (GOGAT) cycle. In aerobic soils, nitrogen exists mainly in the form of nitrate, while in anaerobic soils such as rice fields, ammonium is the main inorganic nitrogen form, and ammonium transporter (AMT) is essential for obtaining ammonium from plant soil.

[0004] Rapeseed (Brassica napus) is one of the main oil plants in my country. Its seeds contain about 40% oil and have multiple economic values ​​such as food, medicine and feed. Nitrogen nutrition has an important influence on the growth, development and quality of rapeseed. The amount of nitrogen required for rapeseed cultivation is three times that of cereal crops. Therefore, it is very important to improve the nitrogen utilization of rapeseed. Ammonium is one of the important inorganic nitrogen sources for plants, and it consumes less energy in the assimilation process. Therefore, regulating ammonium transporters and increasing rapeseed's absorption of ammonium nitrogen are of great significance to improving the nitrogen utilization efficiency of rapeseed, increasing rapeseed yield and reducing nitrogen fertilizer application. Summary of the invention

[0005] The present invention found that the rapeseed BnaAMT1;10 gene can improve the absorption and assimilation of ammonium nitrogen in rapeseed under low nitrogen conditions. Pot experiments showed that mutation of the gene reduced the yield of rapeseed under low nitrogen conditions, while overexpression of the gene increased the yield of rapeseed. In natural populations, BnaAMT1;10 contains two haplotypes, of which haplotype 1 (Hap1) is an excellent haplotype, and the G / C site in the CDS region is crucial to its ammonium transport activity.

[0006] The present invention provides an application of rapeseed ammonium transporter BnaAMT1;10 in any of the following:

[0007] A1) Improving the nitrogen utilization, number of siliques per plant and / or yield of rapeseed;

[0008] A2) preparing products for improving nitrogen utilization, number of siliques per plant and / or yield of rapeseed;

[0009] A3) Enhance the growth and development of rapeseed under low nitrogen conditions;

[0010] A4) preparing a product for enhancing the growth and development of rapeseed under low nitrogen conditions.

[0011] Furthermore, the amino acid sequence encoded by BnaAMT1;10 is shown in SEQ ID NO:2, and the nucleotide sequence of BnaAMT1;10 is shown in SEQ ID NO:1.

[0012] The present invention also provides a method for improving rapeseed nitrogen utilization, the number of siliques per plant, yield and / or enhancing the growth and development of rapeseed under low nitrogen conditions, and overexpressing BnaAMT1;10 in rapeseed.

[0013] Furthermore, the amino acid sequence encoded by BnaAMT1;10 is shown in SEQ ID NO:2, and the nucleotide sequence of BnaAMT1;10 is shown in SEQ ID NO:1.

[0014] The present invention also provides a SNP molecular marker combination significantly associated with rapeseed ammonium utilization. Taking the rapeseed genome version: Westar.v0 as a reference, the molecular marker combination includes ChrC06:13880756, ChrC06:13880762, ChrC06:13880785, ChrC06:13880795, and ChrC06:13883423.

[0015] Furthermore, when the base sequence of the molecular marker combination is CGCAG, rapeseed exhibits a phenotype of high ammonium utilization ability, and when the base sequence is TAAGC, rapeseed exhibits a phenotype of low ammonium utilization ability.

[0016] The present invention also provides the use of the substance for detecting the above molecular marker combination in any of the following:

[0017] B1) Identify or assist in identifying rapeseed nitrogen utilization;

[0018] B2) preparing and identifying or assisting in the identification of rapeseed nitrogen utilization products;

[0019] B3) Rapeseed breeding or preparation of rapeseed breeding products.

[0020] The present invention also provides the use of a substance for detecting a SNP significantly associated with rapeseed ammonium utilization in identifying or assisting in identifying the ammonium utilization ability of rapeseed, wherein the SNP is ChrC06:13883423, and the rapeseed genome version: Westar.v0 is used as a reference.

[0021] The present invention also provides a method for detecting the ammonium utilization ability of rapeseed, identifying or assisting in the identification of the ammonium utilization ability of rapeseed, predicting the ammonium utilization ability of rapeseed, and assisting in the breeding of rapeseed with high ammonium utilization ability, taking the rapeseed genome version: Westar.v0 as a reference,

[0022] C1) detecting the base sequence of ChrC06:13883423 in rapeseed, when it is G, it indicates that the ammonium utilization capacity of rapeseed is high, and when it is C, it indicates that the ammonium utilization capacity of rapeseed is low;

[0023] C2) The base sequences of ChrC06:13880756, ChrC06:13880762, ChrC06:13880785, ChrC06:13880795, and ChrC06:13883423 in rapeseed were detected. When the base sequence was CGCAG, rapeseed showed high ammonium utilization ability, and when the base sequence was TAAGC, rapeseed showed low ammonium utilization ability.

[0024] Compared with the prior art, the present invention has at least the following advantages: firstly, the tissue localization of BnaAMT1;10 is detected by using GUS, and the ammonium transport activity of BnaAMT1;10 is proved by using yeast and clawed frog oocytes, and then by comparing the sensitivity of the wild type, mutants and overexpression materials to methylammonium, it is proved that BnaAMT1;10 has the ability to transport ammonium in plants, and by comparing the phenotypes of the wild type and the bnaamt1;10 mutant under different nitrogen treatments, it is proved that the mutation of BnaAMT1;10 will inhibit the growth of rapeseed and the absorption and assimilation of ammonium, and through pot experiments, it is proved that under low nitrogen conditions, the mutation of BnaAMT1;10 will inhibit the yield of rapeseed, while the overexpression of BnaAMT1;10 will increase the yield of rapeseed. Through candidate gene association analysis, an unreported superior allele was found, which played a crucial role in the ammonium transport activity of the protein. In summary, the study of BnaAMT1;10 provides a genetic means to promote rapeseed ammonium absorption, increase rapeseed yield and nitrogen efficiency under conditions of limited nitrogen fertilizer supply. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 The expression levels of the BnaAMT10 gene in Example 1 of the present invention at different time points under normal nitrogen supply and nitrogen-free treatments;

[0027] Figure 2 This is the vector map for constructing the ProBnaAMT1;10-GUS fusion plasmid in Example 2;

[0028] Figure 3 The GUS staining results of wild-type and ProBnaAMT1;10-GUS Arabidopsis in Example 2 show the tissue localization of BnaAMT1;10;

[0029] Figure 4 The yeast ammonium transport activity and ammonium transport affinity results of BnaAMT1;10 in Example 3;

[0030] Figure 5 The editing status of the BnaAMT1;10 mutant rapeseed and the expression level of the overexpressed rapeseed in Example 4;

[0031] Figure 6 The phenotype and biomass of the mutant and overexpressing rapeseed of BnaAMT1;10 in Example 5 under 30 mM methylammonium (MeA) treatment;

[0032] Figure 7 The wild type and BnaAMT1;10 mutants of Example 6 were cultured in 3 mM NH 4 NO 3 with 0.1 mM NH 4 + Phenotype and biomass under treatments;

[0033] Figure 8 The wild type and BnaAMT1;10 mutants of Example 7 were cultured in 3 mM NH 4 NO 3 with 0.1 mM NH 4 + Nitrogen concentration and nitrogen content analysis under treatments;

[0034] Fig. 9The wild type and BnaAMT1;10 mutants of Example 7 were cultured in 3 mM NH 4 NO 3 with 0.1 mM NH 4 + Analysis of ammonium content, GS enzyme activity and Gln content under treatments;

[0035] Fig.10 The photos of flowering phenotypes of wild type, BnaAMT1;10 mutant and overexpressed rapeseed in Example 8;

[0036] Fig.11 The plant height, number of siliques per plant, thousand-grain weight and yield data of the wild type, BnaAMT1;10 mutant and overexpression rapeseed at maturity in Example 8;

[0037] Fig.12 BnaAMT1;10 Haplotype analysis and phenotypic data;

[0038] Fig.13 Yeast ammonium transport activity of BnaAMT1;10 different haplotypes. DETAILED DESCRIPTION

[0039] The following examples are only used to more clearly illustrate the technical scheme of the present invention, and are therefore only used as examples, and cannot limit the scope of protection of the present invention. It should be noted that, unless otherwise stated, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs. Unless otherwise stated, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise stated, the reagents and materials used in the following examples are commercially available.

[0040] In order to better understand the present invention but not to limit the scope of the present invention, all the numbers and other numerical values ​​used in this application to express the amount, percentage, etc. should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the attached claims are approximate values, which may be changed according to the different ideal properties attempted to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant figures and by conventional rounding methods.

[0041] In the present application, the term "gene" refers to a nucleic acid fragment that expresses a specific protein or functional RNA molecule, which may contain regulatory sequences preceding the coding sequence (5' non-coding region) and following the coding sequence (3' non-coding region).

[0042] Example 1 Response of BnaAMT1;10 gene to nitrogen

[0043] (1) Rapeseed material culture formula: 3.0 mM NH 4 NO 3 , 1.0 mM NaH 2 PO 4 ·2H 2 O, 2.0 mM MgSO 4 7H 2 O, 2.0 mM KCl, 3.24 mM CaCl 2 , 46.0 μM H 3 BO 3 , 9.14 μM MnCl 2 ·4H 2 O, 0.5 μM Na 2 MoO 4 · 2 H 2 O, 0.77 μM ZnSO 4 7H2O, 0.32μM CuSO 4 ·5H 2 O and 25.0 μM Fe-EDTA.

[0044] (2) Rapeseed material culture steps: Rapeseed seeds were shelled and heated in 0.5 mM CaCl 2 After 5 days of growth, the seedlings were transferred to normal nutrient solution for 6 days, and then the seedlings with uniform growth were selected, without nitrogen and with 3mM NH 4 NO 3 After 9 days of cultivation and 3 days of restoration of nitrogen supply under N-free treatment, samples were taken to extract RNA, and the response of BnaAMT1;10 to nitrogen was analyzed by qPCR.

[0045] Using EF-α as the internal reference gene, BnaAMT1;10 primer sequence:

[0046] F:CGGCGTCACTAGTTGTCCTT;

[0047] R:GACGTTTCCCGAAGAGGGTT

[0048] qPCR detected that after 6 hours of nitrogen deficiency, the expression of BnaAMT1;10 in the aboveground part increased, and after 3 days of nitrogen deficiency, the expression of BnaAMT1;10 in the root increased significantly, which was higher than that in the aboveground part. After nitrogen supply, the expression level of the gene dropped rapidly both aboveground and underground, indicating that BnaAMT1;10 was induced by nitrogen deficiency.

[0049] Example 2 Tissue-specific expression of BnaAMT1;10

[0050] (1) Construction of ProBnaAMT1;10-GUS fusion vector

[0051] The gDNA sequence of BnaAMT1;10 was searched by BnIR, and the 1895 bp fragment before ATG was cloned. The sequence was shown in SEQ ID NO:3. The primer sequences were (GATTACGCCAAGCTTAAGCTAAAC CAGAACTCGTG; GGACTGACCACCCGGGTTGGGAGAGATTGGTGAG). The 1895 bp promoter was connected to the pBI121-GUS vector using SmaⅠ and XbaⅠ. The vector map is shown in Figure 2 The ProBnaAMT1;10-GUS fusion plasmid was transformed into Agrobacterium, and then infected into Arabidopsis to obtain transgenic Arabidopsis materials and observe the tissue localization of BnaAMT1;10.

[0052] (2) Acquisition of Arabidopsis thaliana materials

[0053] Take out the Agrobacterium strain containing ProBnaAMT1; 10-GUS fusion plasmid, thaw and apply a small amount to LB solid medium containing Kan and Gen, and culture in a constant temperature incubator at 28°C for 2 days; pick a single clone to 500μL of double-antibody LB, culture it on a constant temperature shaker at 28°C at 200r / min overnight, draw 200-400μL of the shaken bacterial solution into 100mL of double-antibody LB liquid, and culture it in a constant temperature incubator at 28°C at 200r / min until OD600 is 0.8-1.2; divide the shaken 100mL bacterial solution into 50mL centrifuge tubes, centrifuge at 3600r / min for 15min, pour off the supernatant, resuspend the bacteria with an equal volume of sterilized 5% sucrose (add a small amount of magnesium sulfate), add an appropriate amount of silwet L-77 (50 μL added to 100 mL); infect the Arabidopsis buds that have been normally cultured to the flowering stage in the bacterial solution for 30 seconds, and culture them in the dark for 24 hours after the infection; after normal culture for 1 week, infect and transform them again, and the first batch of seeds can be harvested in about 2-3 weeks.

[0054] Soak the cultured GUS transgenic Arabidopsis in the GUS dye solution, evacuate for 30 minutes, and incubate in a 37°C incubator until blue appears. After decolorization with 75% ethanol, take photos and record. Figure 3 As shown, there is no blue color in wild-type Arabidopsis, while blue color appears in both leaves and roots of ProBnaAMT1;10-GUS transgenic Arabidopsis, indicating that BnaAMT1;10 is expressed in both leaves and roots of Arabidopsis, mainly in the root epidermis and cortex, which is consistent with the localization of Arabidopsis AtAMT1;1.

[0055] Example 3 Ammonium transport activity and affinity of BnaAMT1;10

[0056] 1. Ammonium transport activity of BnaAMT1;10

[0057] The yeast mutant strain 31019b has the genotype of mep1D mep2D mep3D ura3, which means that the strain lacks these three MEP genes and cannot grow in the presence of less than 5 mM NH 4 + The PDR196-BnaAMT1;10 fusion vector was constructed using primer pairs (F: CGACTAGTGGATCCCATGTCGGGATCTTTATCTTGCTCTGCT; R: CGATAAGCTTGATATCGTCAAACAGAAGTGGTAGTAACACCCG), and the PDR196 (negative control), PDR196-AtAMT1;1 (positive control), and PDR196-BnaAMT1;10 vectors were transformed into 31019b yeast strains, and then inoculated into 20 mL of 100 mL conical flasks containing 0.17% YNB, 0.1% L-proline, and 2% glucose, and the bacterial solution was shaken at 28°C and 200 r / min until the OD600 was 1-1.2. Then 1 mL of the bacterial solution was centrifuged at 4000 r / min-1 for 2 min, washed twice, and resuspended with 0.17% YNB. All bacterial suspensions were diluted with 0.17% YNB to an OD600 of 0.5. Then, the yeast was divided into four concentration gradients by ten-fold dilution with sterile water and cultured on plates containing 0.2M and 2M ammonium sulfate until colonies grew.

[0058] like Figure 4 As shown, yeast transformed with empty vector only grows on medium supplemented with proline and cannot grow on medium with ammonium chloride as the only nitrogen source. Yeast transformed with BnaAMT1;10 and AtAMT1;1 can grow normally under 0.2mM and 2mM ammonium chloride conditions, indicating that BnaAMT1;10 has ammonium transport activity.

[0059] 2. Ammonium transport affinity of BnaAMT1;10

[0060] Use primer pair (F: AACTTTGGCAGATCTATGTCGGGATCTTTATCTTGCTC TGCT; R: TAGTCAGTCACTAGTTCAAACAGAAGTGGTAGTAACACCCG) to construct BnaAMT1; 10-pT7Ts fusion vector, take 6-7μg plasmid, add restriction endonuclease to linearize the plasmid, add 0.4μL proteinase K (20mg / mL), 20μL 1% SDS to the linearized plasmid, warm at 50℃ for 30min, then add enzyme-free water to 100μL and 100μL phenol / chloroform solution. Centrifuge at room temperature for 13000r min - 1, 3min. Aspirate the supernatant and add 10μL sodium acetate (3M) and 200μL 95% ethanol at -20℃ for 15min. Centrifuge again at 4℃, 13000r / min, 30min. Wash the precipitate with 200μL 70% ethanol, and dissolve the precipitate with 8-10μL to obtain the purified linearized plasmid.

[0061] Pipette 1μg of linearized plasmid, add 2μL enzyme mix, 10μL 2×NTP / Cap, 2μL 10×buffer, and add sterile deionized water to 20μL. React at 37℃ for 2h. Add 1μL DNAase and react at 37℃ for 15-30min. Add 100μL water, 15μL sodium acetate (3M) and 150μL phenol / chloroform solution, centrifuge at room temperature at 13000r / min for 3min. Absorb the supernatant and add 100μL water to mix well and centrifuge again. Take the supernatant and add an equal volume of isopropanol at -20℃ for 15min. Centrifuge at 4℃ at 13000r / min for 30min to precipitate cRNA. Wash the precipitate with 200μL 70% ethanol, and dissolve the precipitate with 11μL to obtain cRNA.

[0062] Obtaining Xenopus oocytes: Select dark-colored, strong, adult female African clawed frogs and place them on ice for anesthesia. After thorough anesthesia, dissect and retrieve the eggs. Use forceps to tear apart large groups of Xenopus oocytes as much as possible and transfer them to a 1.5-2 mg mL -1 MBS containing collagenase was used to digest the outer membrane of the oocytes at 25°C. When most of the Xenopus oocytes were scattered, they were promptly treated with Ca-containing 2 + MBS was used to wash the Xenopus oocytes, and the enzymatic reaction was terminated to select the Xenopus oocytes with clear black and white boundaries and uniform size for injection. -1 Streptomycin, 60 mg L -1The oocytes were cultured in MBS containing penicillin and gentamicin for 2 days. The Xenopus oocytes containing the target gene cRNA were transferred to 20 μM NH 4 + , 50 μM NH 4 + , 100 μM NH 4 + , 400 μM NH 4 + , 800 μM NH 4 + and 1000 μM NH 4 + The current was detected in solution using a two-electrode voltage clamp.

[0063] The results are as follows Figure 4 As shown in the figure, compared with oocytes not injected with BnaAMT1;10, oocytes injected with BnaAMT1;10 showed a larger inward current at -50nA. The Km of ammonium transport by BnaAMT1;10 is 25.64±1.11μM. Therefore, both yeast and Xenopus oocyte experiments indicate that BnaAMT1;10 is a high-affinity ammonium transporter.

[0064] Example 4 Construction of BnaAMT1;10 mutant rapeseed and overexpression rapeseed lines

[0065] The target gene was knocked out by CRISPR / Cas9 gene editing technology, and the target site of gene BnaAMT1;10 was designed by CRISPR-P v2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the specific sequence was (ATATATGGTCTCGATTGCTGCTGCCGGAATCACCAGGTT; TGCT GCTGCCGGAATCACCAGGTTTTAGAGCTAGAAATAGC; AACTTGCACCCA AGGAGTACCACAATCTCTTAGTCGACTCTAC; ATTATTGGTCTCGAAACTTGCACCCAAGGAGTACCACAA), and mutant vector was constructed by primer pair (TTT CGCGAGCTCGGTACCCGGGATGTCGGGATCTTTATCTTGCTC; GTCGACT The BnaAMT1;10CDS sequence was constructed into the pBI21s overexpression vector, and then the positive material was obtained by genetic transformation of rapeseed hypocotyls. The positive material was subsequently identified by PCR, the gene sequencing method was used to identify whether the target sequence was edited, and the expression level of the overexpression plant was identified by qPCR.

[0066] like Figure 5 As shown, three mutant strains were obtained, and the editing types were insertion mutation, deletion mutation, and insertion mutation, respectively. Two overexpression strains were obtained, which were overexpressed by 25 times and 15 times, respectively.

[0067] Example 5 Using MeA to explore the ammonium absorption capacity of BnaAMT1;10 transgenic material

[0068] MeA is an ammonium analog. The absorption mechanism of methylammonium by plants is the same as that of ammonium. After absorption, it will quickly become toxic to plants and inhibit plant growth. Therefore, MeA can be used to explore the mechanism of plant absorption of ammonium. The overexpression and mutant materials were treated with normal light and dark respectively under 30mM MeA. After 3 days, Figure 6 The seedlings grown under light-proof conditions had no significant difference in hypocotyl length under normal culture. The seedlings grown with methylammonium had significantly longer hypocotyl length than the wild type, while the overexpression strain was significantly inhibited. Under normal light, when cultured in normal nutrient solution, there was no significant difference between all strains. However, after MeA treatment, the fresh weight of the mutant strain was significantly higher than that of the wild type, while the overexpression strain was significantly lower than that of the wild type. This indicates that BnaAMT1;10 is beneficial to the absorption of MeA, and also indicates that BnaAMT1;10 has the ability to absorb ammonium.

[0069] Example 6 Phenotypes of bnaamt1;10 mutant rapeseed under different nitrogen treatments

[0070] 1. Rapeseed cultivation conditions

[0071] Rapeseed in 0.5 mM CaCl 2 After 5 days of seedling cultivation, the seedlings were transferred to normal and low nitrogen treatments. Normal treatment was 3 mM NH 4 NO 3 and low nitrogen 0.1 mM NH 4 + Three biological replicates were set for each treatment. After 12 days of treatment, samples were collected and dried above and below the ground. The root system was pre-cooled with CaCl 2 After washing, the leaves were withered together with the aerial parts in an oven at 105°C for 30 min, then dried at 75°C to constant weight, and the dry weight and nitrogen content were determined.

[0072] 2. Determination of total nitrogen content in rapeseed

[0073] The solution is prepared as follows: (1) Preparation of phenol solution: weigh 5g of phenol and 50mg of sodium nitrosoferrocyanide, dissolve them in distilled water, transfer to a 500mL volumetric flask and make up to volume, and store them in a brown bottle in a refrigerator at 4°C. It must be warmed to room temperature before use. (2) Preparation of sodium hypochlorite alkaline solution: weigh 5g of sodium hydroxide, 3.53g of disodium hydrogen phosphate, 15.9g of sodium phosphate, measure 5mL of sodium hypochlorite (i.e., bleach solution containing 5% effective chlorine) solution, dissolve them, transfer to a 500mL volumetric flask and make up to volume, and store them in a brown bottle in a refrigerator at 4°C. (3) Preparation of masking agent: weigh 20g of potassium sodium tartrate, 5g of disodium EDTA, and 0.2g of NaOH in a beaker, add about 60mL of water, heat to dissolve, and transfer to a 100mL volumetric flask and make up to volume. (4) Ammonium nitrogen standard solution (5 μg / mL, available in the laboratory): On the day of measurement, the ammonium nitrogen standard stock solution was accurately diluted 20 times with water (e.g., 5 mL was diluted to 100 mL).

[0074] The specific operation is as follows: accurately weigh about 0.05g of plant sample and place it in a 20mL digestion tube, add 2mL of concentrated H 2 SO 4 After the cold nitration is completed, the digestive tube is placed in a metal bath (120°C) for hot nitration, during which 2-3 drops of H are added every 10-15 minutes. 2 O 2And shake evenly, repeat the operation until the solution is colorless and transparent. After the digestion solution is cooled, dilute it to 20mL with pure water and shake it well, then filter it into a 10mL centrifuge tube with medium-speed quantitative filter paper. Finally, take 4mL of the solution and dilute it 2 times with ultrapure water to complete the preparation. The test solution is used to determine the nitrogen content in each tissue in a flow injection analyzer (AA3, SEAL Analytical GmbH), and 7 standard curve concentrations (0mg / L, 5mg / L, 10mg / L, 20mg / L, 40mg / L, 50mg / L and 60mg / L) are set.

[0075] like Figure 7 As shown, in 3 mM NH 4 NO 3 There was no significant difference in the dry weight of the shoots and roots under the treatments. 4 + Under the treatment, the aboveground and root fresh weights of the mutant strains were significantly lower than those of the wild type, indicating that the Bnaamt1;10 mutation caused the growth and development of rapeseed to be inhibited under low ammonium conditions. At the same time, the nitrogen content and nitrogen concentration of all materials under different treatments were measured. 4 NO 3 Under the same conditions, the nitrogen content and nitrogen concentration of all materials did not change significantly, but under 0.1 mM NH 4 + Under these conditions, the nitrogen concentration and content in the shoots and roots of the mutant were significantly lower than those in the wild type, indicating that the reduced nitrogen concentration caused by the BnaAMT1;10 mutation may be the reason for the growth inhibition of the mutant rapeseed.

[0076] Example 7 Effect of mutation of BnaAMT1;10 on nitrogen assimilation in rapeseed

[0077] (1) Determination of ammonium nitrogen content

[0078] The reagent preparation, standard curve preparation and result calculation method for the determination of ammonium nitrogen content in this embodiment are the same as those in Example 6. The only difference is that the sample preparation and determination method is different. Sample determination: Weigh 0.5g of sample in a mortar, grind with 5mL ultrapure water, transfer to a centrifuge tube, centrifuge at 12500rpm for 15min, draw 0.1mL of supernatant and dilute it into a test tube, add 2.9mL ultrapure water, 0.5mL phenol solution, 1mL sodium hypochlorite alkaline solution in turn, shake well, and place at room temperature of about 28°C for 30min. Add 0.1mL masking agent to dissolve any precipitate that may be generated. After shaking well, colorimetry is performed at 625nm. Expressed in μmol / gFW.

[0079] Xylem sap collection: The natural collection method relying on plant root pressure was adopted. Specific steps: The absorbent cotton was washed with dilute hydrochloric acid, distilled water, and deionized water, dried, and placed in a clean 50mL Eppendorf tube for use. The material was moved to a shady place, and the stem was quickly cut with a blade disinfected by soaking in acetone at about 4cm from the root base. With absorbent cotton dipped in deionized water, the incision connected to the root system was quickly scrubbed and the surface water was absorbed. The first drop of sap was discarded with absorbent cotton. A 200μL pipette was used to repeatedly absorb the overflowed sap into a 10mL Eppendorf tube, with 5 plants for each replicate, and the collection was stopped after 2h. Weigh, subtract the mass of the centrifuge tube before collection, and calculate the amount of xylem sap collected for each treatment. The collected xylem sap was diluted 10 times and free ammonium was determined.

[0080] (2) Determination of glutamine synthetase activity

[0081] Preparation of enzyme extraction buffer: weigh 1.5295 g Tris, 0.1245 g MgSO 4 7H2O, 0.1543g DTT (dithiothreitol) and 34.23g sucrose were dissolved in deionized water, adjusted to pH 8.0 with 1.0mol / L HCI, and finally fixed to 250mL.

[0082] Preparation of control reaction solution A: weigh 1.2236 g Tris, 1.9918 g MgSO 4 7H 2 O, 0.3451g sodium glutamate, 0.2422g cysteine, 0.0744g EDTA-Na 2 , respectively, after being dissolved in deionized water, the pH was adjusted to 7.4 with 1.0 mol / L HCl and the volume was fixed to 100 mL.

[0083] Preparation of complete reaction solution B: In addition to the components of reaction mixture A, add 80 mmol / L hydroxylamine hydrochloride (containing 0.5560 g hydroxylamine hydrochloride per 100 mL).

[0084] Preparation of color developer: weigh 3.3176g TCA (trichloroacetic acid) and 10.1021g FeC l3 6H 2 O, dissolve it in deionized water, add 5mL of concentrated hydrochloric acid and make up to 100mL.

[0085] Preparation of 40mmol / L ATP solution: weigh 0.2420g ATP and dissolve it in 10mL deionized water (prepare before use).

[0086] Extraction of crude enzyme solution: weigh 0.5-1.0 g of plant material into a mortar, add 5 mL of extraction buffer, grind and homogenize on an ice bath, transfer the homogenate to a centrifuge tube, centrifuge at 4°C and 15000g for 20 min, and the supernatant is the crude enzyme solution.

[0087] Determination of GS activity: Take 1.0mL of complete reaction solution (B) in a 10mL centrifuge tube, add 0.5mL of crude enzyme solution and 0.5mL of ATP solution, mix well, keep warm at 37℃ for 0.5h, add 1mL of color developer to terminate the reaction, shake well, leave at room temperature for 5min, centrifuge at 3500r / min for 10min, take the supernatant and measure the absorbance at 540nm, and use 1.0mL of control reaction solution (A) as the control.

[0088] Results calculation: GS activity (A540·g / FW / h), where: A is the absorbance at 540nm; m is the sample mass; V1 is the total volume of crude enzyme solution; V2 is the volume of crude enzyme solution added to the reaction system; t is the reaction time.

[0089] (3) Determination of glutamate content

[0090] In this experiment, the glutamate content detection kit (BC1580) provided by Solarbio Biological Company was used to determine the glutamate content in rapeseed, and the determination method was carried out according to the instructions of the kit.

[0091] like Fig. 9 As shown in Figure 2, under ammonium nitrate conditions, there was no significant change in the free ammonia content in the roots, GS enzyme activity, glutamate content, and xylem sap ammonia concentration. Only the aboveground ammonium concentration decreased in two strains. 4 + Under the treatment, the ammonium concentration in the roots of the mutant materials decreased to 79%, 71% and 67% of the wild type, the GS enzyme activity decreased significantly to 52%, 68% and 62% of the wild type, and the glutamate content decreased significantly to 70%, 65% and 52% of the wild type. There was no significant change in the aboveground part, and the xylem sap decreased to 80%, 79% and 80%. This shows that the mutation of BnaAMT1;10 affects the assimilation of ammonium in the roots and inhibits the transport of ammonium from the roots to the aboveground parts.

[0092] Example 8 Yield analysis of BnaAMT1;10 transgenic rapeseed under different nitrogen treatments

[0093] Potted experiment method: The soil for the rapeseed potted experiment was taken from Shizi Mountain of Huazhong Agricultural University. The soil type is yellow-brown soil. The basic physical and chemical properties are as follows: organic matter 6.30 mg / g, alkaline nitrogen: 9.46 mg / g, available phosphorus: 5.98 mg / g, available potassium: 213 mg / kg, pH: 7.04. The experiment set up two nitrogen treatments: normal nitrogen (CK, N is 0.3 g / kg) and low nitrogen (LN, 0.03 g / kg). The application rates of other mineral nutrients are as follows: KH 2 PO 4 .2H 2 O 0.38 g / kg, KCl 0.11 g / kg and MgSO 4 .7H 2 O 0.25g / kg. Trace elements adopt Arnon formula, add 7mL 1000× mother solution to each pot. During the application process, the macronutrient fertilizer, magnesium salt and trace elements are dissolved and mixed in pure water and then evenly poured into each pot of soil (about 1.0-1.5L water per pot).

[0094] like Fig.10 and 11 As shown in the figure, under normal nitrogen conditions, all indicators had no significant changes, but under low nitrogen conditions, the plant height of the mutant line was significantly lower than that of the wild type, and there was no significant difference in the overexpression line. The number of siliques per plant of the mutant was significantly lower than that of the wild type, and the number of siliques per plant of the overexpression line was significantly higher than that of the wild type. The yield of the mutant was reduced to 73% and 60% of that of the wild type, and the yield of the overexpression line increased by 37%. This shows that BnaAMT1;10 is beneficial to the growth and yield of rapeseed under LN conditions.

[0095] Example 9BnaAMT1;10Candidate Gene Association Analysis

[0096] 1. Candidate gene association analysis

[0097] VCFtools software was used to extract SNPs in the BnaAMT1;10 genome and the 2000bp sequence before and after, and association analysis was performed with relative fresh weight traits based on a general linear model in Tassel 5.0 software, where the threshold was generally 1 / the number of SNPs in the BnaAMT1;10 sequence. Candidate gene association analysis visualization and haplotype analysis were achieved using LDblockshow1.33 and Haploview.4.2 software, respectively.

[0098] 2. Treatment of different haplotype MeA

[0099] The light cycle of the light culture room was 16 h light / 8 h dark, the temperature was 22 °C, the humidity was 60% to 75%, and the optical density was 300 μmol / m 2 / s~320μmol / m 2The seeds were placed in a seedling dish and soaked in deionized water in a dark environment for 2 days, and then transferred to a net floating on a nutrient solution (pH = 5.8) and grown for 4 days. The nutrient solution for normal treatment contained KNO 3 5.0mM, KH 2 PO 4 1.0 mM MgSO 4 2.0mM, H 3 BO 3 46.0μM, MnCl 2 9.0μM, CuCl 2 0.3μM, ZnCl 2 0.8μM, Na 2 MoO 4 0.32μM and EDTA-Fe 50.0μM. MeA toxicity treatment was to add 20mM / LMeA to the nutrient solution of normal treatment.

[0100] 3. Low ammonium treatment of different haplotypes of rapeseed

[0101] Rapeseed in 0.5 mM CaCl 2 After 5 days of seedling cultivation, the seedlings were transferred to normal and low nitrogen treatments. Normal treatment was 3 mM NH 4 NO 3 and low nitrogen 0.1 mM NH 4 + Three biological replicates were set for each treatment. After 12 days of treatment, samples were collected from above and below ground and dried to determine relative dry weight.

[0102] 4. Short-term N of different haplotypes of rapeseed 15 Tracer experiment

[0103] First, rapeseed was cultured normally for 6 days, and then nitrogen-deficient (0 mM NH 4 + ) for 3 days, the plants were placed in 0.1 mM CaSO 4 After washing for 1 minute, the rapeseed materials with different haplotypes were transferred into 15 N-labeled 0.1 mM NH 4 + Medium treatment 10min( 15 N abundance: 10.38%). After treatment, roots of different strains were sampled, washed in 0.1 mM CaSO4 and dried in an oven. The elemental analyzer-isotope mass spectrometer (EA-Delta VMS, Thermo, USA) was used to obtain 15 N and total nitrogen contents, and calculated the ammonium absorption rate of roots of different haplotypes of rapeseed.

[0104] 5. qPCR expression analysis of different haplotypes of BnaAMT1;10

[0105] Use Promega (Beijing) Biotechnology Co., Ltd. The plant RNA was extracted using the Super Total RNA Extraction Kit (LS1040). For specific steps, refer to the kit instructions. Ⅱ1st Strand cDNA First Strand Synthesis Kit was used to convert it into cDNA. The total amount of reverse RNA was 500ng, the system was 10μL and diluted 10 times before use.

[0106] Fluorescence quantitative PCR (RT-qPCR) was performed using Yisheng Biotechnology qPCR SYBR Green Master Mix Kit was performed on a QuantStudio™ 6Flex System (Applied Biosystems, Foster City, CA). -ΔΔCt The relative expression level of genes was calculated by the method, and EF1-α (accession number: DQ312264) was used as the internal reference gene. The RT-qPCR reaction system was as follows: 2 μL of cDNA template, 0.2 μL of each specific primer, 5 μL of Hieff-qPCRSYBR Green Master Mix (Low Rox) dye and ddH 2 O 2.6μL total 10μL system. The reaction program is as follows: 95℃ pre-denaturation for 5min, 95℃ denaturation for 10s, 60℃ annealing for 20s, 72℃ extension for 20s, 40 cycles. The melting curve is the default setting of the instrument, 95℃ for 15s, 60℃ for 1min, and 95℃ for 15s.

[0107] The results are as follows Fig.12 As shown, the BnaAMT1;10 genome and the 2000bp before and after contain a total of 49 SNP sites, and their locations are shown in Table 1.

[0108] Table 1

[0109]

[0110]

[0111] There are five significant SNPs, the locations of which are shown in Table 2, four of which are located in non-coding regions and one in the CDS region.

[0112] Table 2

[0113]

[0114] like Fig.12 As shown in the figure, based on these five SNPs, BnaAMT1;10 can be divided into two haplotypes, CGCAG and TAAGC, and the phenotypic differences of the two haplotypes in the population in terms of sensitivity to methylammonium are extremely significant. Haplotype 1 has a smaller biomass under methylammonium treatment, indicating that it is more sensitive to methylammonium and is more poisoned by methylammonium. Compared with normal nutrient solution, the relative fresh weight of haplotype 1 is significantly higher than that of haplotype 2 under low ammonium conditions. At the same time, using short-term N 15 Tracing experiments showed that the ammonium absorption rate of haplotype 1 was significantly stronger than that of haplotype 2. The expression levels of the two haplotypes BnaAMT1;10 were analyzed by qPCR, and the expression level of BnaAMT1;10 in the roots of haplotype 1 was significantly higher than that of haplotype 2. This indicates that haplotype 1 has a stronger ammonium absorption capacity and is an excellent candidate haplotype.

[0115] Therefore, the above-mentioned SNP molecular marker combination can be screened and combined with the screening and breeding of rapeseed ammonium absorption and utilization ability, which has good application prospects. Specifically, direct amplification sequencing can be used, or conventional primer design tools can be used to design corresponding primers or probes for the above-mentioned SNP molecular marker combination, which can be used for molecular marker-assisted breeding of rapeseed with high ammonium utilization ability.

[0116] Example 10 Effect of significant SNPs of BnaAMT1;10 on ammonium absorption capacity

[0117] Construction of pDR196-BnaAMT1;10(Hap1 G , Hap2 C , Hap1 G→C , Hap2 C→G ) fusion vector, and PDR196 (negative control), PDR196-AtAMT1;1 (positive control), PDR196-BnaAMT1;10 (Hap1 G , Hap2 C , Hap1 G→C , Hap2 C→G ) vectors were transformed into 31019b yeast strains, and then inoculated into 20 mL of 100 mL conical flasks containing 0.17% YNB, 0.1% L-proline and 2% glucose, and incubated at 28°C, 200 r min -1 Shake the bacterial solution until the OD600 is 1-1.2. Then take 1 mL of the bacterial solution and centrifuge at 4000 r min-1 for 2 min, wash twice, and resuspend with 0.17% YNB. ​​Dilute all the bacterial solution with 0.17% YNB to OD600 of 0.5. Then use sterile water to dilute the yeast ten-fold in sequence to 4 concentration gradients, and culture on plates containing 0.2M and 2M ammonium sulfate until colonies grow.

[0118] like Fig.13 As shown in the figure, on the medium supplemented with proline, all yeasts grew normally, while on the medium with ammonium as the only nitrogen source, the growth of haplotype 1 yeast was stronger than that of haplotype 2. There is only one SNP (ChrC06:13883423) in the CDS region of BnaAMT1;10. It is speculated that this site plays an important role in the ammonium absorption of BnaAMT1;10, so the G of haplotype 1 was mutated to C, and the C of haplotype 2 was mutated to G. The results showed that the growth of yeast with haplotype 2 point mutation became stronger, while the growth of yeast with haplotype 2 point mutation became weaker, indicating that this site is crucial for the transport activity of BnaAMT1;10.

[0119] The above specific embodiments describe the implementation of the present invention in detail, but the present invention is not limited to the specific details in the above embodiments. Within the scope of the claims and technical concept of the present invention, the technical solution of the present invention can be modified and changed in many simple ways, and these simple modifications all belong to the protection scope of the present invention.

Claims

1. Application of rapeseed ammonium transporter BnaAMT1;10 in any of the following: A1) improving the nitrogen utilization, number of siliques per plant and / or yield of rapeseed; A2) preparing products for improving nitrogen utilization, number of siliques per plant and / or yield of rapeseed; A3) Enhance the growth and development of rapeseed under low nitrogen conditions; A4) preparing a product for enhancing the growth and development of rapeseed under low nitrogen conditions.

2. The use according to claim 1, characterized in that: The amino acid sequence encoded by BnaAMT1;10 is shown in SEQ ID NO:2, and the nucleotide sequence of BnaAMT1;10 is shown in SEQ ID NO:

1.

3. A method for improving rapeseed nitrogen utilization, number of siliques per plant, yield and / or enhancing rapeseed growth and development under low nitrogen conditions, characterized in that: Overexpression of BnaAMT1;10 in rapeseed.

4. The method according to claim 3, characterized in that The amino acid sequence encoded by BnaAMT1;10 is shown in SEQ ID NO:2, and the nucleotide sequence of BnaAMT1;10 is shown in SEQ ID NO:

1.

5. A SNP molecular marker combination significantly associated with ammonium utilization in rapeseed, characterized in that: Taking the rapeseed genome version: Westar.v0 as a reference, the molecular marker combination includes ChrC06:13880756, ChrC06:13880762, ChrC06:13880785, ChrC06:13880795, and ChrC06:13883423.

6. The molecular marker combination according to claim 5, characterized in that: When the base sequence of the molecular marker combination is CGCAG, rapeseed shows a phenotype of high ammonium utilization ability, and when the base sequence is TAAGC, rapeseed shows a phenotype of low ammonium utilization ability.

7. Use of a substance for detecting a molecular marker combination according to any one of claims 5 to 6 in any of the following: B1) Identify or assist in identifying rapeseed nitrogen utilization; B2) preparing and identifying or assisting in the identification of rapeseed nitrogen utilization products; B3) Rapeseed breeding or preparation of rapeseed breeding products.

8. Use of a substance for detecting a SNP significantly associated with ammonium utilization in rapeseed in identifying or assisting in identifying the ammonium utilization ability of rapeseed, characterized in that: The SNP is ChrC06:13883423, with the rapeseed genome version: Westar.v0 as a reference.

9. A method for detecting the ammonium utilization ability of rapeseed, identifying or assisting in the identification of the ammonium utilization ability of rapeseed, predicting the ammonium utilization ability of rapeseed or assisting in the breeding of rapeseed with high ammonium utilization ability, characterized in that: Taking rapeseed genome version: Westar.v0 as reference, C1) detecting the base sequence of ChrC06:13883423 in rapeseed, when it is G, it indicates that the ammonium utilization capacity of rapeseed is high, and when it is C, it indicates that the ammonium utilization capacity of rapeseed is low; C2) The base sequences of ChrC06:13880756, ChrC06:13880762, ChrC06:13880785, ChrC06:13880795, and ChrC06:13883423 in rapeseed were detected. When the base sequence was CGCAG, rapeseed showed high ammonium utilization ability, and when the base sequence was TAAGC, rapeseed showed low ammonium utilization ability.

Images