CD19-targeted extracellular vesicle as well as preparation method and application thereof

Abstract

The invention discloses a CD19-targeted extracellular vesicle as well as a preparation method and application thereof. An anti-CD19 single-chain antibody is over-expressed on the outer surface of the extracellular vesicle. The preparation method of the CD19-targeted extracellular vesicle comprises the following steps: S1, constructing an anti-CD19 single-chain antibody overexpression lentivirus plasmid; s2, screening to obtain mesenchymal stem cells capable of stably and highly expressing the anti-CD19 single-chain antibody; s3, placing the mesenchymal stem cells obtained in the step S2 in a serum-free DMEM / F12 culture medium, adding cytochalasin b for culture, collecting cell culture supernatant, and then obtaining the mesenchymal stem cell-derived extracellular vesicles overexpressing the anti-CD19 single-chain antibody through a gradient centrifugation method. According to the invention, the extracellular vesicle with B cell targeting can be prepared, and the extracellular vesicle is taken as a carrier to deliver drugs, so that the biological safety is high, and the toxic and side effects are low.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to an extracellular vesicle targeting CD19 and a preparation method and application thereof. Background Art

[0002] Systemic lupus erythematosus (SLE) is an autoimmune disease that affects multiple organs and systems throughout the body. Its pathogenesis is complex and the disease varies. The mortality rate of confirmed patients can reach 2.4%-5.9%. Recent studies have found that long-lived plasma cells (LLPCs) differentiated from abnormally activated B cells have increased significantly in SLE animal models and patients. Their long survival cycle and continuous antibody production are important factors for the prolonged relapse of SLE in the middle and late stages. Therefore, the effective inhibition and clearance of B cells has always been an important exploration direction in the research of new and efficient clinical treatment methods.

[0003] Extracellular vesicles (EVs) are a general term for lipid bilayer structures secreted by cells to the outside world. In recent years, their diagnostic and therapeutic value in diseases has been recognized and widely used by researchers. EV-based delivery technology has many advantages: 1) Compared with traditional nano-delivery materials such as liposomes and nano-metal particles, EVs have better biosafety, their preparation does not involve chemical processes, and their toxicity and rejection reactions in vivo are small; 2) EVs are naturally derived from cells, and their structure can be well recognized and absorbed by cells, and can be widely delivered through biological barriers such as the blood-brain barrier; 3) The delivery substances are diverse and can be compatible with various small molecule drugs, nucleic acids, proteins, etc., to achieve personalized functions. In recent years, in order to achieve more precise delivery functions, researchers have biologically modified and transformed EVs to make EVs targeted, so as to achieve specific effects on target cell populations or target organs. Targeted EVs under biological modification have been widely used in tumor killing, gene editing and other treatments. The current use of B cell-related small molecule drugs in clinical practice still has many limitations and application bottlenecks: 1) Chemically synthesized small molecule drugs have relatively clear drug action mechanisms, but their range of action is wide, and they are distributed throughout the body after administration, bringing many side effects that are irrelevant to the therapeutic effect or harmful. Taking fludarabine as an example, as a B cell-killing drug, although it has shown good effects in the treatment of SLE animal models and the clinical treatment of lupus nephritis, fludarabine also has a killing effect on normal cells, which can cause serious side effects such as bone marrow suppression and central nervous system toxicity, which greatly limits its further application in the treatment of SLE in recent years. 2) Ordinary chemically synthesized drugs have a short half-life in the body, and patients often need to take them orally intermittently to maintain blood drug concentrations. Some drugs fail to play a good role in the body due to metabolic loss or poor absorption. New small molecule nucleic acid drugs such as siRNA also have the problem of poor stability in the blood and easy degradation by endonucleases. These factors all lead to low drug bioavailability and failure to play their pharmacological effects. 3) Traditional nano-delivery materials such as liposomes and nano-metal particles may cause toxicity and rejection reactions in the human body when used for in vivo drug delivery. Therefore, it is very necessary to provide a cell microvesicle with B cell targeting to achieve targeted treatment of systemic lupus erythematosus. Summary of the invention

[0004] The primary purpose of the present invention is to provide an extracellular vesicle targeting CD19 and a preparation method and application thereof, so as to be used in a drug delivery system for the treatment of systemic lupus erythematosus. At the same time, the carrier has the advantages of low immunogenicity and does not cause immune and rejection reactions in the body.

[0005] To achieve this object, in a basic embodiment, the present invention provides an extracellular vesicle targeting CD19, the outer surface of which overexpresses an anti-CD19 single-chain antibody.

[0006] Preferably, the extracellular vesicles are mesenchymal stem cell extracellular vesicles.

[0007] Preferably, the mesenchymal stem cells are umbilical cord-derived mesenchymal stem cells.

[0008] In a second aspect, the present invention provides a method for preparing extracellular vesicles targeting CD19, comprising the following steps: S1: constructing an anti-CD19 single-chain antibody overexpression lentiviral plasmid, using HEK293T cells to encapsulate the viral plasmid, and obtaining a viral liquid capable of infecting target cells, wherein the viral liquid can specifically express the CD19 single-chain antibody on the cell membrane surface of the target cells; S2: transfecting mesenchymal stem cells with the virus solution obtained in step S1, and screening to obtain mesenchymal stem cells that stably and highly express anti-CD19 single-chain antibody; S3: The mesenchymal stem cells obtained in step S2 are placed in a serum-free DMEM / F12 culture medium and cytochalasin b is added for culture, the cell culture supernatant is collected, and then the mesenchymal stem cell-derived extracellular vesicles overexpressing the anti-CD19 single-chain antibody are obtained by gradient centrifugation.

[0009] Preferably, in step S2, 0.5-2 μg / mL puromycin is used for screening.

[0010] Preferably, in step S3, the gradient centrifugation method comprises the following steps: (i) vortexing the cell culture supernatant for 1 minute, centrifuging at 500 g for 5 minutes, and collecting the supernatant to obtain a first centrifuged supernatant; (ii) centrifuging the first centrifugal supernatant at 2000 g for 20 min, taking the supernatant to obtain a second centrifugal supernatant; (iii) centrifuging the second centrifugal supernatant at 100,000 g for 60 min, collecting the precipitate, and obtaining extracellular vesicles derived from mesenchymal stem cells that overexpress the anti-CD19 single-chain antibody.

[0011] In a third aspect, the present invention provides an application of extracellular vesicles targeting CD19 in the preparation of drugs for treating autoimmune diseases.

[0012] Preferably, the drug for treating autoimmune diseases is used to inhibit B cell proliferation, and the autoimmune diseases include systemic lupus erythematosus.

[0013] In a fourth aspect, the present invention provides a drug delivery system of extracellular vesicles targeting CD19, comprising the extracellular vesicles as described above, and a drug body loaded inside the extracellular vesicles.

[0014] Preferably, the drug substance comprises fludarabine.

[0015] Beneficial effects: 1. The extracellular vesicles of the present invention have a clear scope of action: The present invention designs an extracellular vesicle with B cell targeting, and the surface of the vesicle carries a modified and expressed anti-CD19 antibody fragment that can specifically bind to the CD19 membrane protein on the surface of the B cell. The extracellular vesicles of the present invention can deliver the loaded drugs into the B cells, so that most of the drugs only act on the B cells in the body, greatly reducing the damage of the drugs to other normal cells or tissues.

[0016] 2. The extracellular vesicles of the present invention can improve in vivo bioavailability: the extracellular vesicles designed in the present invention are loaded with drugs, and the lipid bilayer wraps the drugs in the membrane. After being injected into the blood, the vesicles can be taken into cells under endocytosis and release the drugs after rupture, allowing the drugs to enter directly, thereby achieving higher utilization efficiency and drug sustained-release ability.

[0017] 3. The present invention has good biosafety: the extracellular vesicles used are derived from mesenchymal stem cells, especially umbilical cord-derived mesenchymal stem cells. These cells have been confirmed by many studies to have extremely low immunogenicity and will not cause immune and rejection reactions in the body. The extracellular vesicles produced by them also have this characteristic. The extracellular vesicles are used as carriers to deliver drugs, which has high biosafety and extremely low toxic side effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of the partial structure of the lentiviral plasmid overexpressing anti-CD19 scFvs; Figure 2 The expression of myc protein on the cell membrane surface: A is a flow cytometry image of myc-tagged protein representing the expression of CD19 single-chain antibody, and B is a western blot image of myc-tagged protein representing the expression of CD19 single-chain antibody; Figure 3 The extraction and basic structural morphology of extracellular vesicles: A is a flowchart of EVs extraction, B is a process diagram of EVs release from mesenchymal stem cells under a confocal microscope; C is a zeta potential analysis of BEVs and EVs, and D is a morphological structure diagram of BEVs under a transmission electron microscope; Figure 4Comparison of in vitro targeting detection of BEVs and EVs of the present invention: A is the fluorescence image of BEVs and unmodified EVs co-cultured with 293T cells overexpressing CD19 (with cherry red light) for 1h and 4h, B is the flow cytometry image of BEVs and unmodified EVs co-cultured with 293T cells overexpressing CD19 (with cherry red light) for 1h and 4h (upper figure) and DiD + Frequency statistics results (below), C is the DiD of BEVs and unmodified EVs + Frequency statistics table; Figure 5 The in vivo distribution of B cell-targeted EVs of the present invention: A is the in vivo imaging of MRL / lpr mice 24 hours after tail vein injection of DiR-labeled BEVs and unmodified EVs, and B is the in vivo imaging of MRL / lpr mice viscera 48 hours after tail vein injection of DiR-labeled BEVs and unmodified EVs. DETAILED DESCRIPTION

[0019] The present invention will be further explained below in conjunction with the accompanying drawings and embodiments.

[0020] The present invention can be better understood according to the following examples. However, it is easy for those skilled in the art to understand that the specific material ratios, process conditions and results described in the examples are only used to illustrate the present invention.

[0021] Example 1: Construction of recombinant lentiviral plasmid overexpressing anti-CD19 scFvs In this example, a recombinant lentiviral plasmid with an overexpressed anti-CD19 single chain variable fragment (scFvs) was constructed, and the specific process was as follows: First, the commercially available plvx-CMV-pgk-puro plasmid was used as the backbone. The human CD80 protein transmembrane domain sequence (nucleotide sequence as shown in SEQ ID NO: 1) was inserted after its CMV promoter. Subsequently, the anti-mouse CD19 antibody scFvs sequence (nucleotide sequence as shown in SEQ ID NO: 2) and the myc tag sequence (nucleotide sequence as shown in SEQ ID NO: 3) were co-inserted into the 5' end of the human CD80 protein transmembrane domain to construct a recombinant lentiviral plasmid that can overexpress anti-CD19 scFvs outside the cell membrane. Figure 1 Schematic diagram of the partial structure of the obtained recombinant vector.

[0022] The sequence information involved in the above process is: SEQ ID NO: 1 Ctgctcccatcctgggccattaccttaatctcagtaaatggaatttttgtgatatgctgcctgacctactgctttgccccaagatgcagagagagaaggaggaatgagagattgagaagggaaagtgtacgccctgta。

[0023] SEQ ID NO:2 ATGGGCGTCCCCACTCAGCTCCTGGGCTTATTGTTGCTGTGGATCACAGATGCCATCTGTGACATTCAGATGACACAAAGTCCTGCGTCCTTAAGCACGTCTCTTGGAGAAACCGTCACCATCCAGTGCCAAGCTTCAGAGGACATCTACTCAGGACTAGCCTGGTACCAGCAGAAGCCAGGCAAAAGCCCTCAGCTTCTCATTTATGGGGCTTCAGACCTGCAAGATGGAGTTCCCTCCAGATTTTCGGGTTCAGGATCCGGTACCCAGTATAGCCTGAAGATAACCTCCATGCAGACAGAAGATGAGGGGGTCTATTTCTGTCAGCAGGGCTTGACCTATCCTCGAACCTTTGGGGGAGGGACTAAACTAGAACTTAAAGGTGGAGGAGGCTCTGGGGGCGGCGGGAGCGGAGGAGGTGGCTCCGAGGTGCAGCTGCAGCAAAGTGGGGCTGAGCTGGTGCGCCCAGGAACAAGCGTAAAGCTGTCCTGCAAGGTATCAGGTGATACTATAACGTTCTACTACATGCACTTTGTGAAGCAGCGGCCGGGGCAAGGCTTGGAGTGGATTGGCAGGATTGACCCAGAGGATGAAAGCACGAAGTATTCAGAGAAGTTCAAGAATAAAGCCACTCTCACTGCAGACACCAGCAGCAACACAGCCTACCTGAAACTCAGTTCTCTGACTTCTGAAGACACAGCAACCTACTTCTGCATCTATGGAGGCTATTACTTTGACTACTGGGGCCAGGGTGTGATGGTGACAGTTAGTTCT。

[0024] SEQ ID NO:3 Gagcaaaaacttatctctgaagaggacctc.

[0025] Example 2: Preparation of concentrated virus solution HEK293T cells were plated in a T75 culture flask and grown to a density of 70%. The lentiviral plasmid, packaging plasmid psPAX2, and pMD.2G obtained in Example 1 were mixed in a mass ratio of 8:10:6, and transfected into HEK293T cells with the assistance of EZ Trans Plus cell transfection reagent (Li Ji Biology, catalog number AC04L092) for virus packaging. After culturing at 37°C for 24 hours, the liquid was changed, and then the culture was continued for 48 hours. After the culture was completed, the supernatant was collected by centrifugation. The obtained supernatant was filtered through a 0.45μm filter to remove cell clusters and cell debris, and 5x PEG 8000 (Aladdin, catalog number: P274350) was added. The mixture was inverted and mixed every 20 minutes. After inversion and mixing for a total of three times, it was placed at 4°C for 12 hours, and then centrifuged at 4000g for 20 minutes to obtain a virus precipitate. Finally, the obtained virus precipitate was resuspended with 100μL PBS to obtain a concentrated virus solution.

[0026] Example 3: Detection of myc protein expression on membrane surface In this implementation, the overexpression of CD19 single-chain antibody in umbilical cord mesenchymal stem cells (UC-MSCs) was investigated, and the expression on the cell membrane was verified. First, the umbilical cord-derived mesenchymal stem cells UC-MSCs were cultured in a T75 cell culture flask to a density of 30% confluence, and 40 μl of the concentrated virus solution obtained in Example 2 and 10 μg / ml polybrene (MCE, catalog number: HY-112735) were added to the culture supernatant. The medium was changed after 24 hours of culture. After the umbilical cord-derived mesenchymal stem cells UC-MSCs grew to 90% confluence, they were passaged at a ratio of 1:3 and 1 μg / mL puromycin was added for screening. After 48 hours, the medium was changed and cultured. After growing to 90% confluence, the cells were digested, and the expression of myc protein on the membrane surface was detected by flow cytometry and western blot. The results are shown in the figure. Figure 2 A and 2B. Figure 2 As shown in A, MSCs overexpressing CD19 single-chain antibody showed positive fluorescence of myc protein, which confirmed the expression of myc protein on the cell membrane of MSCs. Figure 2 As shown in B, the western blot results confirmed the expression of myc protein. Since myc protein is linked to the CD19 single-chain antibody, the above results indicate that the CD19 single-chain antibody is successfully expressed on the MSC membrane.

[0027] Example 4: Extracellular vesicles EVs extraction UC-MSCs cell lines overexpressing CD19 single-chain antibody and blank control umbilical cord-derived mesenchymal stem cells UC-MSCs were cultured in T75 cell culture flasks. After growing to 90% confluence, the culture supernatant was aspirated to obtain culture precipitates. The obtained precipitates were washed with PBS, and serum-free DMEM / F12 medium (Bio-Channel, Catalog No.: BC-M-002) and 10μg / ml cytochalasin b (MCE, Catalog No.: HY-16928) were added to stimulate the cells to secrete EVs. After reacting in a 37°C incubator for 30 minutes, the supernatant and digested cell suspension were taken, vortexed for 1 minute, and centrifuged at 500g for 5 minutes to remove cells to obtain the first supernatant. The obtained first supernatant was centrifuged at 2000g for 20 minutes to remove cell debris and dead cells to obtain the second supernatant. The obtained second supernatant was centrifuged at 100000 g for 60 min, and the precipitate was collected to obtain extracellular vesicles derived from mesenchymal stem cells overexpressing anti-CD19 single-chain antibodies. Finally, an appropriate amount of PBS was added to resuspend the obtained extracellular vesicles to 100 μg / ml to obtain an extracellular vesicle solution.

[0028] According to the above method, the extracellular vesicles extracted from the UC-MSCs cell line overexpressing CD19 single-chain antibody are called B cell-targeted extracellular vesicles, abbreviated as BEVs; the extracellular vesicles extracted from the blank control umbilical cord-derived mesenchymal stem cells UC-MSCs are abbreviated as EVs. Figure 3 A is a flow chart of extracellular vesicle extraction. Figure 3 B shows the release process of BEVs from UC-MSCs under confocal microscopy.

[0029] In order to compare the membrane structure stability between BEVs and EVs, 100ul of the prepared BEVs and EVs solutions were taken, 800ul of deionized water was added, mixed evenly and added to the quartz sample tube for detection, and then placed in a particle size detector for zeta potential analysis. The results are shown in 3C. Figure 3 As shown in Figure C, the zeta potential values ​​of EVs and BEVs are -11.66 mV and -10.25 mV, respectively, indicating that the modified BEVs are not much different from EVs and can still maintain a stable membrane structure.

[0030] In order to further study the structural characteristics of BEVs, 50 μl of the prepared BEVs suspension was dripped onto a 200-mesh copper grid (with a sealing film underneath), and tungsten phosphate negative staining was added for 2 min. The grid was then placed under a transmission electron microscope for observation and photography. The morphology and size of BEVs observed under the transmission electron microscope were recorded, and EVs were used as a control. The results are shown in Figure 3 D. As Figure 3As shown in D, the obtained BEVs exhibited a double-layer membrane structure with a diameter of approximately 400 nm.

[0031] The above results indicate that extracellular vesicles EVs can be successfully extracted using the method of this example.

[0032] Experimental Example 5: In vitro targeting detection of B cell-targeting EVs In order to study the difference in in vitro targeting between BEVs and EVs, 30 μl of the BEVs and EVs suspensions obtained in Example 4 were taken, 10 μM DiD dye (Biyuntian, Catalog No.: C1039) or DiO (Biyuntian, Catalog No.: C1038) were added, and the volume was adjusted to 500 μl with PBS. Incubate at 37°C for 30 min, then centrifuge at 100000g for 60 min to remove excess dye and take the precipitate. The precipitate was resuspended in PBS and the EVs concentration was detected using the BCA protein detection kit (Keygen, Catalog No.: KGB2101). BEVs and blank EVs labeled with DiD dye were added to HEK293T cells overexpressing mouse CD19 in a 96-well plate at three concentration gradients of 1 μg / ml, 2 μg / ml, and 4 μg / ml (blank control wells were also set). After incubation for 1h, 2h, 4h, 8h and 24h, the cell DiD fluorescence intensity was detected using a flow cytometer, and the DiD fluorescence intensity was counted. + Cell ratio, results are shown in Figure 4 B-4C. The upper picture of 4B shows the DiD fluorescence intensity of cells combined with BEVs and EVs detected by flow cytometry, and the lower picture shows the DiD fluorescence intensity of cells combined with BEVs and EVs. + Proportional statistics, 4C is DiD + The above results show that within the same incubation time, the proportion of cells bound to vesicles in the BEVs group is higher (circled positive group in the figure above) and DiD + The frequency was higher, which proved that BEVs had better binding ability to cells expressing CD19 membrane protein.

[0033] To further investigate the in vitro phagocytosis of BEVs and EVs, DiO dye-labeled EVs and BEVs were added to 24-well confocal culture dishes at concentrations of 1 μg / ml, 2 μg / ml, and 4 μg / ml, respectively. After 1 h, 2 h, 4 h, 8 h, and 24 h, paraformaldehyde was added for fixation and Dapi staining. The uptake of EVs and BEVs by HEK293T cells was observed under a confocal microscope, and photos were taken as shown in the figure. Figure 4 As shown in A. Figure 4 A is the fluorescence image of BEVs and unmodified EVs co-cultured with 293T cells overexpressing CD19 for 1h and 4h. Figure 4As shown in A, regardless of the incubation time of 1 h or 4 h, BEVs had a higher degree of cell vesicle phagocytosis than the EVs group (i.e., manifested as a stronger green light intensity).

[0034] Experimental Example 6: Evaluation of the in vivo distribution of BEVs In this example, the in vivo distribution of BEVs and EVs was investigated: 100 μl of the BEVs and EVs suspensions obtained in Example 4 were taken respectively, and 10 μM DiR dye (Baiying Biotechnology, Catalog No.: 22070) was added to obtain a mixed solution. The obtained mixed solution was incubated at 37°C for 30 min, fixed to 500 μl with PBS, centrifuged at 100,000g for 60 min to remove excess dye, and the precipitate was taken. The concentration was measured after resuspending the precipitate with PBS, and injected into the body of MRL / lpr lupus model mice (source: Shanghai Slake Laboratory Animal Co., Ltd.) with an age of 14 weeks in the disease cycle through the tail vein at a weight-to-body ratio of 1 μg / g. 40 μg was injected into each mouse, and the fluorescence distribution was observed by a live animal imager 48 hours after administration. The results are shown in 5A. Figure 5 As shown in A, it can be observed that both EVs and BEVs in mice show high-intensity fluorescence, and the fluorescence intensity of BEVs is higher than that of EVs. This result shows that compared with EVs, BEVs have a better retention effect after binding to B cells in vivo.

[0035] The mice were killed 48 hours after drug treatment, and the organs were removed and placed in a 10 cm dish. The fluorescence distribution was photographed using a live animal imaging device. The results are shown in 5B. Figure 5 As shown in B, the spleen of mice in the BEVs group had stronger fluorescence. This result indicates that compared with EVs, the B cell binding ability of BEVs makes them more enriched in the spleen, thereby being able to play a targeting role.

[0036] The above results show that B cell-targeted vesicles (BEVs) are more enriched in the spleen (the location shown by the red circle) than ordinary vesicles (EVs), indicating the targeting of BEVs to B cell-enriched areas.

[0037] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An extracellular vesicle targeting CD19, characterized in that: The outer surface of the extracellular vesicles overexpresses anti-CD19 single-chain antibody.

2. The extracellular vesicle according to claim 1, characterized in that The extracellular vesicles are mesenchymal stem cell extracellular vesicles.

3. The extracellular vesicle according to claim 2, characterized in that The mesenchymal stem cells are umbilical cord-derived mesenchymal stem cells.

4. The method for preparing CD19-targeting extracellular vesicles according to any one of claims 1 to 3, characterized in that: The following steps are involved: S1: constructing an anti-CD19 single-chain antibody overexpression lentiviral plasmid, using HEK293T cells to encapsulate the viral plasmid, and obtaining a viral liquid capable of infecting target cells, wherein the viral liquid can specifically express the CD19 single-chain antibody on the cell membrane surface of the target cells; S2: transfecting mesenchymal stem cells with the virus solution obtained in step S1, and screening to obtain mesenchymal stem cells that stably and highly express anti-CD19 single-chain antibodies; S3: The mesenchymal stem cells obtained in step S2 are placed in a serum-free DMEM / F12 culture medium and cytochalasin b is added for culture, the cell culture supernatant is collected, and then the mesenchymal stem cell-derived extracellular vesicles overexpressing the anti-CD19 single-chain antibody are obtained by gradient centrifugation.

5. The preparation method according to claim 4, characterized in that: In step S2, 0.5-2 μg / mL puromycin is used for screening.

6. The preparation method according to claim 4, characterized in that: In step S3, the gradient centrifugation method comprises the following steps: (i) vortexing the cell culture supernatant for 1 minute, centrifuging at 500 g for 5 minutes, and collecting the supernatant to obtain a first centrifuged supernatant; (ii) centrifuging the first centrifugal supernatant at 2000 g for 20 min, taking the supernatant to obtain a second centrifugal supernatant; (iii) centrifuging the second centrifugal supernatant at 100,000 g for 60 min, collecting the precipitate, and obtaining extracellular vesicles derived from mesenchymal stem cells that overexpress the anti-CD19 single-chain antibody.

7. Use of the extracellular vesicles according to any one of claims 1 to 3 in the preparation of drugs for treating autoimmune diseases.

8. The use according to claim 7, characterized in that: The drug for treating autoimmune diseases is used for inhibiting B cell proliferation, and the autoimmune diseases include systemic lupus erythematosus.

9. A drug delivery system of extracellular vesicles targeting CD19, characterized in that: It comprises the extracellular vesicle according to any one of claims 1 to 3, and a drug body loaded inside the extracellular vesicle.

10. The drug delivery system according to claim 9, characterized in that: The drug substance includes fludarabine.

Images