Rice embryo specific expression transfluorescent protein gene and Malt gene editing integrated vector as well as construction method and application thereof

Abstract

The invention relates to a rice embryo specific expression transfluorescent protein gene and Malt gene editing integrated vector and a preparation method thereof, the vector comprises a gene editing fragment and a fluorescent protein gene fragment, the sequence of the gene editing fragment is shown as SEQ ID NO.1; the sequence of the fluorescent protein gene segment is as shown in SEQ ID NO. 2; when the vector is applied to a molecular detection technology, a rice induction line with a homozygous embryo-specific expression transfluorescent protein gene and a mutant gene can be screened out, and the time for creating the induction line with the embryo-specific expression transfluorescent protein gene is saved, so that the cost is saved.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and more specifically to a rice embryo-specific expression transgenic fluorescent protein gene and Malt gene editing integrated vector, and a construction method and application thereof. Background Art

[0002] Recent studies on maize haploid induction lines at home and abroad have shown that the insertion mutation of the lipase gene specifically expressed in maize sperm cells is the basis for the induction line to have the haploid induction function (KELLIHER T et al., 2017; LIU C et al., 2017), and pointed out that the lipase gene is relatively conservative in evolution (LIU C et al., 2017). Using modern gene editing technology to edit related genes, it is possible to create rice induction lines. The induction frequency of rice haploid induction lines is not high, generally around 5%, so there is a problem of how to screen haploids. In order to solve the problem of screening haploids, rice materials with markers are usually used to prepare rice haploids. Currently, there are several main ways to create induced lines of haploid rice seeds: (1) Using ordinary rice materials as precursor materials, using gene editing technology to edit related genes, and creating rice induced lines; (2) Using rice materials with dominant colored genes, using gene editing technology to edit related genes, and creating rice induced lines; (3) Using transgenic rice materials with specific trait genes (such as fluorescent protein genes) as precursor materials, using gene editing technology to edit related genes, and creating rice induced lines.

[0003] The above-mentioned vector construction methods for creating rice induction lines are simple and easy to operate, but it is very time-consuming and labor-intensive to obtain induction lines that are homozygous for both marker genes and induction genes. Summary of the invention

[0004] Based on the above technical problems existing in the prior art, the present invention provides a rice embryo-specific expression transgenic fluorescent protein gene and Malt gene editing integrated vector and a preparation method thereof. The vector is applied to molecular detection technology to screen out rice induced lines carrying homozygous embryo-specific expression transgenic fluorescent protein gene and mutant gene, saving the time for creating induced lines carrying embryo-specific expression transgenic fluorescent protein gene, thereby saving costs.

[0005] In order to achieve the above object, the technical solution of the present invention is as follows:

[0006] A rice embryo-specific expression transgenic fluorescent protein gene and Mat1 gene editing integrated vector, the vector comprising a gene editing fragment and a fluorescent protein gene fragment, the nucleotide sequence of the gene editing fragment is shown in SEQ ID NO.1; the sequence of the fluorescent protein gene fragment is shown in SEQ ID NO.2.

[0007] The present invention also provides a method for constructing the above-mentioned rice embryo-specific expression transgenic fluorescent protein gene and Mat1 gene editing integrated vector, the method comprising the following steps:

[0008] S1. Using the rice genome as a template, design specific primers, and after PCR amplification, recover the target fragment by gel electrophoresis to obtain an embryo-specific expression transgenic fluorescent protein gene expression cassette; the upstream primer sequence of the expression cassette is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4;

[0009] S2, digesting the knockout vector with endonuclease SgsI, cutting out the electrophoretic fragment of the linearized vector, and recovering the target fragment;

[0010] S3, homologous recombination ligation: the embryo-specific expression transgenic fluorescent protein gene expression cassette obtained in step S1 is connected to the linearized vector by homologous recombination ligation to obtain a ligation product;

[0011] S4. Add the ligation product to the competent E. coli cells, culture them, screen the positive clones, detect by PCR, extract the plasmids and sequence them. If the sequencing result is consistent with the sequence of the target fragment, the expression vector is successfully constructed.

[0012] In some embodiments, in step S1, the PCR reaction system of the expression cassette is: 2×buffer 25 μL, 2 mM dNTPs 10 μL, upstream primer 1 μL, downstream primer 1 μL, KOD-FX polymerase 1 μL, vector DNA 1 μL, and ddH2O to 50 μL.

[0013] In some embodiments, in step S1, the PCR reaction conditions of the expression cassette are: 94°C for 2 min; 98°C for 10 s, 60°C for 30 s, 68°C for 2:20 min, for 32 cycles; and 68°C for extension for 6 min.

[0014] In some embodiments, in step S3, the homologous recombination ligation system is: Gibson assembly mix 5 μL, linearized empty load 100 ng, target fragment 50 ng, add ddH2O to 10 μL; reaction conditions are: treatment at 50°C for 30 min.

[0015] In some embodiments, in step S4, colony PCR detection is performed using a specific primer pair, and the band size is 1639 bp; the sequences of the upstream primer J and the downstream primer RB-R of the primer pair are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

[0016] In some embodiments, the reaction system for colony PCR amplification is: 2×Taq MIX 10μL, upstream primer J0.5μL, downstream primer RB-R 0.5μL, pick a small amount of colonies, add ddH2O to 20μL; the reaction conditions for colony PCR amplification are: 25×, 95℃ pre-denaturation for 5min, 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 2min, and 72℃ final extension for 5min.

[0017] In some embodiments, in step S4, plasmid extraction comprises the following steps:

[0018] (1) Pick a single clone from the LB solid medium plate and inoculate it into LB liquid medium with kanamycin resistance at a final concentration of 50 μg / mL, and culture it at 37°C overnight;

[0019] (2) Take the activated bacterial solution, centrifuge it at 10,000 rpm for 2 min at room temperature, and discard the supernatant completely;

[0020] (3) Take Solution I reagent containing RNase A and thoroughly resuspend the bacterial mass;

[0021] (4) Take Solution II reagent to lyse the bacterial mass and turn it upside down several times until the bacteria become transparent;

[0022] (5) Take Solution III reagent and invert it several times until a white, compact flocculent substance is formed;

[0023] (6) Centrifuge at 12000 rpm for 10 min at room temperature and collect the supernatant;

[0024] (7) Take out the nucleic acid purification column from the kit, take the supernatant obtained in step (6) into the nucleic acid purification column, centrifuge at room temperature 12000 rpm for 1 min, and discard the filtrate;

[0025] (8) Add Buffer W1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0026] (9) Add Buffer W2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0027] (10) Repeat the above step (9);

[0028] (11) Place the nucleic acid purification column on the collection tube and spin at 12000 rpm for 2 min at room temperature to remove as much residual liquid as possible;

[0029] (12) Discard the collection tube, place the nucleic acid purification column in a 1.5 mL EP tube, and add 50 μL of elution solution to elute the DNA attached to the nucleic acid purification column membrane (the elution solution can be preheated in a 65°C constant temperature water bath to help elute the DNA), and let it stand at room temperature for 2 min;

[0030] (13) Centrifuge at 12000 rpm for 2 min at room temperature to elute the DNA attached to the nucleic acid purification column membrane and store in a -40°C low-temperature refrigerator for later use;

[0031] (14) Take a portion of the recovered product and use 1% agarose gel electrophoresis to detect the quality of plasmid extraction.

[0032] In some embodiments, in step S4, the extracted plasmid is subjected to Sanger sequencing, using primer RB-F with a sequence as shown in SEQ ID NO.7 and primer RB-R with a sequence as shown in SEQ ID NO.6 as sequencing primers for sequencing.

[0033] The present invention also provides the application of the above-mentioned vector as a material for creating haploid rice induction lines.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] The present invention uses rice embryo-specific expression of transgenic fluorescent protein gene and Mat1 gene editing integrated vector. Molecular detection technology is applied to obtain homozygous individuals of mutant genes in T1 plants. After one generation of self-fertilization, rice induced lines with homozygous embryo-specific expression of transgenic fluorescent protein gene and mutant gene can be screened out, and the rice induced lines can be used to produce rice haploid seeds in the field.

[0036] The present invention can greatly save the time for creating an induction line with embryo-specific expression of a transgenic fluorescent protein gene, thereby also saving costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 Schematic diagram of the knockout vector pEGCas9Pubi-H-matl;

[0038] Figure 2 This is a structural diagram of the rice embryo-specific expression vector for transgenic fluorescent protein gene and Malt gene editing constructed in this application. DETAILED DESCRIPTION

[0039] Many specific details are set forth in the following description to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways than those described herein, and those skilled in the art can make similar modifications without violating the connotation of the present invention, so the present invention is not limited to the specific implementation disclosed below.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0041] Example 1

[0042] A method for constructing a rice embryo-specific expression vector for a transgenic fluorescent protein gene and a Malt gene editing vector comprises the following steps:

[0043] 1. Primer design

[0044] F:AATAAAGGAGGCAGCTATGACTAGTTA

[0045] CTTCGGCCCCACAATGGAATCT

[0046] R:ACGATGTAGGAGATCGATGCAT

[0047] CTTAAGAAACACACCTAGACTAGATTTGTTTTGCT

[0048] J:ACCATCACACCATCGGACAC

[0049] RB-R:AAGTTGGGTAACGCCAGGGT

[0050] SP-L:GCGGTGTCATCTATGTTACTAG

[0051] The specific construction method includes the following steps:

[0052] S1. Preparation of a rice embryo-specific expression transgenic fluorescent protein gene expression cassette: Using the Nipponbare rice genome as a template, designing specific primers, and recovering the target fragment by gel electrophoresis after PCR amplification to obtain a rice embryo-specific expression transgenic fluorescent protein gene expression cassette;

[0053] Wherein, the sequences of the upstream primer and the downstream primer of the primer pair of the expression cassette are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively; specifically:

[0054] Upstream primer F: AATAAAGGAGGCAGCTATGACTAGTTA CTTCGGCCCCACAATGGAATCT

[0055] Downstream primer R: ACGATGTAGGAGATCGATGCAT

[0056] CTTAAGAAACACACCTAGACTAGATTTGTTTTGCT

[0057] The reaction system and reaction conditions for expression cassette preparation are shown in Tables 1 and 2, respectively:

[0058] Table 1 PCR amplification system

[0059]

[0060] Table 2 PCR reaction conditions

[0061]

[0062]

[0063] The electrophoresis fragment of 2033 dp was cut out, and the target fragment was recovered using the agarose gel DNA recovery kit (DP209-03) of Tiangen Biochemical Technology Co., Ltd.; the operation was carried out according to the instructions of the kit.

[0064] S2, the structure of the knockout vector pEGCas9Pubi-H-matl is as follows Figure 1 As shown, the linearized vector was cut with FastDigest AscI (SgsI) at 37°C, and the electrophoresis fragment was cut out. The target fragment was recovered using the agarose gel DNA recovery kit (DP209-03) of Tiangen Biochemical Technology Co., Ltd.; the operation was performed according to the instructions of the kit;

[0065] S3, homologous recombination ligation reaction: the expression cassette fragment obtained in step S1 is connected to the linearized vector by homologous recombination ligation to obtain a ligation product. The specific reaction system and reaction conditions are shown in Table 3 and Table 4 respectively:

[0066] Table 3 Homologous recombination ligation reaction system

[0067]

[0068] Table 4 Homologous recombination ligation reaction conditions:

[0069]

[0070] S4, recombinant plasmid transformation, the specific steps are as follows:

[0071] (1) Take a tube of 100 μL of DH5a competent E. coli cells and mix with 2-5 μL of ligation product and incubate on ice for 30 min;

[0072] (2) Rapidly place in a 42°C constant temperature water bath, heat shock for 90 seconds, and ice bath for 2 minutes;

[0073] (3) Add 500 μL LB liquid medium and mix well;

[0074] (4) Cultivate at 37°C and 200 rpm for 45 min to allow the cells to return to normal growth;

[0075] (5) Spread the bacterial solution evenly on a Kana-resistant LB solid culture medium plate;

[0076] (6) After 30 minutes, place the cells in a 37°C incubator for overnight culture.

[0077] S5. Bacteria test

[0078] The primer pair of primers J and RB-R was used for colony PCR detection, and the band size was about 1639 bp; the positive plaques detected were picked and shaken; the sequences of the upstream primer J and the downstream primer RB-R of the primer pair were shown in SEQ ID NO.5 and SEQ ID NO.6, respectively, specifically:

[0079] J:ACCATCACACCATCGGACAC

[0080] RB-R:AAGTTGGGTAACGCCAGGGT

[0081] The colony PCR amplification system is as shown in Table 5:

[0082] Table 5 Reaction system for colony PCR amplification

[0083]

[0084] The reaction conditions for colony PCR amplification are shown in Table 6:

[0085] Table 6 Reaction conditions for colony PCR amplification

[0086]

[0087] S6. Plasmid extraction, as follows:

[0088] (1) Pick a single clone from the LB solid medium plate and inoculate it into LB liquid medium with kanamycin resistance at a final concentration of 50 μg / mL, and culture it at 37°C overnight;

[0089] (2) Take 4 mL of activated bacterial solution, centrifuge at 10,000 rpm for 2 min at room temperature, and discard the supernatant completely;

[0090] (3) Take 250 μL of Solution I reagent containing RNase A to thoroughly resuspend the bacterial mass;

[0091] (4) Take 250 μL of Solution II reagent to lyse the bacterial mass and gently invert it several times until the bacteria become transparent;

[0092] (5) Take 350 μL of Solution III reagent and invert several times until white, compact flocs are formed;

[0093] (6) Centrifuge at 12000 rpm for 10 min at room temperature and collect the supernatant;

[0094] (7) Take out the nucleic acid purification column from the kit and place it on the collection tube;

[0095] (8) Take the clarified supernatant from the above operation step (6) and transfer it to a nucleic acid purification column, centrifuge at 12000 rpm for 1 min at room temperature, and discard the filtrate;

[0096] (9) Add 500 μL of Buffer W1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0097] (10) Add 700 μL of Buffer W2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0098] (11) Repeat the above step 10;

[0099] (12) Place the nucleic acid purification column on the collection tube and spin at 12000 rpm for 2 min at room temperature to remove as much residual liquid as possible;

[0100] (13) Discard the collection tube, place the nucleic acid purification column in a 1.5 mL EP tube, and add 50 μL of elution solution to elute the DNA attached to the nucleic acid purification column membrane (the elution solution can be preheated in a 65°C constant temperature water bath to help elute the DNA), and let it stand at room temperature for 2 min;

[0101] (14) Centrifuge at 12000 rpm for 2 min at room temperature to elute the DNA attached to the nucleic acid purification column membrane and store in a -40°C refrigerator for later use;

[0102] (15) Take a small amount of the recovered product and use 1% agarose gel electrophoresis to detect the quality of the plasmid extraction; S7, sequencing

[0103] The plasmid extracted from the positive plaque was subjected to Sanger sequencing using sequencing primers SP-L / RB-R. The sequencing primer sequences are shown in SEQ ID NO.7 and SEQ ID NO.6, respectively. Specifically, the sequences of the upstream primer SP-L and the downstream primer RB-R of the sequencing primers are as follows:

[0104] SP-L:GCGGTGTCATCTATGTTACTAG

[0105] RB-R:AAGTTGGGTAACGCCAGGGT

[0106] The sequencing result sequence is consistent with the target fragment sequence, which means that the expression vector is successfully constructed. The structure of the successfully constructed vector is as follows: Figure 2 As shown, the vector includes a gene editing fragment of the nucleotide sequence shown in SEQ ID NO.1 and a fluorescent protein fragment of the nucleotide sequence shown in SEQ ID NO.2. The nucleotide sequence obtained after the gene editing fragment and the fluorescent protein fragment are connected is shown in SEQ ID NO.8, which is as follows:

[0107]

[0108] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0109] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A rice embryo-specific expression transgenic fluorescent protein gene and Mat1 gene editing integrated vector, characterized in that: The vector includes a gene editing fragment and a fluorescent protein gene fragment, the nucleotide sequence of the gene editing fragment is shown in SEQ ID NO.1; the sequence of the fluorescent protein gene fragment is shown in SEQ ID NO.

2.

2. The method for constructing a rice embryo-specific expression vector for transgenic fluorescent protein gene and Mat1 gene editing according to claim 1, characterized in that: The following steps are involved: S1. Using the rice genome as a template, design specific primers, and after PCR amplification, recover the target fragment by gel electrophoresis to obtain an embryo-specific expression transgenic fluorescent protein gene expression cassette; the upstream primer sequence of the expression cassette is shown in SEQ ID NO.3, and the downstream primer sequence is shown in SEQ ID NO.4; S2, digesting the knockout vector with endonuclease SgsI, cutting out the electrophoretic fragment of the linearized vector, and recovering the target fragment; S3, homologous recombination ligation: the embryo-specific expression transgenic fluorescent protein gene expression cassette obtained in step S1 is connected to the linearized vector by homologous recombination ligation to obtain a ligation product; S4. Add the ligation product to the competent E. coli cells, culture them, screen the positive clones, detect by PCR, extract the plasmids and sequence them. If the sequencing result is consistent with the sequence of the target fragment, the expression vector is successfully constructed.

3. The method for constructing a rice embryo-specific expression vector for transgenic fluorescent protein gene and Mat1 gene editing according to claim 2, characterized in that: In step S1, the PCR reaction system of the expression cassette is: 2×buffer 25 μL, 2 mM dNTPs 10 μL, upstream primer 1 μL, downstream primer 1 μL, KOD-FX polymerase 1 μL, vector DNA 1 μL, add ddH2O to 50 μL.

4. The method for constructing a rice embryo-specific expression vector for transgenic fluorescent protein gene and Mat1 gene editing according to claim 2, characterized in that: In step S1, the PCR reaction conditions of the expression cassette are: 94°C for 2 min; 98°C for 10 s, 60°C for 30 s, 68°C for 2:20 min, for 32 cycles; and 68°C for extension for 6 min.

5. The method for constructing a rice embryo-specific expression vector for transgenic fluorescent protein gene and Mat1 gene editing according to claim 2, characterized in that: In step S3, the homologous recombination ligation system is: Gibson assembly mix 5 μL, linearized empty load 100 ng, target fragment 50 ng, add ddH2O to 10 μL; reaction conditions are: treatment at 50°C for 30 min.

6. The method for constructing a rice embryo-specific expression vector for transgenic fluorescent protein gene and Mat1 gene editing according to claim 2, characterized in that: In step S4, colony PCR detection is performed using a specific primer pair, and the band size is 1639 bp; the sequences of the upstream primer J and the downstream primer RB-R of the primer pair are shown in SEQ ID NO.5 and SEQ ID NO.6, respectively.

7. The method for constructing a rice embryo-specific expression vector for transgenic fluorescent protein gene and Mat1 gene editing according to claim 6, characterized in that: The reaction system for colony PCR amplification was: 2×Taq MIX 10μL, upstream primer J 0.5μL, downstream primer RB-R 0.5μL, pick a small number of colonies and add ddH2O to 20μL; the reaction conditions for colony PCR amplification were: 25×, 95℃ pre-denaturation for 5min, 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 2min, and 72℃ final extension for 5min.

8. The method for constructing a rice embryo-specific expression vector for transgenic fluorescent protein gene and Mat1 gene editing according to claim 2, characterized in that: In step S4, plasmid extraction includes the following steps: (1) Pick a single clone from the LB solid medium plate and inoculate it into LB liquid medium with kanamycin resistance at a final concentration of 50 μg / mL, and culture it at 37°C overnight; (2) Take the activated bacterial solution, centrifuge it at 10,000 rpm for 2 min at room temperature, and discard the supernatant completely; (3) Take Solution I reagent containing RNase A and thoroughly resuspend the bacterial mass; (4) Take Solution II reagent to lyse the bacterial mass and turn it upside down several times until the bacteria become transparent; (5) Take Solution III reagent and invert it several times until a white, compact flocculent substance is formed; (6) Centrifuge at 12000 rpm for 10 min at room temperature and collect the supernatant; (7) Take out the nucleic acid purification column from the kit, take the supernatant obtained in step (6) into the nucleic acid purification column, centrifuge at room temperature 12000 rpm for 1 min, and discard the filtrate; (8) Add Buffer W1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate; (9) Add Buffer W2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate; (10) Repeat the above step (9); (11) Place the nucleic acid purification column on the collection tube and spin at 12000 rpm for 2 min at room temperature to remove as much residual liquid as possible; (12) Discard the collection tube, place the nucleic acid purification column in a 1.5 mL EP tube, and add 50 μL of elution solution to elute the DNA attached to the nucleic acid purification column membrane (the elution solution can be preheated in a 65°C constant temperature water bath to help elute the DNA), and let it stand at room temperature for 2 min; (13) Centrifuge at 12000 rpm for 2 min at room temperature to elute the DNA attached to the nucleic acid purification column membrane and store in a -40°C low-temperature refrigerator for later use; (14) Take a portion of the recovered product and use 1% agarose gel electrophoresis to detect the quality of plasmid extraction.

9. The method for constructing a rice embryo-specific expression vector for transgenic fluorescent protein gene and Mat1 gene editing according to claim 2, characterized in that: In step S4, the extracted plasmid is subjected to Sanger sequencing, and the primer RB-F having a sequence as shown in SEQ ID NO.7 and the primer RB-R having a sequence as shown in SEQ ID NO.6 are used as sequencing primers for sequencing.

10. Use of the vector according to claim 1 as a material for creating haploid rice induction lines.

Images