EGCG (epigallocatechin gallate) induced collagen modified salidroside as well as preparation method and application thereof

Abstract

The invention particularly relates to EGCG (epigallocatechin gallate) induced collagen modified salidroside as well as a preparation method and application thereof. The invention provides a method for modifying salidroside by inducing collagen through EGCG (epigallocatechin gallate). The method comprises the following steps: S1, preparing an EGCG solution; s2, preparing a collagen solution; s3, preparation of EGCG (Epigallocatechin Gallate)-collagen microspheres; s4, preparing a salidroside solution; and S5, modifying the salidroside solution. According to the present invention, the EGCG is adopted to induce the collagen to self-assemble so as to form the microspheres, and the microspheres are used to modify the salidroside, such that the stability, the solubility and the biological activity of the salidroside are significantly improved, and the application range of the salidroside product is further expanded.

Description

Technical Field

[0001] The invention belongs to the field of cosmetic raw materials, and particularly relates to EGCG-induced collagen-modified salidroside and a preparation method and application thereof. Background Art

[0002] Salidroside is an active ingredient extracted from the Rhodiola rosea plant, which has significant antioxidant, anti-fatigue and anti-aging effects. Salidroside is widely used in skin care products, which can effectively remove free radicals, slow down skin aging, and improve the skin's antioxidant capacity. However, although salidroside is easily soluble in water, its long-term stability in aqueous solution is poor. Rhodiola rosea liquid preparations are prone to precipitation during long-term storage. They are easily affected by factors such as light, heat and oxidation, which in turn affects their solubility and reduces their efficacy, which further limits the application of salidroside. Therefore, in order to give full play to the application potential of salidroside in the field of cosmetics, it is of great significance to develop new innovative technologies to improve its stability in aqueous solution.

[0003] In order to improve the stability of salidroside in aqueous solution, the prior art mainly prepares salidroside into liposomes, thereby improving the long-term stability and biological activity of the product (for example, Chinese patent document CN113041169A discloses a salidroside liposome freeze-dried powder and a preparation method and application thereof), or obtains a salidroside compound of a special crystal form by solvent purification, thereby obtaining a salidroside with single crystal, higher purity, better stability, higher solubility and good pharmaceutical activity (for example, Chinese patent document CN104017036A discloses a new crystal form of salidroside and a preparation method thereof, CN104250273A discloses a salidroside crystal and a preparation method thereof, CN104292279A discloses a salidroside crystal and a preparation method thereof, and CN118307610A discloses a salidroside crystal form and a preparation method thereof, etc.). However, although these methods have achieved remarkable results in improving the quality of salidroside, their preparation process is relatively complicated and costly, and may be accompanied by potential problems such as solvent residues and environmental impacts, which limits their promotion in large-scale production and wide application.

[0004] The chemical modification method is an innovative and efficient means. It can achieve multiple purposes such as enhancing the stability of substances, improving solubility, enhancing biological activity or reducing side effects by introducing or changing the chemical structure of the substance molecules. Chemical modification allows salidroside to be combined with other compounds to form a more stable compound. This method can effectively protect salidroside from interference from external environmental factors such as light, temperature fluctuations, humidity changes, etc., thereby significantly improving its chemical stability. This method has great feasibility. After searching, there is no report on the use of chemical modification methods to provide stability for salidroside. Summary of the invention

[0005] In view of the problems of poor stability, complex preparation method and high cost of salidroside in the prior art, the present invention provides a method for inducing collagen modification of salidroside with epigallocatechin gallate (EGCG) and its application, so as to improve the stability, solubility and biological activity of salidroside, simplify the preparation process and reduce the cost.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: The first object of the present invention is to provide a method for EGCG-induced collagen modification of salidroside, comprising the following steps: S1. Preparation of EGCG solution Weigh EGCG and dissolve it in deionized water to prepare EGCG solution; S2. Preparation of collagen solution Weigh collagen and dissolve it in PBS buffer to prepare collagen solution; S3. Preparation of EGCG-collagen microspheres: The EGCG solution was slowly added dropwise to the collagen solution, and stirring was maintained during the addition process. After the addition was completed, the EGCG-collagen microspheres were prepared after sufficient stirring at room temperature; S4. Preparation of salidroside solution Weigh salidroside and dissolve it in deionized water to prepare a salidroside solution; S5. Modification of salidroside The salidroside solution prepared in step S4 is added to the EGCG-collagen microspheres prepared in step S3, and stirred evenly to prepare collagen-modified salidroside.

[0007] Preferably, the EGCG is derived from tea extract.

[0008] Preferably, the collagen includes type I collagen, type II collagen, type III collagen or type XVII collagen.

[0009] Preferably, the concentration of the EGCG solution is 1-2 mg / mL; the concentration of the collagen solution is 1-2 mg / mL.

[0010] Preferably, in step S3, the mass ratio of the EGCG solution to the collagen solution is 1:1.

[0011] Preferably, the concentration of the salidroside solution is 5-20 mg / mL.

[0012] Preferably, in step S5, the mass ratio of the salidroside solution to the EGCG-collagen microspheres is 1:1.

[0013] Preferably, in step S3, the stirring time is 0.5-3 h, and the stirring speed is 150-350 rpm; in step S5, the stirring time is 0.5-3 h, and the stirring speed is 150-350 rpm.

[0014] Another object of the present invention is to provide collagen-modified salidroside prepared according to the above-mentioned method of EGCG-induced collagen-modified salidroside.

[0015] Another object of the present invention is to provide the use of the collagen-modified salidroside in the preparation of cosmetics.

[0016] Compared with the prior art, the present invention has the following beneficial effects: (1) The present invention provides for the first time a method for EGCG-induced collagen modification of salidroside, wherein EGCG is first used to induce collagen self-assembly to form microspheres, which are then used to modify salidroside, thereby significantly improving the solubility and stability of salidroside. The modified salidroside exhibits the effect of promoting collagen synthesis.

[0017] (2) The present invention can be applied to the preparation of salidroside products with high stability, solubility and biological activity. The preparation process is green and environmentally friendly, avoiding the use of harmful chemical reagents, and further expanding the application scope of salidroside products. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a comparison chart of stability tests and free radical scavenging rates of different samples; Figure 2 The relative expression level of collagen I in samples from different groups in the collagen synthesis promotion test. DETAILED DESCRIPTION

[0019] The above contents of the present invention are further described in detail below by means of specific implementation methods in the form of examples, but this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples.

[0020] The sources of reagents, materials and equipment in the embodiments of the present invention are as follows: The epigallocatechin gallate (EGCG) was purchased from Xi'an Shouhe Biotechnology Co., Ltd., with a packaging specification of 200 g / bag; The type III collagen was purchased from Peptide Source (Guangzhou) Biotechnology Co., Ltd., trade name: Rechprotein ® COL-3 (X type), packaging specification: 1.6kg / bottle; The salidroside was purchased from Yunnan Yingge Biotechnology Co., Ltd., trade name: Jiangxue TM , Packaging specification: 1kg / bag; The NIH-3T3 cells (mouse embryonic fibroblasts) were purchased from Shanghai Bio-Tech Biotechnology Co., Ltd., product number: C7204, packaging specification: 1 tube / bottle; The 1640 culture medium was purchased from Thermo Fisher Scientific (brand: Gibco), product number: C11875500BT, specification: 500 mL / bottle; The ultrasonic processor was purchased from Shenzhen Jiemeng Cleaning Equipment Co., Ltd., model JP-100S; the magnetic stirrer was purchased from Scilogex, model MS-H-Pro + The experimental samples of the present invention need to be stirred using an ultrasonic processor and a magnetic stirrer.

[0021] The inventive concept or principle of the present invention is as follows: Collagen is one of the important components of the skin and has the function of maintaining skin elasticity and moisture. In skin care products, collagen is widely used to improve skin texture, reduce wrinkles and increase skin elasticity. The present invention chemically modifies salidroside by using collagen to form a more stable compound and improve its chemical stability. The amino acid side chain groups in collagen can interact with a variety of active substances, which helps to improve the activity and stability of the active substances. For example, polar groups such as lysine, arginine, and glutamic acid can be used as hydrogen bond donors or acceptors to form hydrogen bonds with polar groups such as the hydroxyl group of salidroside. The ε-amino group of lysine and the carboxyl group of glutamic acid have reactive groups and can form stable complexes with the active groups of salidroside through covalent bonds; non-polar amino acid residues such as leucine, isoleucine, and phenylalanine have hydrophobic properties, and these hydrophobic parts can interact hydrophobically with the hydrophobic parts of the salidroside molecules to promote binding. Aromatic amino acids in collagen, such as phenylalanine, tyrosine, and tryptophan, have aromatic ring structures, which can interact with the aromatic ring structure in salidroside through π-π stacking. Therefore, the present invention utilizes this characteristic of collagen to modify salidroside, which can improve the stability and solubility of salidroside.

[0022] However, due to the limited number of amino acid residues on the side chain of recombinant collagen and the significant steric hindrance between unassembled collagen peptide chains, the modification rate of salidroside using collagen alone is low. In order to improve the modification efficiency of salidroside by collagen, the present invention introduces EGCG as a cross-linking agent, firstly assembles the peptide chains of collagen into an ordered structure using EGCG, and then combines with salidroside, thereby achieving effective modification of salidroside.

[0023] EGCG, a polyphenol compound naturally found in green tea, not only exhibits excellent antioxidant and anti-inflammatory properties, but also plays an important role in the field of skin care products. It can effectively scavenge free radicals, reduce skin inflammation, and provide UV protection for the skin. In addition, EGCG also has the potential to be an efficient protein cross-linking agent. It can tightly bind to proteins through various mechanisms such as hydrogen bonds, hydrophobic interactions, electrostatic interactions, and covalent bonds, inducing cross-linking reactions between protein molecules, thereby achieving optimized adjustments to protein structure and function.

[0024] Therefore, in the present invention, EGCG acts as a protein cross-linking agent to induce collagen self-assembly to form a three-dimensional sphere with EGCG in the middle and collagen wrapped outside. Due to its three-dimensional structure, the self-assembled microspheres expose more peptide chain side chains on the surface, which increases the density of binding sites on the surface. This means that within the same unit volume, the self-assembled microspheres can provide more binding sites to bind to the Rhodiola rosea extract.

[0025] Compared with single or linear peptide chain structures, self-assembled microspheres provide more and more efficient binding sites in the following ways, thereby improving their stability, solubility and biological activity: (1) Increased surface area: The three-dimensional structure of self-assembled microspheres increases the surface area per unit volume, exposing more binding sites.

[0026] (2) Three-dimensional structure: The three-dimensional spherical structure enables the peptide chain to form a highly organized structure in three-dimensional space, increasing the accessibility of the binding site.

[0027] (3) Secondary structure stability: The secondary structure of self-assembled microspheres is more stable and can maintain its functionality under different environmental conditions.

[0028] (4) Multiple binding modes: Since self-assembled microspheres have multiple binding modes, they can bind to Rhodiola rosea extract through various interaction forces (such as hydrophobic interaction, van der Waals force, hydrogen bond, π-π stacking effect and electrostatic attraction) to form a more stable complex.

[0029] (5) Three-dimensional network effect: The three-dimensional network effect formed by self-assembled microspheres makes the binding tighter and enhances the overall stability and functionality.

[0030] In addition, the experimental results of the present invention show that a large amount of precipitation will be precipitated when collagen and Rhodiola rosea extract are mixed alone, while the self-assembled microspheres not only avoid the generation of precipitation but also improve the solubility and stability of the complex.

[0031] Example 1 Preparation of EGCG-induced collagen-modified salidroside of the present invention The method of EGCG-induced collagen modification of salidroside of the present invention comprises the following steps: S1. Preparation of EGCG solution Weigh EGCG and dissolve it in deionized water to prepare an EGCG solution with a concentration of 1 mg / mL; S2. Preparation of collagen solution Weigh type III collagen and dissolve it in PBS buffer to prepare a collagen solution with a concentration of 1 mg / mL; S3. Preparation of EGCG-collagen microspheres: The EGCG solution was slowly added dropwise to the collagen solution, the mass ratio of the EGCG solution to the collagen solution was 1:1, stirring was maintained during the addition, the stirring time was 2 hours, and the stirring speed was 200 rpm. After the addition was completed, the EGCG-collagen microspheres were prepared after sufficient stirring at room temperature; S4. Preparation of salidroside solution Weigh salidroside and dissolve it in an appropriate amount of deionized water to prepare a salidroside solution with a concentration of 20 mg / mL; S5. Modification of salidroside solution The salidroside solution prepared in step S4 is added to the EGCG-collagen microspheres prepared in step S3, the mass ratio of the salidroside solution to the EGCG-collagen microspheres is 1:1, and the mixture is stirred evenly for 2 hours at a stirring speed of 200 rpm to obtain collagen-modified salidroside.

[0032] Example 2 Preparation of EGCG-induced collagen-modified salidroside of the present invention The method of EGCG-induced collagen modification of salidroside of the present invention comprises the following steps: S1. Preparation of EGCG solution Weigh EGCG and dissolve it in an appropriate amount of deionized water to prepare an EGCG solution with a concentration of 1 mg / mL; S2. Preparation of collagen solution Weigh type III collagen and dissolve it in PBS buffer to prepare a collagen solution with a concentration of 1 mg / mL; S3. Preparation of EGCG-collagen microspheres: The EGCG solution was slowly added dropwise to the collagen solution, the mass ratio of the EGCG solution to the collagen solution was 1:1, stirring was maintained during the addition, the stirring time was 3 hours, and the stirring speed was 150 rpm. After the addition was completed, the EGCG-collagen microspheres were prepared after sufficient stirring at room temperature; S4. Preparation of salidroside solution Weigh salidroside and dissolve it in an appropriate amount of deionized water to prepare a salidroside solution with a concentration of 5 mg / mL; S5. Modification of salidroside solution The salidroside solution prepared in step S4 was added to the EGCG-collagen microspheres prepared in step S3, the mass ratio of the salidroside solution to the EGCG-collagen microspheres being 1:1, and the mixture was stirred evenly for 0.5 h at a stirring speed of 350 rpm to obtain collagen-modified salidroside.

[0033] Example 3 Preparation of EGCG-induced collagen-modified salidroside of the present invention The method of EGCG-induced collagen modification of salidroside of the present invention comprises the following steps: S1. Preparation of EGCG solution Weigh EGCG and dissolve it in an appropriate amount of deionized water to prepare an EGCG solution with a concentration of 1 mg / mL; S2. Preparation of collagen solution Weigh type III collagen and dissolve it in PBS buffer to prepare a collagen solution with a concentration of 1 mg / mL; S3. Preparation of EGCG-collagen microspheres: The EGCG solution was slowly added dropwise to the collagen solution, the mass ratio of the EGCG solution to the collagen solution was 1:1, stirring was maintained during the addition, the stirring time was 0.5 h, and the stirring speed was 350 rpm. After the addition was completed, the EGCG-collagen microspheres were prepared after sufficient stirring at room temperature; S4. Preparation of salidroside solution Weigh salidroside and dissolve it in an appropriate amount of deionized water to prepare a salidroside solution with a concentration of 10 mg / mL; S5. Modification of salidroside solution The salidroside solution prepared in step S4 is added to the EGCG-collagen microspheres prepared in step S3, the mass ratio of the salidroside solution to the EGCG-collagen microspheres is 1:1, and the mixture is stirred evenly for 2 hours at a stirring speed of 200 rpm to obtain collagen-modified salidroside.

[0034] Example 4 Preparation of EGCG-induced collagen-modified salidroside of the present invention The method of EGCG-induced collagen modification of salidroside of the present invention comprises the following steps: S1. Preparation of EGCG solution Weigh EGCG and dissolve it in an appropriate amount of deionized water to prepare an EGCG solution with a concentration of 2 mg / mL; S2. Preparation of collagen solution Weigh type III collagen and dissolve it in PBS buffer to prepare a collagen solution with a concentration of 2 mg / mL; S3. Preparation of EGCG-collagen microspheres: The EGCG solution was slowly added dropwise to the collagen solution, the mass ratio of the EGCG solution to the collagen solution was 1:1, stirring was maintained during the addition, the stirring time was 2 hours, and the stirring speed was 200 rpm. After the addition was completed, the EGCG-collagen microspheres were prepared after sufficient stirring at room temperature; S4. Preparation of salidroside solution Weigh salidroside and dissolve it in an appropriate amount of deionized water to prepare a salidroside solution with a concentration of 20 mg / mL; S5. Modification of salidroside solution The salidroside solution prepared in step S4 was added to the EGCG-collagen microspheres prepared in step S3, the mass ratio of the salidroside solution to the EGCG-collagen microspheres being 1:1, and the mixture was stirred evenly for 0.5 h at a stirring speed of 350 rpm to obtain collagen-modified salidroside.

[0035] Comparative Example 1 Compared with Example 1, the difference of this comparative example is that EGCG is not used to induce collagen, and only collagen is used to modify salidroside, and the rest is the same as Example 1. It includes the following steps: S1. Preparation of collagen solution Weigh type III collagen and dissolve it in PBS buffer to prepare a collagen solution with a concentration of 1 mg / mL; S2. Preparation of salidroside solution Weigh salidroside and dissolve it in an appropriate amount of deionized water to prepare a salidroside solution with a concentration of 20 mg / mL; S3. Modification of salidroside solution The salidroside solution prepared in step S2 is added to the collagen solution prepared in step S1, the mass ratio of the salidroside solution to the collagen solution is 1:1, and the mixture is stirred evenly for 2 hours at a stirring speed of 200 rpm to obtain collagen-modified salidroside.

[0036] Comparative Example 2 Compared with Example 1, the difference of this comparative example is that the concentration of the EGCG solution is 0.5 mg / mL, and the others are the same as Example 1.

[0037] Experiment 1 Performance Test (1) Solubility test The samples prepared in Examples 1 to 4 and Comparative Examples 1 to 2 were tested to observe their solubility.

[0038] The solubility test method is as follows: Use a centrifuge (purchased from Shanghai Ganwei Biotechnology Co., Ltd., model HTC-R002) at a speed of 3000 rpm to centrifuge the samples for 10 minutes and observe whether there is any sediment. The results are shown in Table 1 below.

[0039] Table 1 Solubility test results

[0040] Special note: The product obtained in Comparative Example 1 was found to contain a large amount of precipitate before centrifugation.

[0041] It can be seen that compared with Example 1, Comparative Example 1 does not use EGCG to modify collagen, but directly uses collagen to modify salidroside. The final product forms a precipitate without centrifugation, and the product solubility and stability are poor; secondly, compared with Example 1, in Comparative Example 2, the concentration of the EGCG solution is reduced from 1 mg / mL to 0.5 mg / mL, and the final product is still found to form a precipitate after centrifugation, indicating that the reduction in the concentration of the EGCG solution will lead to unstable products and easy precipitation.

[0042] In view of the fact that the increase in EGCG content may cause a certain irritation reaction, setting the concentration of EGCG to 1 mg / mL is considered to be a preferred solution, rather than the higher the better. At the same time, for the consideration of efficient use of resources and reducing cost expenditure, the present invention selects conditions that can achieve the maximum modification of salidroside with the least collagen. Specifically, the conditions of Example 1, in which the EGCG concentration is 1 mg / mL, the collagen concentration is 1 mg / mL, and the salidroside concentration is 20 mg / mL, this solution is considered to be the best choice.

[0043] (2) Stability test The modified salidroside sample (collagen-salidroside group) prepared in Example 1 was stored under light (white light, illumination of 4500lx), high temperature (temperature 45°C, relative humidity 60%), and room temperature (temperature 25°C, relative humidity 60%), and a commercially available unmodified salidroside sample (salidroside group) was used as a control. Samples were taken on the 4th and 8th days, and the DPPH scavenging rate was determined to evaluate its antioxidant activity. The DPPH scavenging rate determination method refers to the group standard "Cosmetics-Free Radical (DPPH) Scavenging Experimental Method", standard number T / SHRH 006-2018.

[0044] The experimental results are as follows Figure 1 As shown in the figure, it can be seen from the experimental results that collagen modification can maintain the antioxidant activity of salidroside under various conditions. On the 8th day, the DPPH clearance rate of the modified salidroside sample prepared in the embodiment of the present invention was significantly higher than that of the control group.

[0045] (3) Biological activity test The modified salidroside sample prepared in Example 1 was administered to NIH-3T3 cells (mouse embryonic fibroblasts) for culture, and a collagen synthesis promotion test was performed after 24 hours of incubation. The specific steps include: a. Cell culture: NIH-3T3 cells were cultured in 1640 medium (containing 10% FBS) at 37°C and 5% carbon dioxide, and seeded into 12-well plates, with 200,000 cells per well, and grouped into test samples and control groups. Cultured at 37°C and 5% carbon dioxide for 24 hours.

[0046] b. Cell Grouping: Control group: cultured in 1640 medium (containing 0.4% FBS); Administration group: samples of different groups (modified salidroside samples prepared in Example 1 of the present invention, recombinant humanized type III collagen samples, and commercially available salidroside samples) were added to 1640 medium containing 0.4% FBS at a concentration of 0.25%.

[0047] c. Biological activity test: After incubation for 24 hours, the cells were collected and RNA was extracted using a micro RNA extraction kit (Magen Biotechnology, model R4111), and QPCR was performed to detect the relative expression of collagen I. The specific detection process is as follows: Table 2 QPCR detection system (per 20 μL system)

[0048] Table 3 QPCR detection procedures

[0049] Primer Information: Upstream primer Primer F sequence information: GCTTCACCTACAGCACCCTT (SEQ ID NO. 1); The sequence information of downstream primer Primer R is: GGTGGGAGGGAACCAGATTG (SEQ ID NO. 2).

[0050] The experimental results are as follows Figure 2 As shown, compared with the unmodified salidroside and collagen group, the modified salidroside showed a stronger effect in promoting collagen synthesis in the in vitro cell experiment and had higher biological activity.

[0051] In summary, the present invention modifies salidroside by inducing collagen with EGCG, significantly improving the solubility and stability of salidroside in aqueous solution, and reducing its degradation under conditions such as light, heat and oxidation. The modified salidroside exhibits a stronger effect of promoting collagen synthesis in in vitro cell experiments and has higher biological activity. This is due to the synergistic effect of collagen and EGCG, which can more effectively improve the functionality of salidroside. At the same time, the preparation process of the method of the present invention is simple and easy, does not require complex equipment and expensive materials, has high industrial application potential, and the preparation process is green and environmentally friendly, avoiding the use of harmful chemical reagents and complex preparation steps, and meets the requirements of green chemistry. The collagen-modified salidroside prepared by the present invention can be widely used in the fields of skin care products, health products and medicines, and has a variety of potential market application values.

[0052] The above embodiments are merely illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Anyone familiar with the art may modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by a person of ordinary skill in the art without departing from the spirit and technical concept disclosed by the present invention shall still be covered by the claims of the present invention.

Claims

1. A method for EGCG-induced collagen modification of salidroside, characterized in that: The steps include: S1. Preparation of EGCG solution Weigh EGCG and dissolve it in deionized water to prepare EGCG solution; S2. Preparation of collagen solution Weigh collagen and dissolve it in PBS buffer to prepare collagen solution; S3. Preparation of EGCG-collagen microspheres: The EGCG solution was slowly added dropwise to the collagen solution, and stirring was maintained during the addition process. After the addition was completed, the EGCG-collagen microspheres were prepared after sufficient stirring at room temperature; S4. Preparation of salidroside solution Weigh salidroside and dissolve it in deionized water to prepare a salidroside solution; S5. Modification of salidroside The salidroside solution prepared in step S4 is added to the EGCG-collagen microspheres prepared in step S3, and stirred evenly to prepare collagen-modified salidroside.

2. The method for EGCG-induced collagen modification of salidroside according to claim 1, characterized in that: The EGCG is derived from tea extract.

3. The method for EGCG-induced collagen modification of salidroside according to claim 1, characterized in that: The collagen includes type I collagen, type II collagen, type III collagen or type XVII collagen.

4. The method for EGCG-induced collagen modification of salidroside according to claim 1, characterized in that: The concentration of the EGCG solution is 1-2 mg / mL; the concentration of the collagen solution is 1-2 mg / mL.

5. The method for EGCG-induced collagen modification of salidroside according to claim 1, characterized in that: In the step S3, the mass ratio of the EGCG solution to the collagen solution is 1:

1.

6. The method for EGCG-induced collagen modification of salidroside according to claim 1, characterized in that: The concentration of the salidroside solution is 5-20 mg / mL.

7. The method for EGCG-induced collagen modification of salidroside according to claim 1, characterized in that: In the step S5, the mass ratio of the salidroside solution to the EGCG-collagen microspheres is 1:

1.

8. The method for EGCG-induced collagen modification of salidroside according to claim 1, characterized in that: In the step S3, the stirring time is 0.5-3 h, and the stirring speed is 150-350 rpm; in the step S5, the stirring time is 0.5-3 h, and the stirring speed is 150-350 rpm.

9. Collagen-modified salidroside obtained by the method for EGCG-induced collagen-modified salidroside according to any one of claims 1 to 8.

10. Use of the collagen-modified salidroside according to claim 9 in the preparation of cosmetics.

Images