Rubber tree AB type cultivated variety identification method based on rubber tree chloroplast SNP (Single Nucleotide Polymorphism) marker

Abstract

The invention belongs to the technical field of molecular markers, and particularly relates to a rubber tree AB type cultivated variety identification method based on a rubber tree chloroplast SNP (Single Nucleotide Polymorphism) marker, an SNP site is located at the 147th site from the 5'terminal of a sequence as shown in SEQ ID No.1, and C / A natural variation exists at the site. The SNP site can be used for breeding a rubber tree high-yield variety, and can be used for identifying the rubber tree AB type cultivated variety. And a molecular marker library for rubber tree excellent variety breeding is expanded.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a method for identifying AB-type cultivars of rubber trees based on rubber tree chloroplast SNP markers. Background Art

[0002] Natural rubber mainly comes from the Brazilian rubber tree. It is an important industrial raw material and military strategic material. It is widely used in transportation, medical care, national defense and military industry. Its excellent performance in elasticity, wear resistance and impact resistance has not been replaced by synthetic rubber so far. The Brazilian rubber tree is native to the Amazon Basin in Brazil. After many introductions, it is now widely cultivated in tropical Asia. It is cultivated in Taiwan, southern Fujian, Guangdong, Guangxi, Hainan and southern Yunnan in my country, with Hainan and Yunnan being the most planted. There are two famous introductions of rubber trees in history. In 1876, the British Wickham collected rubber tree germplasm in Brazil, and then brought the seeds and seedlings to Kew Garden in the UK for breeding. Later, they were planted in Sri Lanka and then introduced to Malaysia, Indonesia, Thailand and other Southeast Asian countries for planting. The second time was in 1981 when the International Rubber Research and Development Board (IRRDB) organized the collection and introduction of rubber tree germplasm. In addition, it also includes other rubber tree germplasm currently available in major rubber-producing countries. After years of introduction, cultivation, hybrid breeding and screening, my country has bred a number of cold-resistant, wind-resistant and high-yield varieties, including Reyan 879, Reyan 73397 and other high-yield varieties, Reyan 917 and other wind-resistant high-yield varieties, Yunyan 774 and other cold-resistant high-yield varieties. Among them, Reyan 879 is a super high-yield variety, with an per-acre yield increased by more than 50% over the control, and is currently the variety with the highest yield in the world.

[0003] With the continuous advancement of sequencing technology, more and more rubber tree varieties, germplasms and rubber tree species have been analyzed, laying a solid foundation for further genome selection and molecular-assisted breeding to accelerate the rubber breeding process. Recently, the Rubber Research Institute of the Chinese Academy of Tropical Agricultural Sciences, where our team is located, has jointly conducted research on the genetic diversity and rubber production evolution of rubber tree germplasm with the Sanya South Breeding Research Institute of Hainan University and Lanzhou University. We have completed high-quality genome analysis and pan-genome component research on three Brazilian rubber tree cultivated varieties (high yield and high sensitivity), two Brazilian rubber tree wild germplasms (medium yield and high sensitivity) and three other different species of the genus Hevea (low yield and high resistance), explaining the genetic structure and phylogenetic relationship of the three types of rubber tree germplasm resources currently preserved in the world's major rubber-producing countries, and discovered the generation of the rubber elongation factor / small rubber particle protein (REF / SRPP) large gene cluster. By searching NCBI and my country's National Genome Science Data Center, we found hundreds of genome resequencing data of different varieties and wild germplasm. Among them, the project number PRJCA004986 released in September 2023 has the largest amount of data, including more than 100 cultivated varieties and more than 200 wild germplasm materials. By mining and analyzing these data, it is beneficial to screen effective SNP marker sites and lay the foundation for further assisting high-yield and resistant breeding of rubber trees.

[0004] Chloroplasts are the sites where green plants carry out photosynthesis. They have an independent genetic system, a relatively stable genetic structure, and rarely undergo gene recombination. Therefore, chloroplast genome sequences are widely used in plant phylogeny and species identification. Plant genome resequencing is mostly based on leaves, and mesophyll cells contain a large number of chloroplasts. In addition, the size of the chloroplast genome is also very small, only more than 100 kb. Therefore, compared with the nuclear genome, only a small amount of leaf resequencing data can be used for chloroplast genome assembly and SNP analysis. Rubber tree cultivars are all derived from the screening of wild germplasm in the Amazon Basin of Brazil. They generally have characteristics such as high yield and stress resistance. By comparing the chloroplast genomes of cultivated varieties and wild germplasm, screening effective SNP marker sites will accelerate the breeding process of high-yield and stress-resistant rubber trees. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP site that can be used for high-yield varieties of rubber trees, enrich the molecular markers available for breeding excellent varieties of rubber trees, and provide new ideas for high-yield breeding of rubber trees.

[0006] The invention provides an application of a SNP marker site for identifying high-yield varieties of rubber trees in the breeding of high-yield varieties of rubber trees, wherein the SNP site is located at the 147th position from the 5' end of the sequence shown in SEQ ID No.1, and the site has a C / A natural variation, specifically: 5'-ATACAAAGAAAGATATCTCTGTTTACAACAGAAAAACTCTCCTCTGATGAATTGTATAATCGTTGGAATTATAAGAATGAACAAAAAAAGAAAATCCTAAATAATGAATTTATAAATTTTAAAAAATTTAAAGAGTAATAAATTCAAATTAATAAAAAAATTAATGCATAAAATAAATAAAATAAGAGATAAGAAGAGATGCGACCACTTCCTACATATTTTATACCCTCTCCTACAAAGAAACTGGTAACACCGACCCCATTGGTGA-3'; the corresponding wild-type sequence is shown in SEQ ID As shown in No.2, specifically: 5'-ATACAAAGAAAGATATCTCTGTTTACAACAGAAAAACTCTCCTCTGATGAATTGTATAATCGTTGGAATTATAAGAATGAACAAAAAAAGAAAATCCTAAAATAATGAATTTATAAATTTTTGAAAAAAATT TAAAGAGTAATAAATTAAAATTAATAAAAAAATTAATGCATAAAATAAATAAAATAAGAGATAAGAAGAGATGCGACCACTTCCTACATATTTTATACCCTCTCCTACAAAGAAACTGGTAACACCGACCCCATTGGTGA-3'.

[0007] Preferably, the SNP site is related to the latex yield of the rubber tree. When the base of the SNP site is C, it indicates that the rubber tree is a high-yield variety.

[0008] Preferably, the high yield means latex yield>50mL / knife.

[0009] The present invention also provides a method for identifying high-yield varieties of rubber trees, comprising the following steps: The DNA of the sample to be tested is amplified, and the SNP site polymorphism detection is performed using the SNP site described in the above technical solution. The sample to be tested is genotyped according to the detection result of the SNP site. When the base of the SNP site is C, it indicates that the sample is a high-yield variety of rubber tree.

[0010] The present invention also provides an application of a SNP marker site for identifying high-yield varieties of rubber trees in preparing products for identifying high-yield varieties of rubber trees, wherein the SNP site is located at the 147th position from the 5' end of the sequence shown in SEQ ID No. 1, and there is a C / A natural variation at the site.

[0011] Preferably, the product comprises a kit and / or a gene chip.

[0012] The present invention also provides a kit for identifying high-yield varieties of rubber trees, wherein the kit comprises the SNP sites described in the above technical solution.

[0013] The present invention also provides an application of a SNP marker site for identifying high-yield varieties of rubber trees in constructing a rubber tree gene library, wherein the SNP site is located at the 147th position from the 5' end of the sequence shown in SEQ ID No. 1, and the site has a C / A natural variation.

[0014] Beneficial effects of the present invention: By searching NCBI and my country's National Genome Science Data Center, the present invention found hundreds of genome resequencing data of different varieties and wild germplasm. Among them, the project number PRJCA004986 released in September 2023 has the largest amount of data, including more than 100 cultivated varieties and more than 200 wild germplasm materials. By mining and analyzing these data, it is beneficial to screen effective SNP marker sites, laying the foundation for further assisting high-yield and resistant breeding of rubber trees.

[0015] The SNP site provided by the present invention is related to latex yield. When the base of the site is C, it indicates that the rubber tree is a high-yield variety. When the latex yield of the rubber tree is greater than 50 mL / knife, it is a high-yield variety. The site can be used to breed high-yield varieties of rubber trees, expanding the molecular marker library used for breeding excellent varieties of rubber trees. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0017] Figure 1 This is the evolutionary tree of 670 chloroplast genome sequences of 335 samples in Example 1; Figure 2 This is a cluster analysis heat map of 299 core SNP sites in 335 samples in Example 2; Figure 3 This is a heat map of the cluster analysis of 25 SNP sites in Example 2. DETAILED DESCRIPTION

[0018] To further illustrate the present invention, a method for identifying AB-type cultivars of rubber trees based on rubber tree chloroplast SNP markers provided by the present invention is described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0019] The present invention downloaded 335 genome resequencing data of rubber tree cultivars and wild germplasms from the National Genome Science Data Center, used GetOrganelle software to assemble chloroplasts of 127 cultivars and 208 wild germplasms, a total of 335 materials, and then used the chloroplast genome of the main rubber tree cultivar Reyan 73397 as a reference, used snippy software to screen and analyze core SNPs, and finally used the Heatmap analysis tool of TBtools software to cluster analyze the core SNPs, and screened out the SNP sites between the cultivars and the wild germplasms. The methods described in the following embodiments are all conventional methods unless otherwise specified.

[0020] Example 1 335 materials chloroplast assembly The genome resequencing data of 335 rubber tree cultivars and wild germplasms were downloaded from the National Genome Science Data Center (https: / / ngdc.cncb.ac.cn / ) to the local server (Project No.: PRJCA004986). The chloroplast genomes of each sample were assembled using the GetOrganelle software. The specific command was: get_organelle_from_reads.py -1 CRR286406_f1.fastq.gz -2 CRR286406_r2.fastq.gz -F embplant_pt -oCRR286406 -R 15 -t 20 --reverse-lsc. The chloroplast genomes of 335 samples were obtained. The chloroplast genome of each sample included two configurations, namely, embplant_pt.K85.complete.graph1.1.path_sequence.fasta and embplant_pt.K85.complete.graph1.2. path_sequence.fasta, and named them CRR286406_1 and CRR286406_2 respectively (other samples were named in the same way). The specific commands were: ll|grepCRR|awk '{print"cat "$NF" / *complete.graph1.1.path_sequence.fasta>Result / "$NF"_1"}'|sh and ll|grep CRR|awk '{print"cat "$NF" / *complete.graph1.2.path_sequence. fasta>Result / "$NF"_2"}'|sh. Then, the cat command was used to merge the 670 sequences of 335 samples into a fasta file named CRR286-cp.fasta. The mafft software was used for multiple sequence alignment. The command was: mafft CRR286-cp.fasta>CRR286-cp.fasta.mafft. Then, the fasttree software was used to construct the evolutionary tree. The command was: fasttree CRR286-cp.fasta.mafft>CRR286-cp.fasta.mafft.tree. Transfer the obtained evolutionary tree file CRR286-cp.fasta.mafft.tree to a personal computer and use Figtree software to view and display the evolutionary tree, such as Figure 1 As shown, a total of 335 chloroplast genome sequences from the branch where CRR286406_2 was located were selected for subsequent SNP analysis.

[0021] Example 2 SNP analysis of chloroplast genomes in 335 samples According to the phylogenetic tree of the chloroplast genome sequence constructed in Example 1, a total of 335 chloroplast genome sequences in the branch where CRR286406_2 is located are selected, and core SNP analysis is performed using the software snippy. The specific command is: snippy--outdirCRR286364_1a --ref . / CRR286406_2 --ctgs CRR286364_1 --cpus 10. The command takes CRR286364_1 as an example, and the chloroplast genome sequence CRR286406_2 of the cultivated variety Reyan 73397 is used as the reference genome. The above command analysis is performed on the 335 chloroplast genome sequences respectively; then the core SNP analysis is performed, and the specific command is: snippy-core CRR286348_1a CRR286348_2a CRR286349_1a CRR286349_2a CRR286350_1a...(335 folder names in total), the analysis results are the core.tab file, which is the core SNP matrix file, including 299 core SNP sites. Use the sed command to replace A, T, C, and G with numbers 1, 2, 3, and 4. The specific command is: morecore.tab|sed -e 's / A / 1 / g' -e 's / T / 2 / g' -e 's / C / 3 / g' -e 's / G / 4 / g'>core.tab.xlsx, transfer core.tab.xlsx to a personal desktop, open it with Excel, select all and selectively paste in a new table, check transpose, delete the first row to get the SNP site matrix. Use the Heatmap analysis tool of the TBtools software to draw a heat map for the transposed core.tab.xlsx file and perform cluster analysis on the columns, such as Figure 2 As shown in the figure, Cul is a high-yield resistant material selected and cultivated from wild germplasm, and cultivated on a large scale; WAC, WRO and WMG represent wild germplasm materials collected from three regions of Brazil. Through comparative analysis, it was found that 25 SNP loci can divide high-yield varieties into two complementary types, such as Figure 3As shown, the two complementary types are named A class and B class, respectively, and a SNP site covering both types A and B is named AB class SNP site, wherein A class includes 5 SNP sites, B class includes 19 SNP sites, and AB class includes 1 SNP site, which is represented by the structure of s-Reyan 73397 chloroplast genome physical position-cultivated variety genotype / wild germplasm genotype, and the variation information is as follows: s116127-C / A, which is located at the 147th position from the 5' end of the sequence shown in SEQ ID No.1, and there is a C / A natural variation at this site.

[0022] The present invention obtains chloroplast genome SNP sites that can effectively distinguish cultivated varieties from wild germplasm through resequencing data collection and downloading, chloroplast genome assembly and SNP screening analysis. This study can classify high-yield varieties into three types: A type, B type and AB type by clustering analysis of the screened SNPs, among which A type and B type are two complementary types, and AB type includes both A type and B type. The yield of rubber trees with cultivated varieties of A type, B type and AB type is higher than that of wild type.

[0023] The s116127-C / A provided by the present invention is used to pair wild-type germplasms numbered WAC-1 to WAC-33, WRO-1 to WRO-53, WMG-1 to WMG-29 and cultivated variety samples numbered Cul-1 to Cul-127. When the base of the SNP site is C, the sample is an AB type cultivated variety, and when the base of the SNP site is A, the sample is an ab type variety. The latex yield of the AB type rubber tree is higher than that of the ab type. The results are shown in Tables 1 and 2, wherein Cul is a cultivated variety material, and WAC, WRO and WMG represent wild germplasm materials collected in three regions of Brazil.

[0024] Table 1 Identification results of WAC-1~WAC-33, WRO-1~WRO-53, WMG-1~WMG-29

[0025] Table 2 Identification results of Cul-1~Cul-127

[0026] Among the 115 wild germplasm materials in Table 1, 11 samples were detected to be AB type. As shown in Table 2, among the cultivated variety samples numbered Cul-1 to Cul-127, 124 were AB type. Figure 3It can be seen that the s116127-C / A provided by the present invention can identify AB-type cultivars with higher latex yield and distinguish them from ab-type cultivars; this site covers 97.64% (124 / 127) of the detected cultivars, and can also be used to identify potential high-yield resistant planting materials from wild germplasm, which can greatly improve the breeding process.

[0027] Test Example 1 Some varieties were extracted, and their latex yields were collected, which were expressed as the volume of latex that could be collected per cut, and then the screening results of the present invention were verified, as shown in Tables 3 and 4 below.

[0028] Table 3 Latex yield of samples WAC-1~WAC-33, WRO-1~WRO-53, WMG-1~WMG-29

[0029] Table 4 Latex yield of samples Cul-1~Cul-93

[0030] From Tables 1 to 4, it can be seen that among the 242 samples, 135 AB-type cultivars were obtained by screening the SNP loci of the present invention, of which 81 samples had a latex yield of >50 mL / knife, belonging to high-yield varieties.

[0031] There are certain discrepancies between the screening results and the yield results. This is because there are many factors affecting the yield, such as climatic conditions, pests and diseases, planting management methods and rubber tapping techniques, which can lead to deviations in the yield results. Among the germplasms obtained by screening using the SNP markers of the present invention, 60% are high-yield varieties, which can indicate that the SNP loci provided by the present invention are related to the latex yield of rubber trees, and the SNP loci provided by the present invention can be used to screen high-yield germplasms of rubber trees.

[0032] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. An application of a SNP site for identifying high-yield varieties of rubber trees in the breeding of high-yield varieties of rubber trees, characterized in that, The SNP site is located at the 147th position from the 5' end of the sequence shown in SEQ ID No. 1, and there is a C / A natural variation at this site.

2. The use according to claim 1, characterized in that The SNP site is related to the latex yield of the rubber tree; when the base of the SNP site is C, it indicates that the rubber tree is a high-yield variety.

3. The use according to claim 2, characterized in that The high yield means that the latex yield is greater than 50 mL / knife.

4. A method for identifying high-yield varieties of rubber trees, characterized in that: The following steps are involved: The DNA of the sample to be tested is amplified, and the SNP site polymorphism detection is performed using the SNP site described in claim 1 or 2. The sample to be tested is genotyped according to the detection result of the SNP site. When the base of the SNP site is C, it indicates that the sample is a high-yield variety of rubber tree.

5. An application of a SNP site for identifying high-yield varieties of rubber trees in the preparation of a product for identifying high-yield varieties of rubber trees, wherein the SNP site is located at the 147th position from the 5' end of the sequence shown in SEQ ID No.1, and there is a C / A natural variation at the site.

6. The use according to claim 5, characterized in that: The product includes a kit and / or a gene chip.

7. A kit for identifying high-yield varieties of rubber trees, characterized in that: The kit comprises the SNP site according to claim 1 or 2.

8. An application of a SNP site for identifying high-yield varieties of rubber trees in constructing a rubber tree gene library, wherein the SNP site is located at the 147th position from the 5' end of the sequence shown in SEQ ID No.1, and there is a C / A natural variation at the site.

Images