Cloning of translocation recombinant fragment in gibberellic disease resistant wheat Zhongke 1878, molecular marker development and breeding application

Abstract

The invention relates to cloning of a translocation recombinant fragment in gibberellic disease resistant wheat Zhongke 1878, molecular marker development and breeding application. Specifically, the invention relates to a specific molecular marker of the gibberellic disease resistant wheat Zhongke 1878, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO: 4. The invention also relates to application of the molecular marker in breeding and / or identification of wheat resistant to gibberellic disease. In addition, the invention also relates to a recombinant site RS-6DL / 7EL in the gibberellic disease resistant wheat Zhongke 1878, and the nucleotide sequence of the recombinant site RS-6DL / 7EL is as shown in SEQ ID NO: 1. The invention also relates to application of the recombinant site RS-6DL / 7EL in breeding and / or identification of wheat resistant to gibberellic disease. The invention has important significance on wheat scab resistance breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant chromosome engineering and molecular breeding, and relates to the cloning of translocation recombinant fragments in the scab-resistant wheat Zhongke 1878, the development of molecular markers and breeding applications. The new scab-resistant wheat variety - Zhongke 1878 carries the scab-resistant segment from Elymus elongatus, wherein the 7EL fragment of Elymus elongatus is integrated into the end of the long arm of the wheat 6D chromosome through translocation, forming a new recombinant chromosome 6DS·6DL / 7EL. The present invention discloses the specific sequence RS-6DL / 7EL of the recombination site of the 6DL / 7EL recombinant fragment of wheat and Elymus elongatus in Zhongke 1878, and develops the molecular marker WE1820 for identifying the recombination site of the 6DS·6DL / 7EL recombinant chromosome of Zhongke 1878. In addition, using the specific primer combination (WEW165-F, WEE1655-R and WEW798-R) designed by the present invention, a rapid typing method based on multiplex PCR technology was established, which can efficiently identify the recombinant chromosome 6DS·6DL / 7EL of the wheat-Elygropyrum longissima translocation line Zhongke 1878. This technical system can accelerate the breeding process of wheat varieties resistant to Fusarium fusarium. Background Art

[0002] Wheat (Triticum aestivum L.) is one of the important food crops, and maintaining and improving its yield is an important guarantee for food security. Wheat head blight (Fusarium head blight) is one of the three major diseases in wheat production. Breeding disease-resistant varieties is the most economical and environmentally friendly measure to control head blight. However, the biggest challenge faced in the breeding process is the lack of disease-resistant resources. At present, Sumai No. 3 and its derivative lines carrying the major resistance gene Fhb1 have been widely used in wheat head blight resistance breeding around the world. It is reported that more than 120 wheat varieties resistant to head blight in my country are related to Sumai No. 3. In addition, Chinese breeders have also bred Yangmai series, Ningmai series and Emai series resistant to head blight, making important contributions to the prevention and control of head blight. However, most of these varieties show strong spring characteristics, tall plants, large leaves, loose plant shape and low tillering rate, which are obviously different from the ecological needs of the Huanghuai winter wheat area and cannot meet the production requirements of the area. Therefore, the development of wheat varieties resistant to ergot disease that are adaptable to breeding in the Huanghuai winter wheat region remains the focus and difficulty of current breeding work.

[0003] As a wild relative of wheat, Elytrium longispinum contains rich excellent gene resources, which can provide important support for the genetic improvement of wheat. Han Fangpu's team at the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, has long been committed to the study of distant hybridization of wheat. Laboratory studies have shown that the long arm of chromosome 7E (7EL) of diploid Elytrium longispinum carries the Fusarium head blight resistance gene Fhb-7EL. The team used the method of irradiating the pollen of the Chinese Spring-Elytrium longispinum telomere addition line (CS-7EL) with physical rays to create a wheat-Elytrium longispinum translocation line, and used fluorescence in situ hybridization technology to screen 836 wheat-Elytrium longispinum translocation lines from the offspring. After years of multi-point disease resistance identification, they finally bred a number of new wheat lines resistant to Fusarium head blight, named the "Zhongke Series", and successfully applied them to wheat breeding. Among them, the new wheat line Zhongke 1878 is particularly outstanding. The disease resistance segment of Thinopyrum elongatum 7EL carried by it was integrated into the end of the long arm of wheat chromosome 6D through recombination, forming a new recombinant chromosome 6DS·6DL / 7EL, which provides new genetic resources and technical paths for wheat Fusarium head blight resistance breeding (see reference: Guo et al. Systemic development of wheat-Thinopyrum elongatum translocation lines and their deployment in wheat breeding for Fusarium head blight resistance. The Plant Journal. 2023;114:1475-1489). Zhongke 1878 participated in the national wheat breeding joint research variety comparison test, regional test and production test, and passed the national approval in 2024 (Guo Shen Mai 20243007). At present, there is no relevant report on the recombinant sequence of wheat and Thinopyrum elongatum recombinant fragment 6DL / 7EL in Zhongke 1878 and the rapid utilization system of Fusarium head blight resistance genes. Summary of the invention

[0004] The present invention compares the genome resequencing data of the Chinese Spring-Elymus elongatus telesome addition line CS-7EL to the genome of the assembled wheat-Elymus elongatus translocation line Zhongke 1878, and successfully obtains the nucleic acid sequences on both sides of the recombination point of the wheat 6DL chromosome and the Elymus elongatus 7EL chromosome in Zhongke 1878. Based on this information, specific sequence (RS-6DL / 7EL) primers with 2kb on both sides of the 6DL / 7EL recombination site were designed, and the recombinant sequence was verified by PCR, and the molecular marker WE1820 (composed of the WEW165-F and WEE1655-R primer pairs) for identifying the recombination site was successfully obtained. In the translocation line Zhongke 1878, the molecular marker amplified fragment size was 1820bp, while no bands were amplified in other common wheat varieties, proving that the marker has specificity.

[0005] Furthermore, by using the sequence of wheat 6DL on the left side of the 6DL / 7EL recombination site to perform Blast analysis on the Chinese Spring reference genome (Wheat Chinese Spring IWGSC RefSeq v2.1 pseudomolecules), the recombination site was determined to be located at 462, 150, and 207 bp on wheat chromosome 6D. Then, a 1000 bp sequence from the Chinese Spring reference genome downstream of the recombination site was extracted, and the reverse primer WEW798-R was designed. Using the molecular marker WE963 (composed of the WEW165-F and WEW798-R primer pairs), a 963 bp band was amplified in common wheat varieties, indicating that the recombinant chromosome 6DS·6DL / 7EL from Zhongke 1878 does not exist in common wheat varieties.

[0006] In order to accelerate the breeding and utilization of the Fusarium fusogenum resistance segment of Zhongke 1878, the present invention combines primers WEW165-F, WEE1655-R and WEW798-R for multiple PCR, and establishes a rapid typing technology for the recombinant chromosome 6DS·6DL / 7EL of the wheat-Elystroemia indica translocation line Zhongke 1878. The technology is used in wheat Fusarium fusogenum resistance breeding and significantly accelerates the breeding process.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] On the one hand, the present invention provides a specific molecular marker for the wheat Zhongke 1878 that is resistant to ergot disease, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO:4.

[0009] On the other hand, the present invention provides a primer pair for detecting specific molecular markers of wheat Zhongke 1878 resistant to ergot disease, and the sequences of the primer pair are shown in SEQ ID NO:2 and SEQ ID NO:3.

[0010] In another aspect, the present invention provides the use of the molecular markers described above in the breeding and / or identification of wheat resistant to ergot.

[0011] On the other hand, the present invention provides a kit for breeding and / or identifying the wheat Zhongke 1878 resistant to ergot disease, the kit comprising the primer pair as described above.

[0012] On the other hand, the present invention provides a method for breeding and / or identifying the wheat Zhongke 1878 resistant to Fusarium fusarium, the method comprising the step of detecting the plant to be tested using the primer pair as described above.

[0013] In some embodiments, the method for detecting the plant to be tested is PCR detection.

[0014] In some embodiments, if a band of 1820 bp is amplified in the plant to be tested, the plant to be tested is determined to be wheat Zhongke 1878 resistant to ergot.

[0015] On the other hand, the present invention provides a recombination site RS-6DL / 7EL in the ergot-resistant wheat Zhongke 1878, and the nucleotide sequence of the recombination site RS-6DL / 7EL is shown in SEQ ID NO:1.

[0016] On the other hand, the present invention provides the use of the recombination site RS-6DL / 7EL as described above in the breeding and / or identification of wheat resistant to Fusarium head blight.

[0017] On the other hand, the present invention provides the use of the recombination site RS-6DL / 7EL as described above in the breeding and / or identification of the wheat Zhongke 1878 resistant to ergot.

[0018] On the other hand, the present invention provides a method for breeding and / or identifying wheat Zhongke 1878 resistant to ergot disease, the method comprising the steps of designing primers for the recombination site RS-6DL / 7EL as described above, and using the primers to detect the plant to be tested.

[0019] On the other hand, the present invention provides primers for detecting specific molecular markers of the wheat Zhongke 1878 resistant to Fusarium fusarium, wherein the primers are designed for the recombination site RS-6DL / 7EL as described above.

[0020] On the other hand, the present invention provides a kit for breeding and / or identifying the wheat Zhongke 1878 resistant to ergot disease, the kit comprising the primers as described above.

[0021] In some embodiments, breeding and / or identifying wheat Zhongke 1878 that is resistant to ergot disease also includes breeding and / or identifying hybrid progeny of wheat Zhongke 1878 that is resistant to ergot disease.

[0022] In some embodiments, the PCR reaction program for detecting the plant to be tested is: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds, running for 35 cycles; and finally extension at 72°C for 5 minutes.

[0023] On the other hand, the present invention provides a wheat typing method, which comprises performing multiple PCR using primers SEQ ID NO: 2, 3 and 5. If a fragment with a size of 1820 bp is amplified, the wheat to be tested is the wheat Zhongke 1878 resistant to ergot.

[0024] definition

[0025] Molecular marker: Molecular marker refers to the technology of identifying and marking a specific DNA sequence through molecular biological methods (such as PCR, RFLP, SSR, etc.). It can be used as a tool to track specific mutation sites in genes or genomes, and then used for genetic analysis of traits, variety identification and genetic improvement of crops. In the present invention, molecular markers WE1820 and WE963 are used to identify the recombination sites between wheat and Elymus elongatus in Zhongke 1878 and specific sequences without recombinant chromosomes in other common wheat varieties.

[0026] Typing: Typing refers to the process of identifying and classifying the genotype of an individual through molecular markers or other genetic marker technologies. Through typing, specific genes or sequence variations carried by different individuals in the genome can be identified, and their genetic background and related traits can be understood. In the present invention, typing technology is used to identify the recombinant chromosome 6DS·6DL / 7EL in the Zhongke 1878 wheat-Elymus elongatus translocation line, and whether the recombinant fragment is carried in common wheat varieties.

[0027] Translocation line: Translocation line refers to a type of plant individuals containing gene or gene fragment translocation formed by chromosome rearrangement, chromosome fragment transfer, etc. In the present invention, the wheat-Elygropyrum longissimum translocation line refers to the use of physical ray radiation technology to translocate the 7EL chromosome fragment of Elygropyrum longissimum with the 6D chromosome of wheat to create the recombinant chromosome 6DS·6DL / 7EL line Zhongke 1878 containing the Fusarium head blight resistance gene Fhb-7EL.

[0028] Multiplex PCR: Multiplex PCR is a technique that amplifies multiple target DNA fragments simultaneously by designing multiple specific primers. It can amplify multiple genes or gene fragments in the same PCR reaction, thereby improving experimental efficiency and reducing sample consumption. In the present invention, multiplex PCR technology, combined with primers WEW165-F, WEE1655-R and WEW798-R, was used to achieve rapid typing and detection of the recombinant chromosome 6DS·6DL / 7EL in Zhongke 1878, significantly accelerating the process of breeding for resistance to Fusarium head blight. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The results of the karyotype analysis of the chromosomes of Zhongke 1878 using fluorescence in situ hybridization (FISH) were presented. The DNA of Elymus longispinus was used as a probe in the experiment to successfully identify and mark specific regions on the chromosomes of Zhongke 1878. Through FISH analysis, Figure 1 It clearly showed that the 7EL chromosome fragment of Elymus elongatus existed on the chromosome of Zhongke 1878. This result proved that the 7EL fragment of Elymus elongatus existed stably in Zhongke 1878 and successfully translocated with the 6D chromosome of wheat to form a new recombinant chromosome 6DS·6DL / 7EL.

[0030] Figure 2 The results of identification of 6DL and 7EL recombination sites in the wheat-Elygropyrum elongatum translocation line Zhongke 1878.

[0031] Figure 3 The results of amplification of molecular markers WE1820 and WE963 in Zhongke 1878 and common wheat.

[0032] Figure 4 The results of three-primer multiplex PCR amplification in the hybrid progeny of Zhongke 1878 are shown. DETAILED DESCRIPTION

[0033] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments and with reference to the accompanying drawings.

[0034] The wheat varieties used in the present invention are all materials that can be obtained by those skilled in the art through conventional means, such as through commercial channels, or from breeding units or germplasm banks.

[0035] The inventors aligned the genome resequencing data of the Chinese Spring-Elygropyrum telomere addition line CS-7EL with the assembled genome of the wheat-Elygropyrum telomere translocation line Zhongke 1878, and obtained the nucleic acid sequences on both sides of the recombination points of the wheat chromosome 6DL and the Elygropyrum 7EL chromosome in Zhongke 1878. Primers were designed using the 2kb sequences RS-6DL / 7EL on both sides of the 6DL / 7EL recombination point to perform PCR verification on the recombinant sequences, and molecular markers WE1820 (WEW165-F and WEE1655-R) that identify the specific sequence of the recombination site were obtained. The size of the amplified fragment in the translocation line Zhongke 1878 was 1820bp, and no bands were amplified in other common wheat varieties. At the same time, Blast analysis was performed on the Chinese Spring reference genome (Wheat Chinese Spring IWGSC RefSeq v2.1 pseudomolecules) using the sequence from wheat 6DL on the left side of the 6DL / 7EL recombination site, and it was determined that the recombination point between wheat 6DL and Elymus elongatus 7EL was located at 462150207bp on wheat chromosome 6D. The 1000bp sequence from the Chinese Spring reference genome downstream of the recombination site was extracted to design the reverse primer WEW798-R. The molecular marker WE963 (WEW165-F and WEW798-R) was used to amplify a 963bp band in common wheat varieties, indicating that there was no recombinant chromosome 6DS·6DL / 7EL from Zhongke 1878 in common wheat varieties. In order to accelerate the breeding and utilization of the Fusarium fusogenum resistance segment of Zhongke 1878, the present invention combines primers WEW165-F, WEE1655-R and WEW798-R for multiple PCR, and establishes a rapid typing technology for the recombinant chromosome 6DS·6DL / 7EL of the wheat-Elystroemia indica translocation line Zhongke 1878. This technology can be used in wheat Fusarium fusogenum resistance breeding to accelerate the breeding process.

[0036] Example 1 Obtaining the nucleic acid sequences on both sides of the recombination point between wheat chromosome 6DL and Elymus elongatus chromosome 7EL in Zhongke 1878

[0037] The inventors aligned the genome resequencing data of the Chinese Spring-Elygropyrum elongatum teleostomy addition line CS-7EL to the assembled genome of the wheat-Elygropyrum elongatum translocation line Zhongke 1878, and obtained the nucleic acid sequences on both sides of the recombination points of the wheat 6DL chromosome and the Elygropyrum elongatum 7EL chromosome in Zhongke 1878.

[0038] Among them, the recombination site RS-6DL / 7EL sequences of wheat 6DL (underlined) and Elymus elongatus 7EL (not underlined) in the wheat-Elymus elongatus translocation line Zhongke 1878 (2 kb sequences on both sides of the 6DL / 7EL recombination site, a total of 4000 bp) are as follows:

[0039] GTTTGGCACCAGTATTATTATTTCTGTAGTTTTCCTCTCGAGGAGTCATGCAGACACTCGTTTGGCAC CAGTACTACTATTCTTGCAGTTTCCGCTCGAGGAGTCATTCGGACCCTCGTTTGGCACCCAGCATTTATTATCTCT ATGTCTGAACGCGCTGGTTAACTTGTTTATATGCTTCATGTTTACATTTGTTATATCTTATGTCCGAACTGTCTTG CGAGTACTTTCATAGTACTCACCTGGCTTGTTGATTTGGCCGGATGTTGACGAAGACGATCTCTTGGATGAAGAGT TTGATAGCGTGTCCGACGCCTAGAGGAGTCCCAGTCAGTCCTGCGCGATCCCGGATATTGGTCACTTGTATTATAT ACGCTTCCGCCACCTGTAATAAGTCTCCTCGAGCCTCACTCCAACGCTCGAAGAGCTGTAGTCTTCAGGAGTCATA TCACTCACTTCGCAGTGATATTCCCACCACTGTTATTATCGTGAGTTAGTAATTATGCCACCCTATCCGCCATCTT GTTTTATCGGCATGCATGTAATAAATTGTTGGGCAATTTCCGCTCAACTTTGTATTATATTCAGTACTCCTGGTAT TTTTCTTCTGTGACCATGATAGTGTCTACCAGTGAGAAGGGATTCTTCCTTACTGGTCCGTAAAAGGGATTGGTCT CTCAATAATTATATTATTGAAAAACCGGTCGTGACACTTCGACTTGAAGTCCTATCTCTAAGAAAGATTGCCGAGA ACACCAATGAGAACCTCATCGCTAAACAGTTACACCTGGAAGCTATGACCGACATGCTAGGCCGATCTCACAGCCT TGCTCAGCAGCTTGCACAGCAGTTTCCCGCAAGGCTAACCTTTCTTGAACTGTCTTGGAAGTGGCCTCGGTTCAGT ATTATTTTGTTACGCTGCAATGGTGCCCAGTTTTTGTAATCTGCTTCTTCGTTGCGCGTTATGATCACTGGTGGCA AACTTCGATGCCCAGTGGATGTAATATACCATAAATCCTTTATTGTATAGTGTAGGTTTATTCTTAGTTACTATGC CGTAATTTCTTTATTGTATAGAGTAGGTTTGTTCTTAATTCTTACTAGTTACTGCCATCATTCGCTATCTAAAAAA AATCAGATGTAGTCGACCGGGCCGAAACATTCGCCTCTAACGGGCCTAGTGTTTAGCGGGCCACAATTGGGTCGGC CTGCATCTTTCTTGGGCCTGAATCATTGGGGCCGTCACACTTTGCGCGAGGCCCACAACTTACACTGGCCTATATT TTAGTTGGGCCTTTTGTGGACCCAGCGCTTAGTTTCGCCCAGGTAGCGTTGGGCCATTAACAGGCTGAATATTGTA CTGGCCTGTAACGGCCCAGATGAAACCATGGGCCTTTAGTAGGCCGAATGCATATTGGGCCTCAATTTTCACTAGT CGTCGACGGGCCTTCAGCAGGCTGAAATGTAGACGGGGCCTTTTTGGGCCCAGTTATATCACGGGCAGTTACCAGG CCGAAACATATCTTGGGCCTTAGTTGGCCCACTGATATCATGGGCCTTTAAGAGGCCGAAAGCTTAGTACAGACAT CAACGTGCCGAATTATGCGACAGGCCTTTAACAGGCCCAAAGTTACGTTGGGCTTAACTGTTGCCACCTTTATCAC GGGCCGTTATTGGGCCCGATGTCCTGTCGGACCATATATGGCCCATGGGCAGCACGGGCCATTCCCAGGCCGAAAG TCACACCGGGCTGAAATGGGCCCATGTCTACATCGGGCCTCTAACAGGCCGAAAGTCACTGGGCTATAACTGGGCC CAAATATTCAGCGAACAATTAACGGGCGAGATCTGGCTTCGGGAAGTAAATGGGCCCAAATATTCAGCAAACAATT AACGGGCCAGATCTGGCTTCGGGCCGTAAATGGGCCTCTATTAAGGAGGCCGTTATTGGGCTGGCCCACTAGTACC TGAGTAAGTACTACGGGCCTTTGACTGGGCCG

[0040] Example 2 Acquisition and verification of molecular markers for recognizing the specific sequence of recombination point RS-6DL / 7EL

[0041] The inventors used the 2kb sequence RS-6DL / 7EL on both sides of the 6DL / 7EL recombination point to design primers for PCR verification of the recombinant sequence, and obtained the molecular marker WE1820 (WEW165-F and WEE1655-R) that recognizes the specific sequence of the recombination site. The size of the amplified fragment in the translocation line Zhongke 1878 was 1820bp, and no bands were amplified in other common wheat varieties.

[0042] The primers are as follows:

[0043] WEW165-F: 5'-TAACGGGCGAGATCTGGCTTCGGGAA-3' (SEQ ID NO: 2);

[0044] WEE1655-R: 5'-CCTCTTCTCACTATAACCTGGGCTCATCT-3' (SEQ ID NO: 3).

[0045] The amplified sequence of molecular marker WE1820 is as follows:

[0046]

[0047] The genome of the plant materials to be tested was amplified by PCR, and the materials that could amplify 1820 bp all contained the recombinant chromosome 6DS·6DL / 7EL from Zhongke 1878.

[0048] The plant materials to be tested include Zhongke 1878, Jimai 22, Zhoumai 36, Yannong 19, Beijing 8, Jiangdongmen, Sumai 3, Longmai 33, Funo, St2422 / 464, Mentana, Orofen, Early Preminum, Triumph, Lovrin10, Bima 4, Xinong 6028, Xiaoyan 6, Aifeng 3, Lumai 1, Macaemai, Ningchun 4, Fan 6, Nongda 183, Shimai 14, Zhengmai 7698, Luohan 7, and Shiluan 02-1.

[0049] Table 1 PCR system 1

[0050]

[0051] PCR reaction program: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, run 35 cycles; finally 72℃ extension for 5 minutes. PCR amplification products can be stored at 16℃.

[0052] PCR product electrophoresis detection system: 1.2% agarose gel electrophoresis, voltage: 120V, time: 25 minutes, buffer: 1×TAE.

[0053] At the same time, the inventors used the sequence of wheat 6DL origin on the left side of the 6DL / 7EL recombination site to perform Blast analysis on the Chinese Spring reference genome (Wheat Chinese Spring IWGSC RefSeq v2.1 pseudomolecules), and determined that the recombination point between wheat 6DL and Elymus elongatus 7EL was located at 462150207bp on wheat chromosome 6D. The inventors extracted 1000bp sequence from the Chinese Spring reference genome downstream of the recombination site and designed the reverse primer WEW798-R. Using the molecular marker WE963 (WEW165-F and WEW798-R), a 963bp band was amplified in common wheat varieties, indicating that there was no recombinant chromosome 6DS·6DL / 7EL originating from Zhongke 1878 in common wheat varieties.

[0054] WEW165-F: 5'- TAACGGGCGAGATCTGGCTTCGGGAA-3' (SEQ ID NO: 2);

[0055] WEW798-R: 5'-TAGAGCCTTTCGCAAGCAAAGACAG-3' (SEQ ID NO: 5).

[0056] Table 2 PCR system 2

[0057]

[0058] PCR reaction program: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, run 35 cycles; finally 72℃ extension for 5 minutes. PCR amplification products can be stored at 16℃.

[0059] PCR product electrophoresis detection system: 1.2% agarose gel electrophoresis, voltage: 120V, time: 25 minutes, buffer: 1×TAE.

[0060] The amplified sequence of molecular marker WE963 is as follows:

[0061] TAACGGGCGAGATCTGGCTTCGGGAAGTAAATGGGCCCAAATATTCAGCAAACAATTAACGGGCCAGATCTGGCTTCGGGCCGTAAATGGGCCTCTATTAAGGAGGCCGTTATTGGGCTGGCCCACTAGTACCTGAGTAAGTACTACGGGCCTTTGACTGGGCCGACCTTTTTATATATGGGCATCTGTTGGGCCGTGCCACGTGTCCACGTATCATAGGTGCTTTGGGTCCAATGAGTGGATGACATCTATCCCAACGGTGAGCCGACACGTGTTTCCTCCAGCCAATGATGATTTTACACGTGGAAAATCCCCATTGGTCGGGGCTGTTAACGGGTTATCGGATCCAAAACCGGACCCGATAGCTTAACGGCGTTCCGTTATGGTGGATGCCACGTGTCGGTCACCCTTGACGAAAGCACTTCTGTGACGCGCGATTTATCGTCATGGAAGTGGACACTTTCGTGATGATAATTTTGGTAATGTCATGGAACACTTCTACGACAGCACAGGTATGACTATCTTGATTCTGTCATAAATTTGTCATGGATGTACATGCATGACAGAAAACGTAACCTACTGTGACAAACACGTATCATCACAGAAGTGTAGTTTTTTTGTAGTGAAGGGACAAGAGACACAGCAGTTTATCCTGGTTCGGGCCACCTTGCGGTGTAATACCCTACTCCAGCTTTGTGGTGGATTGCCTTAGGGGGCTGAGGATGAACTAGTACAGTGGTTGAGCAGCCTCAGGAGGTGAGGTGTTCTTGAGCTCGATGAGCTGGTGGAATGGTCAAGGTGGAATCCATCCCCTCCCCATGGTAGTGGCTAAGTCCTATTATAGTGGCCTTGGTCCTCTCCCCAAATGTAGGCGGGGAGGGATCCCACAATGGCCAAATTTGAAGGGGGACAACTAGTACAAGCTATCCTGACAAAAGCTGTCTTTGCTTGCGAAAGGCTCTA(SEQ ID NO:6)

[0062] The results of the above experiments are as follows Figure 3 As shown in the figure, it can be seen that the 1820 bp fragment was identified only in Zhongke 1878, and only 963 bp fragments were identified in other wheats.

[0063] Example 3 Rapid typing of recombinant chromosome 6DS·6DL / 7EL in Zhongke 1878

[0064] In order to accelerate the breeding and utilization of the Fusarium fusogenum resistance segment of Zhongke 1878, the present invention combines primers WEW165-F, WEE1655-R and WEW798-R for multiple PCR, and establishes a rapid typing technology for the recombinant chromosome 6DS·6DL / 7EL of the wheat-Elystroemia indica translocation line Zhongke 1878. This technology can be used in wheat Fusarium fusogenum resistance breeding to accelerate the breeding process.

[0065] Table 3 Three-primer multiplex PCR system

[0066]

[0067] PCR reaction program: 94℃ pre-denaturation for 5 minutes; 94℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, run 35 cycles; finally 72℃ extension for 5 minutes. PCR amplification products can be stored at 16℃.

[0068] PCR product electrophoresis detection system: 1.2% agarose gel electrophoresis, voltage: 120V, time: 25 minutes, buffer: 1×TAE.

[0069] The experimental results are as follows Figure 4 shown.

[0070] The specific embodiments described above further illustrate the objectives, technical solutions and beneficial effects of the present invention in detail. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A specific molecular marker for the resistance to scab in wheat Zhongke 1878, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO:

4.

2. A primer pair for detecting specific molecular markers of wheat Zhongke 1878 resistant to scab, characterized in that: The sequences of the primer pair are shown in SEQ ID NO:2 and SEQ ID NO:

3.

3. Use of the molecular marker according to claim 1 in the breeding and / or identification of wheat resistant to ergot.

4. A method for breeding and / or identifying wheat Zhongke 1878 resistant to ergot disease, the method comprising the step of detecting the plant to be tested using the primer pair according to claim 2.

5. The recombination site RS-6DL / 7EL in the fusarium resistant wheat Zhongke 1878 is characterized by: The nucleotide sequence of the recombination site RS-6DL / 7EL is shown in SEQ ID NO:

1.

6. Use of the recombination site RS-6DL / 7EL according to claim 5 in the breeding and / or identification of wheat resistant to ergot.

7. Use of the recombination site RS-6DL / 7EL according to claim 5 in the breeding and / or identification of the ergot-resistant wheat Zhongke 1878.

8. A method for breeding and / or identifying wheat Zhongke 1878 resistant to scab, characterized in that: The method comprises the steps of designing primers for the recombination site RS-6DL / 7EL according to claim 5, and using the primers to detect the plant to be tested.

9. Primers for detecting specific molecular markers of wheat Zhongke 1878 resistant to scab, characterized in that: The primers are designed for the recombination site RS-6DL / 7EL according to claim 5.

10. A kit for breeding and / or identifying wheat Zhongke 1878 resistant to scab, characterized in that: The kit comprises the primer pair according to claim 2 or the primer according to claim 9.

Images