Nicotinamide mononucleotide adenosine transferase mutant and application thereof

Abstract

The invention belongs to the field of biopharmacy and biotransformation, and particularly relates to a nicotinamide mononucleotide adenosine transferase mutant and application thereof. According to the invention, NMN is taken as a substrate, ATP disodium salt is taken as an auxiliary substrate, and NAD < + > is prepared under the catalysis of the nicotinamide mononucleotide adenosine transferase mutant under the action of magnesium ions, so that the enzymatic activity is improved, few byproducts are generated, and the reaction rate is high. The nicotinamide mononucleotide adenosine transferase mutant disclosed by the invention has better catalytic efficiency, and when NMN is taken as a substrate for catalytic reaction, the conversion rate is higher than that of an original enzyme, and the NAD < + > yield is also increased to a certain extent. The process overcomes the defects of various process steps, harsh reaction conditions, difficulty in separation and purification and the like of a chemical method for synthesizing NAD < + >, and is an efficient, low-cost and environment-friendly production mode.

Description

Technical Field

[0001] The present invention belongs to the field of biopharmaceuticals and biotransformation, and specifically relates to a nicotinamide mononucleotide adenylyltransferase mutant, a mutant encoding gene, a recombinant vector containing the mutant encoding gene, a recombinant genetic engineering bacterium containing the mutant encoding gene, and the application of the nicotinamide mononucleotide adenylyltransferase mutant in biocatalytic synthesis of nicotinamide adenine dinucleotide. Background Art

[0002] NAD + Nicotinamide Adenine Dinucleotide (NAD) is an important intracellular coenzyme that is essential for regulating cell aging and maintaining normal body functions. + Its metabolism directly or indirectly affects many aging-related diseases such as neurodegeneration and cancer, and has a wide range of application value. + NAD for industrial use + dependent enzyme catalysis, while NAD + NAD-dependent enzymes are widely used in industry to synthesize various important chemicals, drugs, and food additives. + Dependent amino acid dehydrogenases can catalyze the synthesis of chiral amino acids, while NAD + It can also be used in the synthesis of some high-value chemicals, such as chiral drugs, vitamins, natural products, etc. In these applications, NAD + The highly efficient catalytic effect significantly improves the selectivity and yield of the reaction, reduces environmental pollution, and complies with the principles of green chemistry. + The high consumption in catalytic reactions, especially in large-scale production, limits its widespread application due to its high cost. Therefore, how to efficiently produce NAD on a large scale? + It has become a focus of current research.

[0003] Currently, various NAD + Chemical synthesis method, but NAD is synthesized by chemical method + , but has the disadvantages of long reaction time, low yield, complicated separation and purification steps, and high pollution of chemical reagents used in the synthesis process. In contrast, NAD is synthesized by biological method using NMN (nicotinamide mononucleotide) as substrate + It can overcome the limitations of the above-mentioned chemical methods and is an efficient, low-cost and environmentally friendly production method.

[0004] Synthesize NAD using NMN as a substrate through biological methods + It has many advantages: 1. NMN is NAD + The direct precursor of + The required nucleotide components enable more efficient synthesis of NAD + This advantage makes the biological synthesis of NAD + It has more advantages than chemical synthesis methods, and can significantly improve the synthesis efficiency and simplify the reaction process. Using NMN as a substrate to synthesize NAD + , which can reduce the multi-step synthesis and complex separation and purification steps required in chemical methods, while avoiding high consumption of chemical reagents; 2. In recent years, the chemical synthesis technology of NMN has made important breakthroughs, greatly improving production efficiency and significantly reducing costs. This progress has led to a significant drop in the price of NMN, further promoting its application in industrial production. As the cost of NMN synthesis decreases, the synthesis of NAD + The economic benefits have been greatly improved, providing a good foundation for large-scale production; 3. Synthesis of NAD by enzymes + , the reaction is simple and produces few by-products; 4. The bioenzyme catalytic reaction has the advantages of high efficiency, fast reaction rate and high conversion rate. The bioenzyme shows high specificity and reaction speed in the catalytic process and can complete the conversion of NAD in a short time. + synthesis.

[0005] When NAD is synthesized enzymatically + Although this method shows potential in production, it still faces some challenges. One of them is that the activity of the enzyme has not yet reached the level required for industrialization, which limits its efficiency in large-scale production. Secondly, the economic benefits are limited. Therefore, the activity of the enzyme needs to be further improved to ensure that it can meet the needs of industrialization and achieve higher economic benefits. Summary of the invention

[0006] The present invention is to overcome the enzymatic synthesis of NAD in the prior art + The defects of the process such as low enzyme activity, low production efficiency and high cost are overcome. A nicotinamide mononucleotide adenylyltransferase mutant, a mutant encoding gene, a recombinant vector containing the mutant encoding gene, and a recombinant genetically engineered bacterium containing the mutant encoding gene are provided. The nicotinamide mononucleotide adenylyltransferase mutant is applied to the process of biocatalytic synthesis of nicotinamide adenine dinucleotide.

[0007] To achieve the above-mentioned purpose, the present invention is implemented by the following technical solutions: A nicotinamide mononucleotide adenylyltransferase mutant is obtained by site-directed mutagenesis of the amino acid sequence shown in SEQ ID NO. 1, wherein the mutation site is one or more of the following: (1) position 6, (2) position 10, and (3) position 11.

[0008] Preferably, a nicotinamide mononucleotide adenylyltransferase mutant is provided, wherein the mutant is obtained by mutation of the amino acids in the sequence as shown in SEQ ID NO.1 at one or more of the following sites: (1) valine V at position 6 is mutated to cysteine ​​C, (2) glutamine Q at position 10 is mutated to glutamic acid E, and (3) proline P at position 11 is mutated to threonine T.

[0009] The nicotinamide mononucleotide adenylyltransferase of the present invention is derived from Methanothermobacter thermautotrophicus WP_048060754.1, and its amino acid sequence is shown in SEQ ID NO.1, and its encoding gene sequence is shown in SEQ ID NO.2.

[0010] A gene encoding a nicotinamide mononucleotide adenylyltransferase mutant as described above.

[0011] Preferably, the nucleotide sequence of the encoding gene is shown as SEQ ID NO.4.

[0012] Preferably, the amino acid sequence of the nicotinamide mononucleotide adenylyltransferase mutant is shown in SEQ ID NO.3.

[0013] A recombinant vector comprising the coding gene as described above.

[0014] A recombinant genetic engineering bacterium comprising the recombinant vector described above.

[0015] The recombinant genetically engineered bacteria of the present invention are prepared as follows: The nicotinamide mononucleotide adenylyltransferase gene (or mutant gene) was connected to the expression vector pET28a to construct a heterologous expression recombinant plasmid pET28a-NMNAT containing the nicotinamide mononucleotide adenylyltransferase gene; the heterologous expression recombinant plasmid pET28a-NMNAT was transformed into Escherichia coli BL21 (DE3) to obtain a recombinant Escherichia coli containing the recombinant plasmid pET28a-NMNAT.

[0016] Application of the nicotinamide mononucleotide adenylyltransferase mutant described above in the biocatalytic synthesis of nicotinamide adenine dinucleotide.

[0017] Preferably, the application is: using wet bacteria obtained by fermentation culture of recombinant genetically engineered bacteria containing a gene encoding a mutant of nicotinamide mononucleotide adenosyltransferase or pure enzyme extracted from wet bacteria after ultrasonic disruption as a catalyst, using nicotinamide mononucleotide as a substrate, and ATP disodium salt as a cosubstrate, in the presence of Mg 2+ In the presence of 5-nitropropene, the reaction is carried out at 30-50°C in a PB buffer solution with a pH value of 6.5-8. After the reaction is complete, nicotinamide adenine dinucleotide is obtained.

[0018] As further preferred, the pH value of the PB buffer in the reaction system is 7.0.

[0019] As further preferred, the reaction temperature in the reaction system is 45°C.

[0020] Preferably, in the reaction system, when the catalyst is wet bacteria, the amount of wet bacteria added is 5-20 g / L; when the catalyst is pure enzyme, the amount of pure enzyme added is 0.01-1.0 g / L; the final concentration of nicotinamide mononucleotide added is 33.4-167 g / L; the final concentration of ATP disodium salt added is 55.3-276.5 g / L; the final concentration of Mg added is 1.0 ... 2+ The final concentration is 14.25~71.25g / L.

[0021] As a further preferred embodiment, in the reaction system, when the catalyst is wet bacteria, the amount of wet bacteria added is 10 g / L; when the catalyst is pure enzyme, the amount of pure enzyme added is 0.1 g / L; the final concentration of nicotinamide mononucleotide added is 100.2 g / L; the final concentration of ATP disodium salt added is 165.9 g / L; the final concentration of Mg added is 100.2 ...Mg added is 100.2 g / L; the final concentration of Mg added is 100.2 g / L; the final concentration of Mg added is 100.2 g / L; the final concentration of Mg added is 2+ The final concentration was 42.75 g / L.

[0022] Preferably, in the reaction system, the molar ratio of nicotinamide mononucleotide to ATP disodium salt is 1:0.5-1.5; the molar ratio of nicotinamide mononucleotide to Mg is 1:0.5-1.5. 2+ The molar ratio is 1:0.5~2.

[0023] As a further preferred embodiment, in the reaction system, the molar ratio of nicotinamide mononucleotide to ATP disodium salt is 1:1; the molar ratio of nicotinamide mononucleotide to Mg 2+ The molar ratio is 1:1.5.

[0024] Therefore, the present invention has the following beneficial effects: (1) The present invention uses NMN as a substrate and ATP disodium salt as a co-substrate, and utilizes a mutant of nicotinamide mononucleotide adenylyltransferase to catalyze the preparation of NAD under the action of magnesium ions. + , which helps to improve enzyme activity, produce fewer by-products and increase the reaction rate; (2) The nicotinamide mononucleotide adenylyltransferase mutant of the present invention has better catalytic efficiency. When NMN is used as a substrate for catalytic reaction, the conversion rate is higher than that of the original enzyme. + The productivity has also been improved to a certain extent; (3) The process of the present invention overcomes the problem of chemical synthesis of NAD + It has the disadvantages of numerous process steps, harsh reaction conditions, and difficult separation and purification. It is an efficient, low-cost and environmentally friendly production method. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 To produce NAD using NMN as substrate by enzymatic method + Reaction diagram. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments of the specification. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should fall within the scope of protection of the present invention.

[0027] Reagents used in upstream genetic engineering: Phanta Super-Fidelity DNA Polymerase was purchased from Nanjing Novozyme Biotechnology Co., Ltd.; Dpn I was purchased from Thermo Scientific. Plasmid Miniprep Kit and PCR Clean-up Kit were purchased from AxyPrep; Clon Express II One Step Cloning Kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd. E. coli BL21 (DE3) was purchased from Shanghai Xuguan Biotechnology Development Co., Ltd.; DNA marker, low molecular weight standard protein, protein gel, etc. were purchased from Beijing GenStar Co., Ltd.; recombinant plasmid construction, primer synthesis, and sequence sequencing were completed by Hangzhou Qingke Zixi Biotechnology Co., Ltd. Other commonly used reagents were purchased from Sinopharm Chemical Reagent Co., Ltd.

[0028] Example 1: Construction of genetically engineered bacteria producing nicotinamide mononucleotide adenylyltransferase The gene sequence of nicotinamide mononucleotide adenyltransferase (Gen Bank No.: NC_000916.1) from Methanothermoautotrophic Bacillus was sent to Sangon Biotech (Shanghai) Co., Ltd. for full gene synthesis after codon optimization and cloned into the recombinant expression plasmid pET-28a (+). The gene sequence of nicotinamide mononucleotide adenyltransferase after codon optimization is shown in SEQ ID NO.2.

[0029] Example 2: Inducible expression of nicotinamide mononucleotide adenylyltransferase (NMNAT) The recombinant Escherichia coli BL21 (DE3) / pET28a-NMNAT obtained in Example 1 was inoculated into a LB liquid medium containing 50 μg / mL kanamycin resistance, cultured at 37 ° C, 200 rpm for 12 hours, and then inoculated into a fresh LB liquid medium containing 50 μg / mL kanamycin resistance at a 1% (v / v) inoculation amount, cultured at 37 ° C, 150 rpm until the bacterial OD 600 reached 0.6-0.8, added IPTG with a final concentration of 0.1mM, induced culture at 28 ° C for 12 hours, centrifuged at 4 ° C, 8000 rpm for 10 minutes, discarded the supernatant, and collected the precipitate to obtain the recombinant Escherichia coli BL21 / pET28a-NMNAT wet bacterial cells containing the expression recombinant plasmid. The wet bacterial cells can be directly used as a biocatalyst or for protein purification.

[0030] Example 3: Isolation and purification of nicotinamide mononucleotide adenylyltransferase (NMNAT) The wet cells obtained in Example 2 were resuspended in a binding buffer (50 mM, pH = 8.0 sodium phosphate buffer, containing 300 mM NaCl, 10 mM imidazole), and then ultrasonically disrupted (under ice bath conditions, 240 W for 10 min, working for 2 s, and pausing for 2 s), and centrifuged at 12000 rpm for 40 min. The supernatant was incubated with a Ni affinity chromatography resin equilibrated with the above binding buffer, and then rinsed with a washing buffer (50 mM, pH = 8.0 sodium phosphate buffer, containing 300 mM NaCl, 50 mM imidazole) until there was substantially no foreign protein, and then with an elution buffer (50 mM, pH = 8.0 sodium phosphate buffer, containing 300 mM NaCl, 300mM imidazole) was used to elute and collect the eluate to obtain the target protein. After electrophoresis to identify the purity, the target proteins were combined and dialyzed with dialysis buffer (50mM, pH=8.0 sodium phosphate buffer) for 48h (the molecular retention capacity of the dialysis bag is 14KD). The retentate was taken, which was the nicotinamide mononucleotide adenylyltransferase enzyme solution. The protein content was determined to be 3.8mg / mL using the Coomassie Brilliant Blue method. The enzyme solution (specific enzyme activity was approximately 30U / mg) was diluted with 50mM, pH=8.0 sodium phosphate buffer to a final concentration of 0.5mg / mL, aliquoted, and frozen at -80°C. Among them, nicotinamide mononucleotide adenylyltransferase (NMNAT) catalyzes the substrate NMN to produce 1μmol of product NAD per minute. + The amount of enzyme required is 1 enzyme activity unit, represented by U.

[0031] Example 4: Construction of a nicotinamide mononucleotide adenylyltransferase mutant library In the first round, the recombinant E. coli BL21 (DE3) / pET28a-NMNAT obtained in Example 1 was cultured in a test tube, and the plasmid was extracted as a template for site-directed mutagenesis PCR of the nicotinamide mononucleotide adenylyltransferase mutant. The site-directed mutagenesis PCR was performed using the V6C-Pf and V6C-Pr in Table 1 as mutation primers. The PCR product was transformed and plated, and the VC6 mutant was obtained by screening and named V6C.

[0032] In the second round, site-directed mutagenesis PCR was performed using V6C as a template and Q10E-Pf and Q10E-Pr as primers in Table 1. The PCR products were transformed and plated, and the mutants of V6C mutation and Q10E were obtained by screening and named V6C-Q10E.

[0033] In the third round, site-directed mutagenesis PCR was performed using V6C-Q10E as a template and P11T-Pf and P11T-Pr as primers in Table 1. The PCR products were transformed and plated, and the mutants of V6C mutation and Q10E and P11T were obtained by screening and named V6C-Q10E-P11T.

[0034] The PCR reaction system is as follows: 2×Phanta Max buffer: 25 μL; dNTPs: 1 μL; upstream primer: 2 μL; downstream primer: 2 μL; template: 1 μL; Phanta Super-Fidelity DNA polymerase: 1 μL; ddH2O: 18 μL.

[0035] PCR reaction conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 59°C for 30 s, extension at 72°C for 5 min, for a total of 30 cycles; post-extension at 72°C for 10 min; storage at 4°C.

[0036] The PCR results were verified by DNA agarose gel electrophoresis, and the results showed that the amplified product was a single band with a size of about 6300 bp. The PCR product was then digested with DpnI enzyme template.

[0037] Table 1: Primer sequences V6C-Pf CGTGGTTTGCTGTGCGGTCGCATGCAGCC V6C-Pr CAGCAAACCACGCATGGTATATCTC Q10E-Pf GTGCGGTCGCATGGAACCGTTCCATC Q10E-Pr CATGCGACCGCACAGCAAA P11T-Pf CGGTCGCATGGAAACATTCCATCGTGG P11T-Pr TTCCATGCGACCGCACAG

[0038] Example 5: Large-scale preparation of bacteria Producing NAD by converting NMN + In the process, a large amount of biocatalysts are required, so large-scale preparation of bacteria is required. After the glycerol tube of the preserved nicotinamide mononucleotide transferase expression engineered bacteria is activated by streaking on a plate, a single colony is picked and inoculated into 10mL LB liquid culture medium containing 50μg / mL kana resistance, and shake-cultured at 37℃ for 12h. According to the inoculation volume of 2%, it is transferred to 50mL TB liquid culture medium containing 50μg / mL kana, shake-cultured at 37℃ until OD600 reaches about 0.8, add IPTG with a final concentration of 0.1mM, and shake-cultured at 28℃ for 12h. After the culture is completed, the culture solution is centrifuged at 8000rpm for 10min, the supernatant is discarded, the bacteria are collected, and stored in a -20℃ refrigerator for standby use.

[0039] Example 6: Nicotinamide mononucleotide adenylyltransferase-expressing engineered bacteria catalyzes NMN reaction to generate NAD + process The pure enzyme expressed by the nicotinamide mononucleotide adenylyltransferase gene prepared according to the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a cosubstrate, and the metal ion Mg in MgCl2 was used. 2+, 1mL reaction system was formed with pH=7 phosphate buffer as reaction medium. Catalyst dosage was 0.1g / L pure enzyme, final concentration of NMN was 200mM, final concentration of ATP disodium salt was 200mM, final concentration of MgCl2 was 300mM, 35℃, 600rpm / min, 200μL reaction solution was added to 1.5mL EP tube containing 10μL 6M hydrochloric acid to terminate the reaction. Centrifuge at 12000rpm for 1min, take 100μL supernatant to a new 2mL EP tube, add 900μL ultrapure water, shake and mix for NAD + HPLC detection. NAD + Concentration detection: Unitary C18 column (5μm, 100A, 4.6mm×250mm), mobile phase is 50mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6g sodium dihydrogen phosphate and dissolve it in 800mL ultrapure water, and dilute to 1L.), flow rate is 1mL / min, column oven is 40℃, and detection wavelength is 260nm. Nicotinamide mononucleotide adenylyltransferase (NMNAT) catalyzes the substrate NMN to generate 1μmol product NAD per minute + The amount of enzyme required is 1 enzyme activity unit, expressed as U. After 5 minutes of reaction, 4.33mM of NMN was converted and the enzyme activity was 866U. + The reaction diagram is as follows Figure 1 shown.

[0040] Example 7: Nicotinamide mononucleotide adenylyltransferase-expressing engineered bacterial mutant V6C catalyzes the reaction of NMN to produce NAD + process The pure enzyme expressed by the nicotinamide mononucleotide adenylyltransferase V6C gene prepared by the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a cosubstrate, and the metal ion Mg in MgCl2 was used as a catalyst. 2+ , 1mL reaction system was formed with pH=7 phosphate buffer as reaction medium. Catalyst dosage was 0.1g / L pure enzyme, final concentration of NMN was 200mM, final concentration of ATP disodium salt was 200mM, final concentration of MgCl2 was 300mM, 35℃, 600rpm / min, 200μL reaction solution was added to 1.5mL EP tube containing 10μL 6M hydrochloric acid to terminate the reaction. Centrifuge at 12000rpm for 1min, take 100μL supernatant to a new 2mL EP tube, add 900μL ultrapure water, shake and mix for NAD + HPLC detection. NAD +Concentration detection: Unitary C18 column (5μm, 100A, 4.6mm×250mm), mobile phase is 50mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6g sodium dihydrogen phosphate and dissolve it in 800mL ultrapure water, and dilute to 1L.), flow rate is 1mL / min, column oven is 40℃, and detection wavelength is 260nm. Nicotinamide mononucleotide adenylyltransferase (NMNAT) catalyzes the substrate NMN to generate 1μmol product NAD per minute + The amount of enzyme required is 1 enzyme activity unit, expressed as U. After 5 minutes of reaction, 7.84 mM of NMN was converted and the enzyme activity was 1568 U.

[0041] Example 8: Nicotinamide mononucleotide adenylyltransferase-expressing engineered bacterial mutant V6C-Q10E catalyzes the reaction of NMN to produce NAD + process The pure enzyme expressed by the gene of nicotinamide mononucleotide adenylyltransferase V6C-Q10E prepared by the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a cosubstrate, and the metal ion Mg in MgCl2 was used as a catalyst. 2+ , 1mL reaction system was formed with pH=7 phosphate buffer as reaction medium. Catalyst dosage was 0.1g / L pure enzyme, final concentration of NMN was 200mM, final concentration of ATP disodium salt was 200mM, final concentration of MgCl2 was 300mM, 35℃, 600rpm / min, 200μL reaction solution was added to 1.5mL EP tube containing 10μL 6M hydrochloric acid to terminate the reaction. Centrifuge at 12000rpm for 1min, take 100μL supernatant to a new 2mL EP tube, add 900μL ultrapure water, shake and mix for NAD + HPLC detection. NAD + Concentration detection: Unitary C18 column (5μm, 100A, 4.6mm×250mm), mobile phase is 50mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6g sodium dihydrogen phosphate and dissolve it in 800mL ultrapure water, and dilute to 1L.), flow rate is 1mL / min, column oven is 40℃, and detection wavelength is 260nm. Nicotinamide mononucleotide adenylyltransferase (NMNAT) catalyzes the substrate NMN to generate 1μmol product NAD per minute + The amount of enzyme required is 1 enzyme activity unit, expressed as U. After 5 minutes of reaction, 10.6 mM of NMN was converted and the enzyme activity was 2124 U.

[0042] Example 9: Nicotinamide mononucleotide adenylyltransferase-expressing engineered bacterial mutant V6C-Q10E-P11T catalyzes the reaction of NMN to produce NAD + process The pure enzyme expressed by the gene of nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T prepared by the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a cosubstrate, and the metal ion Mg in MgCl2 was used as a catalyst. 2+ , 1mL reaction system was formed with pH=7 phosphate buffer as reaction medium. Catalyst dosage was 0.1g / L pure enzyme, final concentration of NMN was 200mM, final concentration of ATP disodium salt was 200mM, final concentration of MgCl2 was 300mM, 35℃, 600rpm / min, 200μL reaction solution was added to 1.5mL EP tube containing 10μL 6M hydrochloric acid to terminate the reaction. Centrifuge at 12000rpm for 1min, take 100μL supernatant to a new 2mL EP tube, add 900μL ultrapure water, shake and mix for NAD + HPLC detection. NAD + Concentration detection: Unitary C18 column (5μm, 100A, 4.6mm×250mm), mobile phase is 50mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6g sodium dihydrogen phosphate and dissolve it in 800mL ultrapure water, and dilute to 1L.), flow rate is 1mL / min, column oven is 40℃, and detection wavelength is 260nm. Nicotinamide mononucleotide adenylyltransferase (NMNAT) catalyzes the substrate NMN to generate 1μmol product NAD per minute + The amount of enzyme required is 1 enzyme activity unit, expressed as U. After 5 minutes of reaction, 13.3 mM of NMN was converted and the enzyme activity was 2664 U.

[0043] Example 10: Engineering bacteria expressing nicotinamide mononucleotide adenylyltransferase gene and its mutants catalyze NMN reaction to generate NAD + Changes in enzyme activity during the process 0.1 g / L nicotinamide mononucleotide adenylyltransferase or pure enzyme of nicotinamide mononucleotide adenylyltransferase mutant engineered bacteria was used as catalyst. NMN was used as substrate and ATP disodium salt was used as co-substrate. The metal ion Mg in MgCl2 was used as catalyst. 2+ , and a 1 mL reaction system was formed with a phosphate buffer solution at pH = 7 as the reaction medium. After 5 minutes of reaction, samples were taken for liquid phase analysis. The results showed that compared with nicotinamide mononucleotide adenylyltransferase, the enzymatic activity of the V6C mutant increased by 178.2%, the yield of the V6C-Q10E mutant increased by 245.7%, and the yield of the V6C-Q10E-P11T mutant increased by 307.7%.

[0044] Example 11: Nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene-expressing engineered bacteria catalyzes NMN reaction to generate NAD+ Optimization of process pH The pure enzyme expressed by the nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene prepared according to the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a cosubstrate, and the metal ion Mg in MgCl2 was used as a catalyst. 2+ , 1mL reaction system was formed with phosphate buffer of pH=6.5, pH=7, pH=7.5, and pH=8 as reaction medium. The catalyst dosage was 0.1g / L pure enzyme, the final concentration of NMN was 200mM, the final concentration of ATP disodium salt was 200mM, and the final concentration of MgCl2 was 300mM. At 35°C and 600rpm / min, 200μL of reaction solution was added to a 1.5mL EP tube containing 10μL 6M hydrochloric acid to terminate the reaction. Centrifuge at 12000rpm for 1min, take 100μL of supernatant to a new 2mL EP tube, add 900μL ultrapure water, and shake to mix for NAD + HPLC detection. NAD + Concentration detection: Unitary C18 column (5μm, 100A, 4.6mm×250mm), mobile phase is 50mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6g sodium dihydrogen phosphate and dissolve it in 800mL ultrapure water, and dilute to 1L.), flow rate is 1mL / min, column oven is 40℃, and detection wavelength is 260nm. Nicotinamide mononucleotide adenylyltransferase (NMNAT) catalyzes the substrate NMN to generate 1μmol product NAD per minute + The amount of enzyme required is 1 enzyme activity unit, represented by U.

[0045] After 5 minutes of reaction, the pH value was 6.5 and the NAD + Generate 17.6mM, enzyme activity is 3526.1U; pH=7 system NAD + Generate 18.6mM, enzyme activity is 3722.6U; pH = 7.5 system NAD + Generate 16.7mM, enzyme activity is 3338.2U; pH=8 system NAD + The production of 15.5mM, enzyme activity is 3104.2U. The engineered bacteria expressing the nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyzes the NMN reaction to produce NAD + The optimum pH during the process is 7.0.

[0046] Example 12: Engineering bacteria expressing the nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyzes the NMN reaction to produce NAD + Optimization of process temperature The pure enzyme expressed by the nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene prepared according to the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a cosubstrate, and the metal ion Mg in MgCl2 was used as a catalyst. 2+ , a 1mL reaction system was formed with a phosphate buffer solution at pH=7.0 as the reaction medium. The catalyst dosage was 0.1g / L pure enzyme, the final concentration of NMN was 200mM, the final concentration of ATP disodium salt was 200mM, the final concentration of MgCl2 was 300mM, the reaction temperatures were 30℃, 35℃, 40℃, 45℃, 50℃, 600rpm / min for 5min, 100μL of the reaction solution was added to a 1.5mL EP tube containing 5μL 6M hydrochloric acid to terminate the reaction. Centrifuge at 12000rpm for 1min, take 100μL of the supernatant to a new 2mL EP tube, add 900μL ultrapure water, and shake to mix for NAD + HPLC detection. NAD + Concentration detection: Unitary C18 column (5μm, 100A, 4.6mm×250mm), mobile phase is 50mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6g sodium dihydrogen phosphate and dissolve it in 800mL ultrapure water, and dilute to 1L.), flow rate is 1mL / min, column oven is 40℃, and detection wavelength is 260nm. Nicotinamide mononucleotide adenylyltransferase (NMNAT) catalyzes the substrate NMN to generate 1μmol product NAD per minute + The amount of enzyme required is 1 enzyme activity unit, represented by U.

[0047] After 5 minutes of reaction, NAD + The generated enzyme activity was 1999.1U; NAD + The generated enzyme activity was 15.0mM and 2997.9U; NAD + The generated enzyme activity was 3790.4U and the NAD in the reaction system at 45℃ was 19.0mM. + The NAD in the reaction system at 50°C was 23.1 mM and the enzyme activity was 4620.1 U. + The production of 19.7mM, enzyme activity of 3940.6U. The engineered bacteria expressing the nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyzes the NMN reaction to produce NAD + The optimum reaction temperature during the process is 45°C.

[0048] Example 13: Nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene-expressed engineered bacteria catalyzes NMN reaction to generate NAD +Optimization of the amount of ATP disodium salt added during the process The pure enzyme expressed by the nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene prepared according to the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a cosubstrate, and the metal ion Mg in MgCl2 was used as a catalyst. 2+ , a 1mL reaction system was formed with a phosphate buffer solution at pH=7.0 as the reaction medium. The catalyst dosage was 0.1g / L pure enzyme, the final concentration of NMN was 200mM, the final concentrations of ATP disodium salt were 100mM, 150mM, 200mM, and 250mM, respectively, the final concentration of MgCl2 was 300mM, the reaction temperature was 45°C, and the reaction was carried out at 600rpm / min for 2h. 100μL of the reaction solution was added to a 1.5mL EP tube containing 5μL 6M hydrochloric acid to terminate the reaction. Centrifuge at 12000rpm for 1min, take 20μL of the supernatant to a new 2mL EP tube, add 980μL ultrapure water, and shake to mix for NAD + HPLC detection. NAD + Concentration detection: Unitary C18 chromatographic column (5μm, 100A, 4.6mm×250mm), mobile phase is 50mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6g sodium dihydrogen phosphate and dissolve it in 800mL ultrapure water, and make up to 1L.), flow rate is 1mL / min, column oven is 40℃, and detection wavelength is 260nm.

[0049] After 1 hour of reaction, 60.9 mM of NMN was converted in the reaction system with a final concentration of 100 mM ATP disodium salt, with a conversion rate of 30.5%; 71.02 mM of NMN was converted in the reaction system with a final concentration of 150 mM ATP disodium salt, with a conversion rate of 35.6%; 85.2 mM of NMN was converted in the reaction system with a final concentration of 200 mM ATP disodium salt, with a conversion rate of 42.6%; 84.5 mM of NMN was converted in the reaction system with a final concentration of 250 mM ATP disodium salt, with a conversion rate of 42.2%. The engineered bacteria expressing the nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyze the NMN reaction to generate NAD + The optimal amount of ATP disodium salt added during the process is 200 mM.

[0050] Example 14: Nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene-expressing engineered bacteria catalyzes NMN reaction to generate NAD + Optimization of MgCl2 addition during the process The pure enzyme expressed by the nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene prepared according to the method in Example 4 was used as a catalyst, NMN was used as a substrate, ATP disodium salt was used as a cosubstrate, and the metal ion Mg in MgCl2 was used as a catalyst. 2+ , a 10mL reaction system was formed with a phosphate buffer solution at pH=7.0 as the reaction medium. The catalyst dosage was 0.1g / L pure enzyme, the final concentration of NMN was 200mM, the final concentration of ATP disodium salt was 200mM, the final concentration of MgCl2 was 100mM, 200mM, 300mM, 400mM, respectively, the reaction temperature was 45°C, and the reaction was carried out at 600rpm / min for 2h. 100μL of the reaction solution was added to a 1.5mL EP tube containing 5μL 6M hydrochloric acid to terminate the reaction. Centrifuge at 12000rpm for 1min, take 20μL of the supernatant to a new 2mL EP tube, add 980μL ultrapure water, and shake to mix for NAD + HPLC detection. NAD + Concentration detection: Unitary C18 chromatographic column (5μm, 100A, 4.6mm×250mm), mobile phase is 50mM sodium dihydrogen phosphate solution: methanol = 94:6 (sodium dihydrogen phosphate solution: weigh 6g sodium dihydrogen phosphate and dissolve it in 800mL ultrapure water, and make up to 1L.), flow rate is 1mL / min, column oven is 40℃, and detection wavelength is 260nm.

[0051] After 1 hour of reaction, 78.3 mM of NMN was converted in the reaction system with a final MgCl2 concentration of 100 mM, with a conversion rate of 39.1%; 90.7 mM of NMN was converted in the reaction system with a final MgCl2 concentration of 200 mM, with a conversion rate of 45.3%; 92.2 mM of NMN was converted in the reaction system with a final MgCl2 concentration of 300 mM, with a conversion rate of 46.1%; and 62.8 mM of NMN was converted in the reaction system with a final MgCl2 concentration of 400 mM, with a conversion rate of 31.4%. The engineered bacteria expressing the nicotinamide mononucleotide adenylyltransferase V6C-Q10E-P11T gene catalyze the reaction of NMN to generate NAD + The optimal amount of MgCl2 added during the process was 300 mM.

[0052] The above description is only a detailed description of the preferred embodiments and principles of the present invention. For ordinary technicians in this field, according to the ideas provided by the present invention, there will be changes in the specific implementation methods, and these changes should also be regarded as the protection scope of the present invention.

Claims

1. A nicotinamide mononucleotide adenylyltransferase mutant, characterized in that: The amino acid sequence is derived from the amino acid sequence shown in SEQ ID NO. 1 by site-directed mutagenesis, wherein the mutation site is one or more of the following: (1) position 6, (2) position 10, and (3) position 11.

2. A nicotinamide mononucleotide adenylyltransferase mutant according to claim 1, characterized in that: The mutant is obtained by mutation of the amino acids in the sequence shown in SEQ ID NO.1 at one or more of the following sites: (1) valine V at position 6 is mutated to cysteine ​​C, (2) glutamine Q at position 10 is mutated to glutamic acid E, and (3) proline P at position 11 is mutated to threonine T.

3. A gene encoding the nicotinamide mononucleotide adenylyltransferase mutant according to claim 1.

4. The coding gene according to claim 3, characterized in that The nucleotide sequence of the encoding gene is shown in SEQ ID NO.4; the amino acid sequence of the nicotinamide mononucleotide adenylyltransferase mutant is shown in SEQ ID NO.

3.

5. A recombinant vector comprising the coding gene according to claim 3 or 4.

6. A recombinant genetically engineered bacterium comprising the recombinant vector according to claim 5.

7. Use of the nicotinamide mononucleotide adenylyltransferase mutant according to claim 1 or 2 in biocatalytic synthesis of nicotinamide adenine dinucleotide.

8. The use according to claim 7, characterized in that: The application is: using wet bacteria obtained by fermentation culture of recombinant genetically engineered bacteria containing a gene encoding a mutant of nicotinamide mononucleotide adenosyltransferase or pure enzyme extracted from wet bacteria after ultrasonic crushing as a catalyst, using nicotinamide mononucleotide as a substrate, and ATP disodium salt as a cosubstrate, in the presence of Mg 2+ In the presence of 5-nitropropene, the reaction is carried out at 30-50°C in a PB buffer solution with a pH value of 6.5-8. After the reaction is complete, nicotinamide adenine dinucleotide is obtained.

9. The use according to claim 8, characterized in that: In the reaction system, when the catalyst is wet bacteria, the amount of wet bacteria added is 5~20g / L; when the catalyst is pure enzyme, the amount of pure enzyme added is 0.01~1.0g / L; the final concentration of nicotinamide mononucleotide added is 33.4~167g / L; the final concentration of ATP disodium salt added is 55.3~276.5g / L; the final concentration of Mg added is 1.5~2.0 ... 2+ The final concentration is 14.25~71.25g / L.

10. The use according to claim 8, characterized in that: In the reaction system, the molar ratio of nicotinamide mononucleotide to ATP disodium salt is 1:0.5~1.5; the molar ratio of nicotinamide mononucleotide to Mg 2+ The molar ratio is 1:0.5~2.

Images